1qwa

NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.

spinqualitylabelsall models 1qwa Show:Asymmetric Unit Biological Assembly Drag the structure with the mouse to rotate   Export Animated Image   Print3D Structural highlights 1qwa is a 1 chain structure with sequence from Mus musculus. Full experimental information is available from OCA. For a guided tour on the structure components use FirstGlance. Method: Solution NMR Resources: FirstGlance, OCA, PDBe, RCSB, PDBsum, ProSAT

Proteopedia Page Contributors and Editors (what is this?)

OCA