
<?xml version="1.0"?>
<feed xmlns="http://www.w3.org/2005/Atom" xml:lang="en">
	<id>https://proteopedia.org/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=Fantin+Mesny</id>
	<title>Proteopedia - User contributions [en]</title>
	<link rel="self" type="application/atom+xml" href="https://proteopedia.org/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=Fantin+Mesny"/>
	<link rel="alternate" type="text/html" href="https://proteopedia.org/Special:Contributions/Fantin_Mesny"/>
	<updated>2026-09-25T05:00:40Z</updated>
	<subtitle>User contributions</subtitle>
	<generator>MediaWiki 1.43.8</generator>
	<entry>
		<id>https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2526349</id>
		<title>Sandbox Reserved 1120</title>
		<link rel="alternate" type="text/html" href="https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2526349"/>
		<updated>2016-01-30T15:11:27Z</updated>

		<summary type="html">&lt;p&gt;Fantin Mesny: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{Sandbox_Reserved_ESBS_2015}}&amp;lt;!-- PLEASE ADD YOUR CONTENT BELOW HERE --&amp;gt;&lt;br /&gt;
=SRY protein (AKA TDF protein)=&lt;br /&gt;
&amp;lt;StructureSection load=&#039;1hry&#039; size=&#039;340&#039; frame=&#039;true&#039; side=&#039;right&#039; caption=&#039;The SRY protein linked to DNA&#039; scene=&#039;71/719861/Base/1&#039;&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;table&amp;gt;&amp;lt;tr&amp;gt;&amp;lt;td colspan=&#039;2&#039;&amp;gt;The SRY protein is a 204 residues-long monomeric polypeptide. It is encoded by the SRY gene and is involved in the sex determination in mammals by being responsible for the gonadogenesis and so the male sexual development. It is the HMG-box that gives to the protein its ability to bind DNA by its minor groove&amp;lt;ref name =&amp;quot;Tang&amp;quot;&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;.&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr id=&#039;related&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;[[Related_structure|Related:]]&amp;lt;/b&amp;gt;&amp;lt;/td&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;[[1hrz|1hrz]]&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr id=&#039;resources&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Resources:&amp;lt;/b&amp;gt;&amp;lt;/td&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;&amp;lt;span class=&#039;plainlinks&#039;&amp;gt;[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=1hry FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=1hry OCA], [http://pdbe.org/1hry PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=1hry RCSB], [http://www.ebi.ac.uk/pdbsum/1hry PDBsum]&lt;br /&gt;
&amp;lt;tr id=&#039;Gene&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Encoded by&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;The SRY gene codes for the SRY protein&lt;br /&gt;
&amp;lt;tr id=&#039;Length&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Length&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;204 residues&lt;br /&gt;
&amp;lt;tr id=&#039;Molecular weight&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Molecular weight&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;≈23kDa&lt;br /&gt;
&amp;lt;tr id=&#039;DNA target sequence&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;DNA target sequence&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;(5&#039;-dGCACAAAC)&lt;br /&gt;
&amp;lt;tr id=&#039;Regulation&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Regulation&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;[https://en.wikipedia.org/wiki/Steroidogenic_factor_1 Sf1];[https://en.wikipedia.org/wiki/Sp1_transcription_factor Sp1] (binding site in the promoter of SRY : -150),[https://en.wikipedia.org/wiki/WT1 WT1] (binding site in the promoter of SRY : -87)&lt;br /&gt;
&amp;lt;tr id=&#039;Role&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Role&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;Transcription factor&lt;br /&gt;
&amp;lt;tr id=&#039;Genes targeted&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Genes targeted&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;&amp;lt;i&amp;gt;SOX9&amp;lt;/i&amp;gt;, &amp;lt;i&amp;gt;TH&amp;lt;/i&amp;gt;, &amp;lt;i&amp;gt;MAOA&amp;lt;/i&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;/span&amp;gt;&lt;br /&gt;
&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;/table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==History==&lt;br /&gt;
&lt;br /&gt;
After centuries of unfounded theories mainly based on environmental factors, the first molecular theory concerning the sex determination appeared in 1891. At this time, the german biologist Hermann Henking was studying sperm formation in wasps. As a chromosome which was not present in all the wasps looked different from the others, he suspected it to play a role in sex determination and called it the &amp;quot;X chromosome&amp;quot;.&lt;br /&gt;
Ten years later, Clarence Erwin McClung saw that this chromosome behaved differently during the meiosis and was only present in half the sperm cells of grasshoppers. As the main characteristic that varies in 50/50 proportions among zygotes is the sex, McClung suspected the X chromosome to be implicated in sexual development. &lt;br /&gt;
In 1905, Nettie Stevens discovered the &amp;quot;Y chromosome&amp;quot; (and the female XX and male XY patterns) while she was counting the chromosomes of beetles under the microscope&amp;lt;ref&amp;gt;Sumner, A. T. Sex Chromosomes and Sex Determination. Chromosomes: Organization and Function, 97-108. [http://www.nature.com/scitable/nated/topicpage/Sex-Chromosomes-and-Sex-Determination-44565]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
During the next decades, a few theories were in competition. In 1921, Calvin Bridges&#039;s works on &#039;&#039;Drosophila melanogaster&#039;&#039; seemed to reveal that male characters acquisition is due to a genic balance between the genes contained in the X chromosome and those contained in the autosomes&amp;lt;ref&amp;gt;PMID: 17769897&amp;lt;/ref&amp;gt;.&lt;br /&gt;
In 1930, Ronald Fisher introduced the first Y-based control of sex theory by proposing two different models : either all the genes responsible for the male characters are located on the Y chromosome or there is a Y-located gene which regulates the expression of genes elsewhere in the genome&amp;lt;ref name=&amp;quot;Goodfellow&amp;quot;&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt;.&lt;br /&gt;
As Alfred Jost had shown the testosterone produced by the testis is responsible for the entire male phenotype acquisition&amp;lt;ref&amp;gt;PMID: 4805859&amp;lt;/ref&amp;gt;, Peter Neville Goodfellow proposed in 1988, that there is a gene (&#039;&#039;TDF&#039;&#039; in human, &#039;&#039;Tdy&#039;&#039; in mice)  on the Y chromosome which drives the development of the testis&amp;lt;ref name=&amp;quot;Goodfellow&amp;quot; /&amp;gt;. In 1990, Goodfellow&#039;s hypothesis was validated with the discovery of &#039;&#039;Tdy&#039;&#039;&#039;s localisation. This gene&#039;s product (expressed during the male gonadal development) owns an amino-acid motif which shows homology to other known or putative DNA-binding domains. &#039;&#039;Tdy&#039;&#039; is therefore a transcriptional factor&amp;lt;ref&amp;gt;PMID: 2374589&amp;lt;/ref&amp;gt;. The same year, the human &#039;&#039;SRY&#039;&#039; gene (accepted later as the &#039;&#039;TDF&#039;&#039;) was discovered&amp;lt;ref&amp;gt;PMID: 1695712&amp;lt;/ref&amp;gt;. &lt;br /&gt;
Three dimensional structure of the SRY protein was determined in 1995 using NMR spectroscopy&amp;lt;ref&amp;gt;PMID:7774012&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
==SRY gene==&lt;br /&gt;
&lt;br /&gt;
The SRY gene encodes the SRY protein. The SRY protein is a transcriptional factor that induces the male phenotype in the embryo. The SRY gene is located on the [https://en.wikipedia.org/wiki/Y_chromosome Y chromosome] in the short arm (p) 11.3 &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/gene/6736 NCBI gene]&amp;lt;/ref&amp;gt;. This gene has only one exon that contains the HMG domain (DNA-binding High-Mobility Group box domain). It means that SRY mRNA does not have an alternative splicing, so there is only one isoforme of SRY protein&amp;lt;ref name=&amp;quot;McE&amp;quot;&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;. Moreover, the human genome contains only one copy of the SRY gene, whereas the mouse genome contains 6 copy of this gene&amp;lt;ref&amp;gt; Sekido R, Lovell-Badge R. Genetic control of testis development. Sex Dev Genet Mol Biol Evol Endocrinol Embryol Pathol Sex Determ Differ. 2013;7(1-3):21–32 &amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Sequence of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:90%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
&amp;gt;gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/nuccore NCBI nucleotide]&amp;lt;/ref&amp;gt;&lt;br /&gt;
TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT&lt;br /&gt;
TTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACA&lt;br /&gt;
&amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;ATG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;CAATCATATGCTTCTGCTATGTTAAGCGTATTCAACAGCGATGATTACAGTCCAGCTGTGCAAGAGAAT&lt;br /&gt;
ATTCCCGCTCTCCGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTAAGTATCAGTGTGAAA&lt;br /&gt;
CGGGAGAAAACAGTAAAGGCAACGTCCAGGATAGAGTGAAGCGACCCATGAACGCATTCATCGTGTGGTC&lt;br /&gt;
&#039;&#039;&#039;TCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCAGAGATCAGCAAGCAGCTG&lt;br /&gt;
&#039;&#039;&#039;GGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCATTCTTCCAGGAGGCACAGAAATTACAGG&lt;br /&gt;
&#039;&#039;&#039;CCATGCACAGAGAGAAATACCCGAATTATAAGTATCGA&#039;&#039;&#039;CCTCGTCGGAAGGCGAAGATGCTGCCGAAGAA&lt;br /&gt;
TTGCAGTTTGCTTCCCGCAGATCCCGCTTCGGTACTCTGCAGCGAAGTGCAACTGGACAACAGGTTGTAC&lt;br /&gt;
AGGGATGACTGTACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAACG&lt;br /&gt;
CAGCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTG&amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;TAG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;GACAATCGGGTAACATT&lt;br /&gt;
GGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCACTTTCTTATGTTTAGTTT&lt;br /&gt;
CAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCATTTCA&amp;lt;/small&amp;gt;&lt;br /&gt;
&lt;br /&gt;
(Legend : &amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Initiation codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt; ; &amp;lt;b&amp;gt;HMG sequence&amp;lt;/b&amp;gt; ; &amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Stop codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;)&lt;br /&gt;
&amp;lt;/div&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Regulation of the expression of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
In humans, the SRY promoter is located between −408 and −95 bp. Moreover, the SRY gene has enhancers at -727 pb. The linkage between regulatory proteins and these enhancers has the property to increase the production of SRY proteins. These regulatory proteins could be: SF1 (steroidogenic factor 1), SP1  and WT 1 (Wilms tumor)&amp;lt;ref name=&amp;quot;Harley&amp;quot;&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;SF1&#039;&#039;&#039;: this transcriptional factor belongs to the family of nuclear hormone receptors and contains a zinc finger. The activation of this protein requires a ligand (hormone).&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;SP1&#039;&#039;&#039;: this transcriptional factor is an ubiquitous protein which binds rich GC-sites and is implicated in the transcription of many genes. Moreover, this protein contains a zinc finger.&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;WT1&#039;&#039;&#039;: this transcriptional factor transactivates the SRY gene. It contains a zinc finger&amp;lt;ref&amp;gt;Larney C, Bailey TL, Koopman P. Switching on sex: transcriptional regulation of the testis-determining gene Sry. Dev Camb Engl. 2014 Jun;141(11):2195–205&amp;lt;/ref&amp;gt;. &lt;br /&gt;
&lt;br /&gt;
==Structure==&lt;br /&gt;
&lt;br /&gt;
===The SRY-HMG domain (HMG-Box)===&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;&#039;SRY-HMG&#039;&#039;&#039; stands for &#039;&#039;&#039;S&#039;&#039;&#039;ex determining &#039;&#039;&#039;R&#039;&#039;&#039;egion &#039;&#039;&#039;Y&#039;&#039;&#039; - &#039;&#039;&#039;H&#039;&#039;&#039;igh &#039;&#039;&#039;M&#039;&#039;&#039;obility &#039;&#039;&#039;G&#039;&#039;&#039;roup domain.&lt;br /&gt;
It is approximately 80 residues-long. It mediates the binding of the protein to the minor groove of DNA. It is the most important part of the SRY protein. Not only because it enables  the protein to bind the DNA but also because even a single mutation can cause an inactivation of the protein.&lt;br /&gt;
&lt;br /&gt;
It has a twisted L shape: it has a long (28Å) and a short (22Å) arm. The HMG Box is made of 3 helices. Its N-term and C-term domains are irregular. The overall structure is stabilized by a hydrophobic core especially at the intersection of the 3 helices where 3 aromatics cycles meet, surrounded by aliphatic aminoacids.&lt;br /&gt;
See the different structures:&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_1/3&#039;&amp;gt;Helix 1&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_2/2&#039;&amp;gt;Helix 2&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_3/1&#039;&amp;gt;Helix 3&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Long_arm_28a/1&#039;&amp;gt;Long arm (28Å)&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Short_arm_22a/1&#039;&amp;gt;Short arm (22Å)&amp;lt;/scene&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The interaction between the HMG-Box and DNA is specific and stable.  It is mostly hydrophobic. It permits the DNA to bend of DNA (≈75°). Only one molecule of water interfaces the Box and the DNA. The complex is stabilized by salt bridges between positively charged residues of the HMG domain and negatively charged phosphates&amp;lt;ref name=&amp;quot;Tang&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
[[Image:HHMG-bitmap.png|thumb|alt=Image bitmap|Linear structure of hHMG domain]]&lt;br /&gt;
&lt;br /&gt;
The binding of SRY on DNA is specific. The DNA target site is a DNA octamer :&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:30%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
(5&#039;-dGCACAAAC)&amp;lt;br/&amp;gt;&lt;br /&gt;
(5&#039;-dGTTTGTGC)&lt;br /&gt;
&amp;lt;/small&amp;gt;&amp;lt;/div&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
This sequence is found in the promoters of genes expressed during the testicular development.&lt;br /&gt;
The bend of DNA enables the recruitment of different proteins and the building of massive proteins-DNA complexes that could change the expression of different genes&amp;lt;ref&amp;gt;PMID:11563911&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
Even if the most important function of the HMG box is binding and bending DNA, it is also involved in DNA condensation, recombination and repair.&lt;br /&gt;
&lt;br /&gt;
There are two kinds of proteins that contain a HMG box:&lt;br /&gt;
* &#039;&#039;&#039;HMG1&#039;&#039;&#039; : It is expressed in few cell types. It is found in transcription factors that contain a single HMG box. The binding of a DNA sequence is specific.&lt;br /&gt;
* &#039;&#039;&#039;HMG2&#039;&#039;&#039; : It is found in all cell types and is abundant in chromatin. These proteins can contain two or more HMG boxes that can non-specifically bind DNA. &lt;br /&gt;
&lt;br /&gt;
===General structure of SRY===&lt;br /&gt;
&lt;br /&gt;
The overall structure of SRY is organized around the HMG-box.&lt;br /&gt;
3 domains:&lt;br /&gt;
* N-term domain&lt;br /&gt;
* Central domain : DNA binding (HMG box)&lt;br /&gt;
* C-term domain&lt;br /&gt;
&lt;br /&gt;
== Function ==&lt;br /&gt;
&lt;br /&gt;
===Sex determining===&lt;br /&gt;
&lt;br /&gt;
It acts like a sex determining factor thanks to its transcriptional activity. It inhibits the development of female sex structures in the embryonic individual.&lt;br /&gt;
&lt;br /&gt;
The SRY protein contains nuclear localization signals in N and C terminals. An acetylation of these domains allows the exportation of the SRY protein to the nucleus&amp;lt;ref name=&amp;quot;Harley&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
The SRY protein activates the &#039;&#039;SOX9&#039;&#039; (SRY-box9) gene &amp;lt;ref name=&amp;quot;McE&amp;quot; /&amp;gt;. This gene is found in long arm 24.3 of the chromosome 17&amp;lt;ref&amp;gt; NCBI [http://www.ncbi.nlm.nih.gov/gene/6662 NCBI gene: SOX9 SRY-BOX9 Homo sapiens] &amp;lt;/ref&amp;gt; and is implicated in the stimulation of the differentiation of pre-Sertori into Sertoli cells rather than granulosa cells.&lt;br /&gt;
&lt;br /&gt;
The activation of &#039;&#039;SOX&#039;&#039;9 is done by the SRY protein and another transcriptional factor: SF1 (steroidogenic factor 1). These transcriptional factors are bound on an enhancer called: TESCO (Testis-Specific Enhancer of &#039;&#039;SOX9&#039;&#039; core element). The binding of a transcriptional factor on an enhancer provokes a curvature of the DNA (≈75°), allowing a stabilization of the elongation complex on the &#039;&#039;SOX9&#039;&#039; promoter. The SOX9 protein activates the gene &#039;&#039;AMH&#039;&#039; (Anti-Mullerian Hormone)&amp;lt;ref&amp;gt;[http://www.ebi.ac.uk/interpro/entry/IPR006799?q=AMH EBI-Interpro: Anti-Mullerian-Hormon, N-term] &amp;lt;/ref&amp;gt;. Therefore, it allows the degeneration of the channels of Müller in male&amp;lt;ref name=&amp;quot;Harley&amp;quot; /&amp;gt;.&lt;br /&gt;
===Cathecolamines regulation===&lt;br /&gt;
&lt;br /&gt;
It has been shown that SRY is present in brain regions and activates the Tyrosine-3-Hydroxylase expression. This enzyme catalyses the rate-limiting step of catecholamine synthesis (L-Tyrosine to L-DOPA). Furthermore, SRY also activates the expression of Monoamine Oxidase A which is responsible for the inactivation of catecholamines. Therefore, it regulates both positively and negatively the catecholamines concentration&amp;lt;ref name=&amp;quot;Veitia&amp;quot;&amp;gt;PMID: 24604382&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Other extra-testicular effects===&lt;br /&gt;
&lt;br /&gt;
Some knock-down experiments have shown that SRY may also be a major actor in the dopamine pathway. On the peripheral side, it seems to regulate noradrenaline levels and blood pressure&amp;lt;ref name=&amp;quot;Veitia&amp;quot; /&amp;gt;. A researcher who contributed to discovering these effects says it might explain why &amp;quot;the aggressive fight-or-flight reaction is more dominant in men, while women predominantly adopt a less aggressive tend-and-befriend response&amp;quot;&amp;lt;ref&amp;gt;Cohen, Tamara. The &#039;macho&#039; gene that makes men behave aggressively has been found. The Daily Mail (2012). [http://www.dailymail.co.uk/sciencetech/article-2111668/The-macho-gene-makes-men-aggressive-found.html#ixzz3yZC2BV4k]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
It has been shown that SRY may be involved in the regulation of the renin-angiotensin system in mice. Indeed, sequence mutations of the protein lead to hypertension. Because the human&#039;s SRY organisation is very closed to the mouse&#039;s, it has been proposed that SRY may have the same function in humans but it has not been studied directly&amp;lt;ref&amp;gt;PMID:22315667&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
== Diseases==&lt;br /&gt;
&lt;br /&gt;
=== Swyer syndrome (AKA XY gonadal dysgenis)===&lt;br /&gt;
&lt;br /&gt;
If the TDF protein is not able to bind its targeted DNA sequences, the genes responsible for the testis development are not expressed. The patient owning this defective protein will then develop female characters, even though he has a XY karyotype. This phenomenon is known as the &amp;quot;Swyer Syndrome&amp;quot;. &lt;br /&gt;
Different causes can explain this &amp;quot;XY gonadal dysgenis&amp;quot;, as it is also called. About thirty mutations (named [http://www.uniprot.org/uniprot/Q05066#sequences &amp;quot;SRXY1&amp;quot;]) in the SRY gene have been shown to drive this phenotype development. It can also be due to crossovers during a meiosis. If a Y chromosome portion carrying the SRY gene is recombined into a X chromosome, a sperm cell will get this abnormal Y chromosome. If it then fecundates, a XY karyotype without any SRY gene will be formed. &lt;br /&gt;
&lt;br /&gt;
=== De La Chapelle syndrome (AKA XX male syndrome)===&lt;br /&gt;
&lt;br /&gt;
From the meiosis just described would also result an abnormal X chromosome, carrying the SRY gene. If the sperm cell owning this chromosome fecundates an ovule, the resulting newborn will have a XX karyotype but a male phenotype. This is called the &amp;quot;De La Chapelle syndrome&amp;quot;. In this case, the patient can either develop testis or both testis and ovarian tissues. As some epigenetic mechanisms can inactivate the X chromosome carrying SRY, this syndrome keeps most of the patients sterile&amp;lt;ref&amp;gt;PMID: 4622299&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Hepatocellular carcinoma===&lt;br /&gt;
 &lt;br /&gt;
In the case on a hepatocellular carcinoma, it has been proved that high expression levels of SRY help cancer progression and poor patient survival. However, it still seems that hepatocellular carcinoma is not most likely to develop in men&amp;lt;ref&amp;gt;PMID: 25274159&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
== Structural highlights ==&lt;br /&gt;
&lt;br /&gt;
This is a sample scene created with SAT to &amp;lt;scene name=&amp;quot;/12/3456/Sample/1&amp;quot;&amp;gt;color&amp;lt;/scene&amp;gt; by Group, and another to make &amp;lt;scene name=&amp;quot;/12/3456/Sample/2&amp;quot;&amp;gt;a transparent representation&amp;lt;/scene&amp;gt; of the protein. You can make your own scenes on SAT starting from scratch or loading and editing one of these sample scenes.&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_1/3&#039;&amp;gt;Helix 1&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_2/2&#039;&amp;gt;Helix 2&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_3/1&#039;&amp;gt;Helix 3&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Long_arm_28Å/1&#039;&amp;gt;Long arm (28A)&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Short_arm_22Å/1&#039;&amp;gt;Short arm (22A)&amp;lt;/scene&amp;gt;&lt;br /&gt;
&amp;lt;/StructureSection&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== References ==&lt;br /&gt;
&amp;lt;references/&amp;gt;&lt;/div&gt;</summary>
		<author><name>Fantin Mesny</name></author>
	</entry>
	<entry>
		<id>https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2526348</id>
		<title>Sandbox Reserved 1120</title>
		<link rel="alternate" type="text/html" href="https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2526348"/>
		<updated>2016-01-30T15:07:16Z</updated>

		<summary type="html">&lt;p&gt;Fantin Mesny: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{Sandbox_Reserved_ESBS_2015}}&amp;lt;!-- PLEASE ADD YOUR CONTENT BELOW HERE --&amp;gt;&lt;br /&gt;
=SRY protein (AKA TDF protein)=&lt;br /&gt;
&amp;lt;StructureSection load=&#039;1hry&#039; size=&#039;340&#039; frame=&#039;true&#039; side=&#039;right&#039; caption=&#039;The SRY protein linked to DNA&#039; scene=&#039;71/719861/Base/1&#039;&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;table&amp;gt;&amp;lt;tr&amp;gt;&amp;lt;td colspan=&#039;2&#039;&amp;gt;The SRY protein is a 204 residues-long monomeric polypeptide. It is encoded by the SRY gene and is involved in the sex determination in mammals by being responsible for the gonadogenesis and so the male sexual development. It is the HMG-box that gives to the protein its ability to bind DNA by its minor groove&amp;lt;ref name =&amp;quot;Tang&amp;quot;&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;.&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr id=&#039;related&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;[[Related_structure|Related:]]&amp;lt;/b&amp;gt;&amp;lt;/td&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;[[1hrz|1hrz]]&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr id=&#039;resources&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Resources:&amp;lt;/b&amp;gt;&amp;lt;/td&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;&amp;lt;span class=&#039;plainlinks&#039;&amp;gt;[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=1hry FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=1hry OCA], [http://pdbe.org/1hry PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=1hry RCSB], [http://www.ebi.ac.uk/pdbsum/1hry PDBsum]&lt;br /&gt;
&amp;lt;tr id=&#039;Gene&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Encoded by&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;The SRY gene codes for the SRY protein&lt;br /&gt;
&amp;lt;tr id=&#039;Length&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Length&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;204 residues&lt;br /&gt;
&amp;lt;tr id=&#039;Molecular weight&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Molecular weight&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;≈23kDa&lt;br /&gt;
&amp;lt;tr id=&#039;DNA target sequence&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;DNA target sequence&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;(5&#039;-dGCACAAAC)&lt;br /&gt;
&amp;lt;tr id=&#039;Regulation&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Regulation&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;[https://en.wikipedia.org/wiki/Steroidogenic_factor_1 Sf1];[https://en.wikipedia.org/wiki/Sp1_transcription_factor Sp1] (binding site in the promoter of SRY : -150),[https://en.wikipedia.org/wiki/WT1 WT1] (binding site in the promoter of SRY : -87)&lt;br /&gt;
&amp;lt;tr id=&#039;Role&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Role&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;Transcription factor&lt;br /&gt;
&amp;lt;tr id=&#039;Genes targeted&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Genes targeted&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;&amp;lt;i&amp;gt;SOX9&amp;lt;/i&amp;gt;, &amp;lt;i&amp;gt;TH&amp;lt;/i&amp;gt;, &amp;lt;i&amp;gt;MAOA&amp;lt;/i&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;/span&amp;gt;&lt;br /&gt;
&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;/table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==History==&lt;br /&gt;
&lt;br /&gt;
After centuries of unfounded theories mainly based on environmental factors, the first molecular theory concerning the sex determination appeared in 1891. At this time, the german biologist Hermann Henking was studying sperm formation in wasps. As a chromosome which was not present in all the wasps looked different from the others, he suspected it to play a role in sex determination and called it the &amp;quot;X chromosome&amp;quot;.&lt;br /&gt;
Ten years later, Clarence Erwin McClung saw that this chromosome behaved differently during the meiosis and was only present in half the sperm cells of grasshoppers. As the main characteristic that varies in 50/50 proportions among zygotes is the sex, McClung suspected the X chromosome to be implicated in sexual development. &lt;br /&gt;
In 1905, Nettie Stevens discovered the &amp;quot;Y chromosome&amp;quot; (and the female XX and male XY patterns) while she was counting the chromosomes of beetles under the microscope&amp;lt;ref&amp;gt;Sumner, A. T. Sex Chromosomes and Sex Determination. Chromosomes: Organization and Function, 97-108. [http://www.nature.com/scitable/nated/topicpage/Sex-Chromosomes-and-Sex-Determination-44565]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
During the next decades, a few theories were in competition. In 1921, Calvin Bridges&#039;s works on &#039;&#039;Drosophila melanogaster&#039;&#039; seemed to reveal that male characters acquisition is due to a genic balance between the genes contained in the X chromosome and those contained in the autosomes&amp;lt;ref&amp;gt;PMID: 17769897&amp;lt;/ref&amp;gt;.&lt;br /&gt;
In 1930, Ronald Fisher introduced the first Y-based control of sex theory by proposing two different models : either all the genes responsible for the male characters are located on the Y chromosome or there is a Y-located gene which regulates the expression of genes elsewhere in the genome&amp;lt;ref name=&amp;quot;Goodfellow&amp;quot;&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt;.&lt;br /&gt;
As Alfred Jost had shown the testosterone produced by the testis is responsible for the entire male phenotype acquisition&amp;lt;ref&amp;gt;PMID: 4805859&amp;lt;/ref&amp;gt;, Peter Neville Goodfellow proposed in 1988, that there is a gene (&#039;&#039;TDF&#039;&#039; in human, &#039;&#039;Tdy&#039;&#039; in mice)  on the Y chromosome which drives the development of the testis&amp;lt;ref name=&amp;quot;Goodfellow&amp;quot; /&amp;gt;. In 1990, Goodfellow&#039;s hypothesis was validated with the discovery of &#039;&#039;Tdy&#039;&#039;&#039;s localisation. This gene&#039;s product (expressed during the male gonadal development) owns an amino-acid motif which shows homology to other known or putative DNA-binding domains. &#039;&#039;Tdy&#039;&#039; is therefore a transcriptional factor&amp;lt;ref&amp;gt;PMID: 2374589&amp;lt;/ref&amp;gt;. The same year, the human &#039;&#039;SRY&#039;&#039; gene (accepted later as the &#039;&#039;TDF&#039;&#039;) was discovered&amp;lt;ref&amp;gt;PMID: 1695712&amp;lt;/ref&amp;gt;. &lt;br /&gt;
Three dimensional structure of the SRY protein was determined in 1995 using NMR spectroscopy&amp;lt;ref&amp;gt;PMID:7774012&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
==SRY gene==&lt;br /&gt;
&lt;br /&gt;
The SRY gene encodes the SRY protein. The SRY protein is a transcriptional factor that induces the male phenotype in the embryo. The SRY gene is located on the [https://en.wikipedia.org/wiki/Y_chromosome Y chromosome] in the short arm (p) 11.3 &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/gene/6736 NCBI gene]&amp;lt;/ref&amp;gt;. This gene has only one exon that contains the HMG domain (DNA-binding High-Mobility Group box domain). It means that SRY mRNA does not have an alternative splicing, so there is only one isoforme of SRY protein&amp;lt;ref name=&amp;quot;McE&amp;quot;&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;. Moreover, the human genome contains only one copy of the SRY gene, whereas the mouse genome contains 6 copy of this gene&amp;lt;ref&amp;gt; Sekido R, Lovell-Badge R. Genetic control of testis development. Sex Dev Genet Mol Biol Evol Endocrinol Embryol Pathol Sex Determ Differ. 2013;7(1-3):21–32 &amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Sequence of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:90%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
&amp;gt;gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/nuccore NCBI nucleotide]&amp;lt;/ref&amp;gt;&lt;br /&gt;
TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT&lt;br /&gt;
TTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACA&lt;br /&gt;
&amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;ATG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;CAATCATATGCTTCTGCTATGTTAAGCGTATTCAACAGCGATGATTACAGTCCAGCTGTGCAAGAGAAT&lt;br /&gt;
ATTCCCGCTCTCCGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTAAGTATCAGTGTGAAA&lt;br /&gt;
CGGGAGAAAACAGTAAAGGCAACGTCCAGGATAGAGTGAAGCGACCCATGAACGCATTCATCGTGTGGTC&lt;br /&gt;
&#039;&#039;&#039;TCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCAGAGATCAGCAAGCAGCTG&lt;br /&gt;
&#039;&#039;&#039;GGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCATTCTTCCAGGAGGCACAGAAATTACAGG&lt;br /&gt;
&#039;&#039;&#039;CCATGCACAGAGAGAAATACCCGAATTATAAGTATCGA&#039;&#039;&#039;CCTCGTCGGAAGGCGAAGATGCTGCCGAAGAA&lt;br /&gt;
TTGCAGTTTGCTTCCCGCAGATCCCGCTTCGGTACTCTGCAGCGAAGTGCAACTGGACAACAGGTTGTAC&lt;br /&gt;
AGGGATGACTGTACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAACG&lt;br /&gt;
CAGCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTG&amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;TAG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;GACAATCGGGTAACATT&lt;br /&gt;
GGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCACTTTCTTATGTTTAGTTT&lt;br /&gt;
CAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCATTTCA&amp;lt;/small&amp;gt;&lt;br /&gt;
&lt;br /&gt;
(Legend : &amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Initiation codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt; ; &amp;lt;b&amp;gt;HMG sequence&amp;lt;/b&amp;gt; ; &amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Stop codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;)&lt;br /&gt;
&amp;lt;/div&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Regulation of the expression of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
In humans, the SRY promoter is located between −408 and −95 bp. Moreover, the SRY gene has enhancers at -727 pb. The linkage between regulatory proteins and these enhancers has the property to increase the production of SRY proteins. These regulatory proteins could be: SF1 (steroidogenic factor 1), SP1  and WT 1 (Wilms tumor)&amp;lt;ref name=&amp;quot;Harley&amp;quot;&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;SF1&#039;&#039;&#039;: this transcriptional factor belongs to the family of nuclear hormone receptors and contains a zinc finger. The activation of this protein requires a ligand (hormone).&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;SP1&#039;&#039;&#039;: this transcriptional factor is an ubiquitous protein which binds rich GC-sites and is implicated in the transcription of many genes. Moreover, this protein contains a zinc finger.&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;WT1&#039;&#039;&#039;: this transcriptional factor transactivates the SRY gene. It contains a zinc finger&amp;lt;ref&amp;gt;Larney C, Bailey TL, Koopman P. Switching on sex: transcriptional regulation of the testis-determining gene Sry. Dev Camb Engl. 2014 Jun;141(11):2195–205&amp;lt;/ref&amp;gt;. &lt;br /&gt;
&lt;br /&gt;
==Structure==&lt;br /&gt;
&lt;br /&gt;
===The SRY-HMG domain (HMG-Box)===&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;&#039;SRY-HMG&#039;&#039;&#039; stands for &#039;&#039;&#039;S&#039;&#039;&#039;ex determining &#039;&#039;&#039;R&#039;&#039;&#039;egion &#039;&#039;&#039;Y&#039;&#039;&#039; - &#039;&#039;&#039;H&#039;&#039;&#039;igh &#039;&#039;&#039;M&#039;&#039;&#039;obility &#039;&#039;&#039;G&#039;&#039;&#039;roup domain.&lt;br /&gt;
It is approximately 80 residues-long. It mediates the binding of the protein to the minor groove of DNA. It is the most important part of the SRY protein. Not only because it enables  the protein to bind the DNA but also because even a single mutation can cause an inactivation of the protein.&lt;br /&gt;
&lt;br /&gt;
It has a twisted L shape: it has a long (28Å) and a short (22Å) arm. The HMG Box is made of 3 helices. Its N-term and C-term domains are irregular. The overall structure is stabilized by a hydrophobic core especially at the intersection of the 3 helices where 3 aromatics cycles meet, surrounded by aliphatic aminoacids.&lt;br /&gt;
See the different structures:&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_1/3&#039;&amp;gt;Helix 1&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_2/2&#039;&amp;gt;Helix 2&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_3/1&#039;&amp;gt;Helix 3&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Long_arm_28a/1&#039;&amp;gt;Long arm (28Å)&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Short_arm_22a/1&#039;&amp;gt;Short arm (22Å)&amp;lt;/scene&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The interaction between the HMG-Box and DNA is specific and stable.  It is mostly hydrophobic. It permits the DNA to bend of DNA (≈75°). Only one molecule of water interfaces the Box and the DNA. The complex is stabilized by salt bridges between positively charged residues of the HMG domain and negatively charged phosphates&amp;lt;ref name=&amp;quot;Tang&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
[[Image:HHMG-bitmap.png|thumb|alt=Image bitmap|Linear structure of hHMG domain]]&lt;br /&gt;
&lt;br /&gt;
The binding of SRY on DNA is specific. The DNA target site is a DNA octamer :&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:30%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
(5&#039;-dGCACAAAC)&amp;lt;br/&amp;gt;&lt;br /&gt;
(5&#039;-dGTTTGTGC)&lt;br /&gt;
&amp;lt;/small&amp;gt;&amp;lt;/div&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
This sequence is found in the promoters of genes expressed during the testicular development.&lt;br /&gt;
The bend of DNA enables the recruitment of different proteins and the building of massive proteins-DNA complexes that could change the expression of different genes&amp;lt;ref&amp;gt;PMID:11563911&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
Even if the most important function of the HMG box is binding and bending DNA, it is also involved in DNA condensation, recombination and repair.&lt;br /&gt;
&lt;br /&gt;
There are two kinds of proteins that contain a HMG box:&lt;br /&gt;
* &#039;&#039;&#039;HMG1&#039;&#039;&#039; : It is expressed in few cell types. It is found in transcription factors that contain a single HMG box. The binding of a DNA sequence is specific.&lt;br /&gt;
* &#039;&#039;&#039;HMG2&#039;&#039;&#039; : It is found in all cell types and is abundant in chromatin. These proteins can contain two or more HMG boxes that can non-specifically bind DNA. &lt;br /&gt;
&lt;br /&gt;
===General structure of SRY===&lt;br /&gt;
&lt;br /&gt;
The overall structure of SRY is organized around the HMG-box.&lt;br /&gt;
3 domains:&lt;br /&gt;
* N-term domain&lt;br /&gt;
* Central domain : DNA binding (HMG box)&lt;br /&gt;
* C-term domain&lt;br /&gt;
&lt;br /&gt;
== Function ==&lt;br /&gt;
&lt;br /&gt;
===Sex determining===&lt;br /&gt;
&lt;br /&gt;
It acts like a sex determining factor thanks to its transcriptional activity. It inhibits the development of female sex structures in the embryonic individual.&lt;br /&gt;
&lt;br /&gt;
The SRY protein contains nuclear localization signals in N and C terminals. An acetylation of these domains allows the exportation of the SRY protein to the nucleus&amp;lt;ref name=&amp;quot;Harley&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
The SRY protein activates the &#039;&#039;SOX9&#039;&#039; (SRY-box9) gene &amp;lt;ref name=&amp;quot;McE&amp;quot; /&amp;gt;. This gene is found in long arm 24.3 of the chromosome 17&amp;lt;ref&amp;gt; NCBI [http://www.ncbi.nlm.nih.gov/gene/6662 NCBI gene: SOX9 SRY-BOX9 Homo sapiens] &amp;lt;/ref&amp;gt; and is implicated in the stimulation of the differentiation of pre-Sertori into Sertoli cells rather than granulosa cells.&lt;br /&gt;
&lt;br /&gt;
The activation of &#039;&#039;SOX&#039;&#039;9 is done by the SRY protein and another transcriptional factor: SF1 (steroidogenic factor 1). These transcriptional factors are bound on an enhancer called: TESCO (Testis-Specific Enhancer of &#039;&#039;SOX9&#039;&#039; core element). The binding of a transcriptional factor on an enhancer provokes a curvature of the DNA (≈75°), allowing a stabilization of the elongation complex on the &#039;&#039;SOX9&#039;&#039; promoter. The SOX9 protein activates the gene &#039;&#039;AMH&#039;&#039; (Anti-Mullerian Hormone)&amp;lt;ref&amp;gt;[http://www.ebi.ac.uk/interpro/entry/IPR006799?q=AMH EBI-Interpro: Anti-Mullerian-Hormon, N-term] &amp;lt;/ref&amp;gt;. Therefore, it allows the degeneration of the channels of Müller in male&amp;lt;ref name=&amp;quot;Harley&amp;quot; /&amp;gt;.&lt;br /&gt;
===Cathecolamines regulation===&lt;br /&gt;
&lt;br /&gt;
It has been shown that SRY is present in brain regions and activates the Tyrosine-3-Hydroxylase expression. This enzyme catalyses the rate-limiting step of catecholamine synthesis (L-Tyrosine to L-DOPA). Furthermore, SRY also activates the expression of Monoamine Oxidase A which is responsible for the inactivation of catecholamines. Therefore, it regulates both positively and negatively the catecholamines concentration&amp;lt;ref name=&amp;quot;Veitia&amp;quot;&amp;gt;PMID: 24604382&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Other extra-testicular effects===&lt;br /&gt;
&lt;br /&gt;
Some knock-down experiments have shown that SRY may also be a major actor in the dopamine pathway. On the peripheral side, it seems to regulate noradrenaline levels and blood pressure&amp;lt;ref name=&amp;quot;Veitia&amp;quot; /&amp;gt;. A researcher who contributed to discovering these effects says it might explain why &amp;quot;the aggressive fight-or-flight reaction is more dominant in men, while women predominantly adopt a less aggressive tend-and-befriend response&amp;quot;&amp;lt;ref&amp;gt;Cohen, Tamara. The &#039;macho&#039; gene that makes men behave aggressively has been found. The Daily Mail (2012). [http://www.dailymail.co.uk/sciencetech/article-2111668/The-macho-gene-makes-men-aggressive-found.html#ixzz3yZC2BV4k]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
It has been shown that SRY may be involved in the regulation of the renin-angiotensin system in mice. Indeed, sequence mutations of the protein lead to hypertension. Because the human&#039;s SRY organisation is very closed to the mouse&#039;s, it has been proposed that SRY may have the same function in humans but it has not been studied directly&amp;lt;ref&amp;gt;PMID:22315667&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
== Diseases==&lt;br /&gt;
&lt;br /&gt;
=== Swyer syndrome (AKA XY gonadal dysgenis)===&lt;br /&gt;
&lt;br /&gt;
If the TDF protein is not able to bind its targeted DNA sequences, the genes responsible for the testis development are not expressed. The patient owning this defective protein will then develop female characters, even though he has a XY karyotype. This phenomenon is known as the &amp;quot;Swyer Syndrome&amp;quot;. &lt;br /&gt;
Different causes can explain this &amp;quot;XY gonadal dysgenis&amp;quot;, as it is also called. About thirty mutations (named [http://www.uniprot.org/uniprot/Q05066#sequences &amp;quot;SRXY1&amp;quot;]) in the SRY gene have been shown to drive this phenotype development. It can also be due to crossovers during a meiosis. If a Y chromosome portion carrying the SRY gene is recombined into a X chromosome, a sperm cell will get this abnormal Y chromosome. If it then fecundates, a XY karyotype without any SRY gene will be formed. &lt;br /&gt;
&lt;br /&gt;
=== De La Chapelle syndrome (AKA XX male syndrome)===&lt;br /&gt;
&lt;br /&gt;
From the meiosis just described would also result an abnormal X chromosome, carrying the SRY gene. If the sperm cell owning this chromosome fecundates an ovule, the resulting newborn will have a XX karyotype but a male phenotype. This is called the &amp;quot;De La Chapelle syndrome&amp;quot;. In this case, the patient can either develop testis or both testis and ovarian tissues. As some epigenetic mechanisms can inactivate the X chromosome carrying SRY, this syndrome keeps most of the patients sterile&amp;lt;ref&amp;gt;PMID: 4622299&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Hepatocellular carcinoma===&lt;br /&gt;
 &lt;br /&gt;
In the case on a hepatocellular carcinoma, it has been proved that high expression levels of SRY help cancer progression and poor patient survival. However, it still seems that hepatocellular carcinoma is not most likely to develop in men&amp;lt;ref&amp;gt;PMID: 25274159&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
== Structural highlights ==&lt;br /&gt;
&lt;br /&gt;
This is a sample scene created with SAT to &amp;lt;scene name=&amp;quot;/12/3456/Sample/1&amp;quot;&amp;gt;color&amp;lt;/scene&amp;gt; by Group, and another to make &amp;lt;scene name=&amp;quot;/12/3456/Sample/2&amp;quot;&amp;gt;a transparent representation&amp;lt;/scene&amp;gt; of the protein. You can make your own scenes on SAT starting from scratch or loading and editing one of these sample scenes.&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_1/3&#039;&amp;gt;Helix 1&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_2/2&#039;&amp;gt;Helix 2&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_3/1&#039;&amp;gt;Helix 3&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Long_arm_28a/1&#039;&amp;gt;Long arm (28A)&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Short_arm_22a/1&#039;&amp;gt;Short arm (22A)&amp;lt;/scene&amp;gt;&lt;br /&gt;
&amp;lt;/StructureSection&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== References ==&lt;br /&gt;
&amp;lt;references/&amp;gt;&lt;/div&gt;</summary>
		<author><name>Fantin Mesny</name></author>
	</entry>
	<entry>
		<id>https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2526347</id>
		<title>Sandbox Reserved 1120</title>
		<link rel="alternate" type="text/html" href="https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2526347"/>
		<updated>2016-01-30T15:06:21Z</updated>

		<summary type="html">&lt;p&gt;Fantin Mesny: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{Sandbox_Reserved_ESBS_2015}}&amp;lt;!-- PLEASE ADD YOUR CONTENT BELOW HERE --&amp;gt;&lt;br /&gt;
=SRY protein (AKA TDF protein)=&lt;br /&gt;
&amp;lt;StructureSection load=&#039;1hry&#039; size=&#039;340&#039; frame=&#039;true&#039; side=&#039;right&#039; caption=&#039;The SRY protein linked to DNA&#039; scene=&#039;71/719861/Base/1&#039;&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;table&amp;gt;&amp;lt;tr&amp;gt;&amp;lt;td colspan=&#039;2&#039;&amp;gt;The SRY protein is a 204 residues-long monomeric polypeptide. It is encoded by the SRY gene and is involved in the sex determination in mammals by being responsible for the gonadogenesis and so the male sexual development. It is the HMG-box that gives to the protein its ability to bind DNA by its minor groove&amp;lt;ref name =&amp;quot;Tang&amp;quot;&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;.&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr id=&#039;related&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;[[Related_structure|Related:]]&amp;lt;/b&amp;gt;&amp;lt;/td&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;[[1hrz|1hrz]]&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr id=&#039;resources&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Resources:&amp;lt;/b&amp;gt;&amp;lt;/td&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;&amp;lt;span class=&#039;plainlinks&#039;&amp;gt;[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=1hry FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=1hry OCA], [http://pdbe.org/1hry PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=1hry RCSB], [http://www.ebi.ac.uk/pdbsum/1hry PDBsum]&lt;br /&gt;
&amp;lt;tr id=&#039;Gene&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Encoded by&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;The SRY gene codes for the SRY protein&lt;br /&gt;
&amp;lt;tr id=&#039;Length&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Length&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;204 residues&lt;br /&gt;
&amp;lt;tr id=&#039;Molecular weight&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Molecular weight&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;≈23kDa&lt;br /&gt;
&amp;lt;tr id=&#039;DNA target sequence&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;DNA target sequence&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;(5&#039;-dGCACAAAC)&lt;br /&gt;
&amp;lt;tr id=&#039;Regulation&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Regulation&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;[https://en.wikipedia.org/wiki/Steroidogenic_factor_1 Sf1];[https://en.wikipedia.org/wiki/Sp1_transcription_factor Sp1] (binding site in the promoter of SRY : -150),[https://en.wikipedia.org/wiki/WT1 WT1] (binding site in the promoter of SRY : -87)&lt;br /&gt;
&amp;lt;tr id=&#039;Role&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Role&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;Transcription factor&lt;br /&gt;
&amp;lt;tr id=&#039;Genes targeted&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Genes targeted&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;&amp;lt;i&amp;gt;SOX9&amp;lt;/i&amp;gt;, &amp;lt;i&amp;gt;TH&amp;lt;/i&amp;gt;, &amp;lt;i&amp;gt;MAOA&amp;lt;/i&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;/span&amp;gt;&lt;br /&gt;
&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;/table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==History==&lt;br /&gt;
&lt;br /&gt;
After centuries of unfounded theories mainly based on environmental factors, the first molecular theory concerning the sex determination appeared in 1891. At this time, the german biologist Hermann Henking was studying sperm formation in wasps. As a chromosome which was not present in all the wasps looked different from the others, he suspected it to play a role in sex determination and called it the &amp;quot;X chromosome&amp;quot;.&lt;br /&gt;
Ten years later, Clarence Erwin McClung saw that this chromosome behaved differently during the meiosis and was only present in half the sperm cells of grasshoppers. As the main characteristic that varies in 50/50 proportions among zygotes is the sex, McClung suspected the X chromosome to be implicated in sexual development. &lt;br /&gt;
In 1905, Nettie Stevens discovered the &amp;quot;Y chromosome&amp;quot; (and the female XX and male XY patterns) while she was counting the chromosomes of beetles under the microscope&amp;lt;ref&amp;gt;Sumner, A. T. Sex Chromosomes and Sex Determination. Chromosomes: Organization and Function, 97-108. [http://www.nature.com/scitable/nated/topicpage/Sex-Chromosomes-and-Sex-Determination-44565]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
During the next decades, a few theories were in competition. In 1921, Calvin Bridges&#039;s works on &#039;&#039;Drosophila melanogaster&#039;&#039; seemed to reveal that male characters acquisition is due to a genic balance between the genes contained in the X chromosome and those contained in the autosomes&amp;lt;ref&amp;gt;PMID: 17769897&amp;lt;/ref&amp;gt;.&lt;br /&gt;
In 1930, Ronald Fisher introduced the first Y-based control of sex theory by proposing two different models : either all the genes responsible for the male characters are located on the Y chromosome or there is a Y-located gene which regulates the expression of genes elsewhere in the genome&amp;lt;ref name=&amp;quot;Goodfellow&amp;quot;&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt;.&lt;br /&gt;
As Alfred Jost had shown the testosterone produced by the testis is responsible for the entire male phenotype acquisition&amp;lt;ref&amp;gt;PMID: 4805859&amp;lt;/ref&amp;gt;, Peter Neville Goodfellow proposed in 1988, that there is a gene (&#039;&#039;TDF&#039;&#039; in human, &#039;&#039;Tdy&#039;&#039; in mice)  on the Y chromosome which drives the development of the testis&amp;lt;ref name=&amp;quot;Goodfellow&amp;quot; /&amp;gt;. In 1990, Goodfellow&#039;s hypothesis was validated with the discovery of &#039;&#039;Tdy&#039;&#039;&#039;s localisation. This gene&#039;s product (expressed during the male gonadal development) owns an amino-acid motif which shows homology to other known or putative DNA-binding domains. &#039;&#039;Tdy&#039;&#039; is therefore a transcriptional factor&amp;lt;ref&amp;gt;PMID: 2374589&amp;lt;/ref&amp;gt;. The same year, the human &#039;&#039;SRY&#039;&#039; gene (accepted later as the &#039;&#039;TDF&#039;&#039;) was discovered&amp;lt;ref&amp;gt;PMID: 1695712&amp;lt;/ref&amp;gt;. &lt;br /&gt;
Three dimensional structure of the SRY protein was determined in 1995 using NMR spectroscopy&amp;lt;ref&amp;gt;PMID:7774012&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
==SRY gene==&lt;br /&gt;
&lt;br /&gt;
The SRY gene encodes the SRY protein. The SRY protein is a transcriptional factor that induces the male phenotype in the embryo. The SRY gene is located on the [https://en.wikipedia.org/wiki/Y_chromosome Y chromosome] in the short arm (p) 11.3 &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/gene/6736 NCBI gene]&amp;lt;/ref&amp;gt;. This gene has only one exon that contains the HMG domain (DNA-binding High-Mobility Group box domain). It means that SRY mRNA does not have an alternative splicing, so there is only one isoforme of SRY protein&amp;lt;ref name=&amp;quot;McE&amp;quot;&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;. Moreover, the human genome contains only one copy of the SRY gene, whereas the mouse genome contains 6 copy of this gene&amp;lt;ref&amp;gt; Sekido R, Lovell-Badge R. Genetic control of testis development. Sex Dev Genet Mol Biol Evol Endocrinol Embryol Pathol Sex Determ Differ. 2013;7(1-3):21–32 &amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Sequence of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:90%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
&amp;gt;gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/nuccore NCBI nucleotide]&amp;lt;/ref&amp;gt;&lt;br /&gt;
TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT&lt;br /&gt;
TTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACA&lt;br /&gt;
&amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;ATG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;CAATCATATGCTTCTGCTATGTTAAGCGTATTCAACAGCGATGATTACAGTCCAGCTGTGCAAGAGAAT&lt;br /&gt;
ATTCCCGCTCTCCGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTAAGTATCAGTGTGAAA&lt;br /&gt;
CGGGAGAAAACAGTAAAGGCAACGTCCAGGATAGAGTGAAGCGACCCATGAACGCATTCATCGTGTGGTC&lt;br /&gt;
&#039;&#039;&#039;TCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCAGAGATCAGCAAGCAGCTG&lt;br /&gt;
&#039;&#039;&#039;GGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCATTCTTCCAGGAGGCACAGAAATTACAGG&lt;br /&gt;
&#039;&#039;&#039;CCATGCACAGAGAGAAATACCCGAATTATAAGTATCGA&#039;&#039;&#039;CCTCGTCGGAAGGCGAAGATGCTGCCGAAGAA&lt;br /&gt;
TTGCAGTTTGCTTCCCGCAGATCCCGCTTCGGTACTCTGCAGCGAAGTGCAACTGGACAACAGGTTGTAC&lt;br /&gt;
AGGGATGACTGTACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAACG&lt;br /&gt;
CAGCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTG&amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;TAG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;GACAATCGGGTAACATT&lt;br /&gt;
GGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCACTTTCTTATGTTTAGTTT&lt;br /&gt;
CAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCATTTCA&amp;lt;/small&amp;gt;&lt;br /&gt;
&lt;br /&gt;
(Legend : &amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Initiation codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt; ; &amp;lt;b&amp;gt;HMG sequence&amp;lt;/b&amp;gt; ; &amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Stop codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;)&lt;br /&gt;
&amp;lt;/div&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Regulation of the expression of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
In humans, the SRY promoter is located between −408 and −95 bp. Moreover, the SRY gene has enhancers at -727 pb. The linkage between regulatory proteins and these enhancers has the property to increase the production of SRY proteins. These regulatory proteins could be: SF1 (steroidogenic factor 1), SP1  and WT 1 (Wilms tumor)&amp;lt;ref name=&amp;quot;Harley&amp;quot;&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;SF1&#039;&#039;&#039;: this transcriptional factor belongs to the family of nuclear hormone receptors and contains a zinc finger. The activation of this protein requires a ligand (hormone).&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;SP1&#039;&#039;&#039;: this transcriptional factor is an ubiquitous protein which binds rich GC-sites and is implicated in the transcription of many genes. Moreover, this protein contains a zinc finger.&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;WT1&#039;&#039;&#039;: this transcriptional factor transactivates the SRY gene. It contains a zinc finger&amp;lt;ref&amp;gt;Larney C, Bailey TL, Koopman P. Switching on sex: transcriptional regulation of the testis-determining gene Sry. Dev Camb Engl. 2014 Jun;141(11):2195–205&amp;lt;/ref&amp;gt;. &lt;br /&gt;
&lt;br /&gt;
==Structure==&lt;br /&gt;
&lt;br /&gt;
===The SRY-HMG domain (HMG-Box)===&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;&#039;SRY-HMG&#039;&#039;&#039; stands for &#039;&#039;&#039;S&#039;&#039;&#039;ex determining &#039;&#039;&#039;R&#039;&#039;&#039;egion &#039;&#039;&#039;Y&#039;&#039;&#039; - &#039;&#039;&#039;H&#039;&#039;&#039;igh &#039;&#039;&#039;M&#039;&#039;&#039;obility &#039;&#039;&#039;G&#039;&#039;&#039;roup domain.&lt;br /&gt;
It is approximately 80 residues-long. It mediates the binding of the protein to the minor groove of DNA. It is the most important part of the SRY protein. Not only because it enables  the protein to bind the DNA but also because even a single mutation can cause an inactivation of the protein.&lt;br /&gt;
&lt;br /&gt;
It has a twisted L shape: it has a long (28Å) and a short (22Å) arm. The HMG Box is made of 3 helices. Its N-term and C-term domains are irregular. The overall structure is stabilized by a hydrophobic core especially at the intersection of the 3 helices where 3 aromatics cycles meet, surrounded by aliphatic aminoacids.&lt;br /&gt;
See the different structures:&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_1/3&#039;&amp;gt;Helix 1&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_2/2&#039;&amp;gt;Helix 2&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_3/1&#039;&amp;gt;Helix 3&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Long_arm_28a/1&#039;&amp;gt;Long arm (28Å)&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Short_arm_22a/1&#039;&amp;gt;Short arm (22Å)&amp;lt;/scene&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The interaction between the HMG-Box and DNA is specific and stable.  It is mostly hydrophobic. It permits the DNA to bend of DNA (≈75°). Only one molecule of water interfaces the Box and the DNA. The complex is stabilized by salt bridges between positively charged residues of the HMG domain and negatively charged phosphates&amp;lt;ref name=&amp;quot;Tang&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
[[Image:HHMG-bitmap.png|thumb|alt=Image bitmap|Linear structure of hHMG domain]]&lt;br /&gt;
&lt;br /&gt;
The binding of SRY on DNA is specific. The DNA target site is a DNA octamer :&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:30%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
(5&#039;-dGCACAAAC)&amp;lt;br/&amp;gt;&lt;br /&gt;
(5&#039;-dGTTTGTGC)&lt;br /&gt;
&amp;lt;/small&amp;gt;&amp;lt;/div&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
This sequence is found in the promoters of genes expressed during the testicular development.&lt;br /&gt;
The bend of DNA enables the recruitment of different proteins and the building of massive proteins-DNA complexes that could change the expression of different genes&amp;lt;ref&amp;gt;PMID:11563911&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
Even if the most important function of the HMG box is binding and bending DNA, it is also involved in DNA condensation, recombination and repair.&lt;br /&gt;
&lt;br /&gt;
There are two kinds of proteins that contain a HMG box:&lt;br /&gt;
* &#039;&#039;&#039;HMG1&#039;&#039;&#039; : It is expressed in few cell types. It is found in transcription factors that contain a single HMG box. The binding of a DNA sequence is specific.&lt;br /&gt;
* &#039;&#039;&#039;HMG2&#039;&#039;&#039; : It is found in all cell types and is abundant in chromatin. These proteins can contain two or more HMG boxes that can non-specifically bind DNA. &lt;br /&gt;
&lt;br /&gt;
===General structure of SRY===&lt;br /&gt;
&lt;br /&gt;
The overall structure of SRY is organized around the HMG-box.&lt;br /&gt;
3 domains:&lt;br /&gt;
* N-term domain&lt;br /&gt;
* Central domain : DNA binding (HMG box)&lt;br /&gt;
* C-term domain&lt;br /&gt;
&lt;br /&gt;
== Function ==&lt;br /&gt;
&lt;br /&gt;
===Sex determining===&lt;br /&gt;
&lt;br /&gt;
It acts like a sex determining factor thanks to its transcriptional activity. It inhibits the development of female sex structures in the embryonic individual.&lt;br /&gt;
&lt;br /&gt;
The SRY protein contains nuclear localization signals in N and C terminals. An acetylation of these domains allows the exportation of the SRY protein to the nucleus&amp;lt;ref name=&amp;quot;Harley&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
The SRY protein activates the &#039;&#039;SOX9&#039;&#039; (SRY-box9) gene &amp;lt;ref name=&amp;quot;McE&amp;quot; /&amp;gt;. This gene is found in long arm 24.3 of the chromosome 17&amp;lt;ref&amp;gt; NCBI [http://www.ncbi.nlm.nih.gov/gene/6662 NCBI gene: SOX9 SRY-BOX9 Homo sapiens] &amp;lt;/ref&amp;gt; and is implicated in the stimulation of the differentiation of pre-Sertori into Sertoli cells rather than granulosa cells.&lt;br /&gt;
&lt;br /&gt;
The activation of &#039;&#039;SOX&#039;&#039;9 is done by the SRY protein and another transcriptional factor: SF1 (steroidogenic factor 1). These transcriptional factors are bound on an enhancer called: TESCO (Testis-Specific Enhancer of &#039;&#039;SOX9&#039;&#039; core element). The binding of a transcriptional factor on an enhancer provokes a curvature of the DNA (≈75°), allowing a stabilization of the elongation complex on the &#039;&#039;SOX9&#039;&#039; promoter. The SOX9 protein activates the gene &#039;&#039;AMH&#039;&#039; (Anti-Mullerian Hormone)&amp;lt;ref&amp;gt;[http://www.ebi.ac.uk/interpro/entry/IPR006799?q=AMH EBI-Interpro: Anti-Mullerian-Hormon, N-term] &amp;lt;/ref&amp;gt;. Therefore, it allows the degeneration of the channels of Müller in male&amp;lt;ref name=&amp;quot;Harley&amp;quot; /&amp;gt;.&lt;br /&gt;
===Cathecolamines regulation===&lt;br /&gt;
&lt;br /&gt;
It has been shown that SRY is present in brain regions and activates the Tyrosine-3-Hydroxylase expression. This enzyme catalyses the rate-limiting step of catecholamine synthesis (L-Tyrosine to L-DOPA). Furthermore, SRY also activates the expression of Monoamine Oxidase A which is responsible for the inactivation of catecholamines. Therefore, it regulates both positively and negatively the catecholamines concentration&amp;lt;ref name=&amp;quot;Veitia&amp;quot;&amp;gt;PMID: 24604382&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Other extra-testicular effects===&lt;br /&gt;
&lt;br /&gt;
Some knock-down experiments have shown that SRY may also be a major actor in the dopamine pathway. On the peripheral side, it seems to regulate noradrenaline levels and blood pressure&amp;lt;ref name=&amp;quot;Veitia&amp;quot; /&amp;gt;. A researcher who contributed to discovering these effects says it might explain why &amp;quot;the aggressive fight-or-flight reaction is more dominant in men, while women predominantly adopt a less aggressive tend-and-befriend response&amp;quot;&amp;lt;ref&amp;gt;Cohen, Tamara. The &#039;macho&#039; gene that makes men behave aggressively has been found. The Daily Mail (2012). [http://www.dailymail.co.uk/sciencetech/article-2111668/The-macho-gene-makes-men-aggressive-found.html#ixzz3yZC2BV4k]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
It has been shown that SRY may be involved in the regulation of the renin-angiotensin system in mice. Indeed, sequence mutations of the protein lead to hypertension. Because the human&#039;s SRY organisation is very closed to the mouse&#039;s, it has been proposed that SRY may have the same function in humans but it has not been studied directly&amp;lt;ref&amp;gt;PMID:22315667&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
== Diseases==&lt;br /&gt;
&lt;br /&gt;
=== Swyer syndrome (AKA XY gonadal dysgenis) :===&lt;br /&gt;
&lt;br /&gt;
If the TDF protein is not able to bind its targeted DNA sequences, the genes responsible for the testis development are not expressed. The patient owning this defective protein will then develop female characters, even though he has a XY karyotype. This phenomenon is known as the &amp;quot;Swyer Syndrome&amp;quot;. &lt;br /&gt;
Different causes can explain this &amp;quot;XY gonadal dysgenis&amp;quot;, as it is also called. About thirty mutations (named [http://www.uniprot.org/uniprot/Q05066#sequences &amp;quot;SRXY1&amp;quot;]) in the SRY gene have been shown to drive this phenotype development. It can also be due to crossovers during a meiosis. If a Y chromosome portion carrying the SRY gene is recombined into a X chromosome, a sperm cell will get this abnormal Y chromosome. If it then fecundates, a XY karyotype without any SRY gene will be formed. &lt;br /&gt;
&lt;br /&gt;
=== De La Chapelle syndrome (AKA XX male syndrome) :===&lt;br /&gt;
&lt;br /&gt;
From the meiosis just described would also result an abnormal X chromosome, carrying the SRY gene. If the sperm cell owning this chromosome fecundates an ovule, the resulting newborn will have a XX karyotype but a male phenotype. This is called the &amp;quot;De La Chapelle syndrome&amp;quot;. In this case, the patient can either develop testis or both testis and ovarian tissues. As some epigenetic mechanisms can inactivate the X chromosome carrying SRY, this syndrome keeps most of the patients sterile&amp;lt;ref&amp;gt;PMID: 4622299&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Hepatocellular carcinoma===&lt;br /&gt;
 &lt;br /&gt;
In the case on a hepatocellular carcinoma, it has been proved that high expression levels of SRY help cancer progression and poor patient survival. However, it still seems that hepatocellular carcinoma is not most likely to develop in men&amp;lt;ref&amp;gt;PMID: 25274159&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
== Structural highlights ==&lt;br /&gt;
&lt;br /&gt;
This is a sample scene created with SAT to &amp;lt;scene name=&amp;quot;/12/3456/Sample/1&amp;quot;&amp;gt;color&amp;lt;/scene&amp;gt; by Group, and another to make &amp;lt;scene name=&amp;quot;/12/3456/Sample/2&amp;quot;&amp;gt;a transparent representation&amp;lt;/scene&amp;gt; of the protein. You can make your own scenes on SAT starting from scratch or loading and editing one of these sample scenes.&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_1/3&#039;&amp;gt;Helix 1&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_2/2&#039;&amp;gt;Helix 2&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_3/1&#039;&amp;gt;Helix 3&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Long_arm_28a/1&#039;&amp;gt;Long arm (28A)&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Short_arm_22a/1&#039;&amp;gt;Short arm (22A)&amp;lt;/scene&amp;gt;&lt;br /&gt;
&amp;lt;/StructureSection&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== References ==&lt;br /&gt;
&amp;lt;references/&amp;gt;&lt;/div&gt;</summary>
		<author><name>Fantin Mesny</name></author>
	</entry>
	<entry>
		<id>https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2526339</id>
		<title>Sandbox Reserved 1120</title>
		<link rel="alternate" type="text/html" href="https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2526339"/>
		<updated>2016-01-30T15:00:44Z</updated>

		<summary type="html">&lt;p&gt;Fantin Mesny: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{Sandbox_Reserved_ESBS_2015}}&amp;lt;!-- PLEASE ADD YOUR CONTENT BELOW HERE --&amp;gt;&lt;br /&gt;
=SRY protein (AKA TDF protein)=&lt;br /&gt;
&amp;lt;StructureSection load=&#039;1hry&#039; size=&#039;340&#039; frame=&#039;true&#039; side=&#039;right&#039; caption=&#039;The SRY protein linked to DNA&#039; scene=&#039;71/719861/Base/1&#039;&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;table&amp;gt;&amp;lt;tr&amp;gt;&amp;lt;td colspan=&#039;2&#039;&amp;gt;The SRY protein is a 204 residues-long monomeric polypeptide. It is encoded by the SRY gene and is involved in the sex determination in mammals by being responsible for the gonadogenesis and so the male sexual development. It is the HMG-box that gives to the protein its ability to bind DNA by its minor groove&amp;lt;ref name =&amp;quot;Tang&amp;quot;&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;.&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr id=&#039;related&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;[[Related_structure|Related:]]&amp;lt;/b&amp;gt;&amp;lt;/td&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;[[1hrz|1hrz]]&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr id=&#039;resources&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Resources:&amp;lt;/b&amp;gt;&amp;lt;/td&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;&amp;lt;span class=&#039;plainlinks&#039;&amp;gt;[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=1hry FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=1hry OCA], [http://pdbe.org/1hry PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=1hry RCSB], [http://www.ebi.ac.uk/pdbsum/1hry PDBsum]&lt;br /&gt;
&amp;lt;tr id=&#039;Gene&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Encoded by&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;The SRY gene codes for the SRY protein&lt;br /&gt;
&amp;lt;tr id=&#039;Length&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Length&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;204 residues&lt;br /&gt;
&amp;lt;tr id=&#039;Molecular weight&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Molecular weight&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;≈23kDa&lt;br /&gt;
&amp;lt;tr id=&#039;DNA target sequence&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;DNA target sequence&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;(5&#039;-dGCACAAAC)&lt;br /&gt;
&amp;lt;tr id=&#039;Regulation&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Regulation&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;[https://en.wikipedia.org/wiki/Steroidogenic_factor_1 Sf1];[https://en.wikipedia.org/wiki/Sp1_transcription_factor Sp1] (binding site in the promoter of SRY : -150),[https://en.wikipedia.org/wiki/WT1 WT1] (binding site in the promoter of SRY : -87)&lt;br /&gt;
&amp;lt;tr id=&#039;Role&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Role&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;Transcription factor&lt;br /&gt;
&amp;lt;tr id=&#039;Genes targeted&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Genes targeted&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;&amp;lt;i&amp;gt;SOX9&amp;lt;/i&amp;gt;, &amp;lt;i&amp;gt;TH&amp;lt;/i&amp;gt;, &amp;lt;i&amp;gt;MAOA&amp;lt;/i&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;/span&amp;gt;&lt;br /&gt;
&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;/table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==History==&lt;br /&gt;
&lt;br /&gt;
After centuries of unfounded theories mainly based on environmental factors, the first molecular theory concerning the sex determination appeared in 1891. At this time, the german biologist Hermann Henking was studying sperm formation in wasps. As a chromosome which was not present in all the wasps looked different from the others, he suspected it to play a role in sex determination and called it the &amp;quot;X chromosome&amp;quot;.&lt;br /&gt;
Ten years later, Clarence Erwin McClung saw that this chromosome behaved differently during the meiosis and was only present in half the sperm cells of grasshoppers. As the main characteristic that varies in 50/50 proportions among zygotes is the sex, McClung suspected the X chromosome to be implicated in sexual development. &lt;br /&gt;
In 1905, Nettie Stevens discovered the &amp;quot;Y chromosome&amp;quot; (and the female XX and male XY patterns) while she was counting the chromosomes of beetles under the microscope&amp;lt;ref&amp;gt;Sumner, A. T. Sex Chromosomes and Sex Determination. Chromosomes: Organization and Function, 97-108. [http://www.nature.com/scitable/nated/topicpage/Sex-Chromosomes-and-Sex-Determination-44565]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
During the next decades, a few theories were in competition. In 1921, Calvin Bridges&#039;s works on &#039;&#039;Drosophila melanogaster&#039;&#039; seemed to reveal that male characters acquisition is due to a genic balance between the genes contained in the X chromosome and those contained in the autosomes&amp;lt;ref&amp;gt;PMID: 17769897&amp;lt;/ref&amp;gt;.&lt;br /&gt;
In 1930, Ronald Fisher introduced the first Y-based control of sex theory by proposing two different models : either all the genes responsible for the male characters are located on the Y chromosome or there is a Y-located gene which regulates the expression of genes elsewhere in the genome&amp;lt;ref name=&amp;quot;Goodfellow&amp;quot;&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt;.&lt;br /&gt;
As Alfred Jost had shown the testosterone produced by the testis is responsible for the entire male phenotype acquisition&amp;lt;ref&amp;gt;PMID: 4805859&amp;lt;/ref&amp;gt;, Peter Neville Goodfellow proposed in 1988, that there is a gene (&#039;&#039;TDF&#039;&#039; in human, &#039;&#039;Tdy&#039;&#039; in mice)  on the Y chromosome which drives the development of the testis&amp;lt;ref name=&amp;quot;Goodfellow&amp;quot; /&amp;gt;. In 1990, Goodfellow&#039;s hypothesis was validated with the discovery of &#039;&#039;Tdy&#039;&#039;&#039;s localisation. This gene&#039;s product (expressed during the male gonadal development) owns an amino-acid motif which shows homology to other known or putative DNA-binding domains. &#039;&#039;Tdy&#039;&#039; is therefore a transcriptional factor&amp;lt;ref&amp;gt;PMID: 2374589&amp;lt;/ref&amp;gt;. The same year, the human &#039;&#039;SRY&#039;&#039; gene (accepted later as the &#039;&#039;TDF&#039;&#039;) was discovered&amp;lt;ref&amp;gt;PMID: 1695712&amp;lt;/ref&amp;gt;. &lt;br /&gt;
Three dimensional structure of the SRY protein was determined in 1995 using NMR spectroscopy&amp;lt;ref&amp;gt;PMID:7774012&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
==SRY gene==&lt;br /&gt;
&lt;br /&gt;
The SRY gene encodes the SRY protein. The SRY protein is a transcriptional factor that induces the male phenotype in the embryo. The SRY gene is located on the [https://en.wikipedia.org/wiki/Y_chromosome Y chromosome] in the short arm (p) 11.3 &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/gene/6736 NCBI gene]&amp;lt;/ref&amp;gt;. This gene has only one exon that contains the HMG domain (DNA-binding High-Mobility Group box domain). It means that SRY mRNA does not have an alternative splicing, so there is only one isoforme of SRY protein&amp;lt;ref name=&amp;quot;McE&amp;quot;&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;. Moreover, the human genome contains only one copy of the SRY gene, whereas the mouse genome contains 6 copy of this gene&amp;lt;ref&amp;gt; Sekido R, Lovell-Badge R. Genetic control of testis development. Sex Dev Genet Mol Biol Evol Endocrinol Embryol Pathol Sex Determ Differ. 2013;7(1-3):21–32 &amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Sequence of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:90%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
&amp;gt;gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/nuccore NCBI nucleotide]&amp;lt;/ref&amp;gt;&lt;br /&gt;
TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT&lt;br /&gt;
TTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACA&lt;br /&gt;
&amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;ATG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;CAATCATATGCTTCTGCTATGTTAAGCGTATTCAACAGCGATGATTACAGTCCAGCTGTGCAAGAGAAT&lt;br /&gt;
ATTCCCGCTCTCCGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTAAGTATCAGTGTGAAA&lt;br /&gt;
CGGGAGAAAACAGTAAAGGCAACGTCCAGGATAGAGTGAAGCGACCCATGAACGCATTCATCGTGTGGTC&lt;br /&gt;
&#039;&#039;&#039;TCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCAGAGATCAGCAAGCAGCTG&lt;br /&gt;
&#039;&#039;&#039;GGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCATTCTTCCAGGAGGCACAGAAATTACAGG&lt;br /&gt;
&#039;&#039;&#039;CCATGCACAGAGAGAAATACCCGAATTATAAGTATCGA&#039;&#039;&#039;CCTCGTCGGAAGGCGAAGATGCTGCCGAAGAA&lt;br /&gt;
TTGCAGTTTGCTTCCCGCAGATCCCGCTTCGGTACTCTGCAGCGAAGTGCAACTGGACAACAGGTTGTAC&lt;br /&gt;
AGGGATGACTGTACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAACG&lt;br /&gt;
CAGCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTG&amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;TAG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;GACAATCGGGTAACATT&lt;br /&gt;
GGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCACTTTCTTATGTTTAGTTT&lt;br /&gt;
CAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCATTTCA&amp;lt;/small&amp;gt;&lt;br /&gt;
&lt;br /&gt;
(Legend : &amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Initiation codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt; ; &amp;lt;b&amp;gt;HMG sequence&amp;lt;/b&amp;gt; ; &amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Stop codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;)&lt;br /&gt;
&amp;lt;/div&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Regulation of the expression of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
In humans, the SRY promoter is located between −408 and −95 bp. Moreover, the SRY gene has enhancers at -727 pb. The linkage between regulatory proteins and these enhancers has the property to increase the production of SRY proteins. These regulatory proteins could be: SF1 (steroidogenic factor 1), SP1  and WT 1 (Wilms tumor)&amp;lt;ref name=&amp;quot;Harley&amp;quot;&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;SF1&#039;&#039;&#039;: this transcriptional factor belongs to the family of nuclear hormone receptors and contains a zinc finger. The activation of this protein requires a ligand (hormone).&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;SP1&#039;&#039;&#039;: this transcriptional factor is an ubiquitous protein which binds rich GC-sites and is implicated in the transcription of many genes. Moreover, this protein contains a zinc finger.&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;WT1&#039;&#039;&#039; :this transcriptional factor transactivates the SRY gene. It contains a zinc finger&amp;lt;ref&amp;gt;Larney C, Bailey TL, Koopman P. Switching on sex: transcriptional regulation of the testis-determining gene Sry. Dev Camb Engl. 2014 Jun;141(11):2195–205&amp;lt;/ref&amp;gt;. &lt;br /&gt;
&lt;br /&gt;
==Structure==&lt;br /&gt;
&lt;br /&gt;
===The SRY-HMG domain (HMG-Box)===&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;&#039;SRY-HMG&#039;&#039;&#039; stands for &#039;&#039;&#039;S&#039;&#039;&#039;ex determining &#039;&#039;&#039;R&#039;&#039;&#039;egion &#039;&#039;&#039;Y&#039;&#039;&#039; - &#039;&#039;&#039;H&#039;&#039;&#039;igh &#039;&#039;&#039;M&#039;&#039;&#039;obility &#039;&#039;&#039;G&#039;&#039;&#039;roup domain.&lt;br /&gt;
It is approximately 80 residues-long. It mediates the binding of the protein to the minor groove of DNA. It is the most important part of the SRY protein. Not only because it enables  the protein to bind the DNA but also because even a single mutation can cause an inactivation of the protein.&lt;br /&gt;
&lt;br /&gt;
It has a twisted L shape: it has a long (28Å) and a short (22Å) arm. The HMG Box is made of 3 helices. Its N-term and C-term domains are irregular. The overall structure is stabilized by a hydrophobic core especially at the intersection of the 3 helices where 3 aromatics cycles meet, surrounded by aliphatic aminoacids.&lt;br /&gt;
See the different structures:&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_1/3&#039;&amp;gt;Helix 1&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_2/2&#039;&amp;gt;Helix 2&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_3/1&#039;&amp;gt;Helix 3&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Long_arm_28a/1&#039;&amp;gt;Long arm (28Å)&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Short_arm_22a/1&#039;&amp;gt;Short arm (22Å)&amp;lt;/scene&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The interaction between the HMG-Box and DNA is specific and stable.  It is mostly hydrophobic. It permits the DNA to bend of DNA (≈75°). Only one molecule of water interfaces the Box and the DNA. The complex is stabilized by salt bridges between positively charged residues of the HMG domain and negatively charged phosphates&amp;lt;ref name=&amp;quot;Tang&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
[[Image:HHMG-bitmap.png|thumb|alt=Image bitmap|Linear structure of hHMG domain]]&lt;br /&gt;
&lt;br /&gt;
The binding of SRY on DNA is specific. The DNA target site is a DNA octamer :&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:30%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
(5&#039;-dGCACAAAC)&amp;lt;br/&amp;gt;&lt;br /&gt;
(5&#039;-dGTTTGTGC)&lt;br /&gt;
&amp;lt;/small&amp;gt;&amp;lt;/div&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
This sequence is found in the promoters of genes expressed during the testicular development.&lt;br /&gt;
The bend of DNA enables the recruitment of different proteins and the building of massive proteins-DNA complexes that could change the expression of different genes&amp;lt;ref&amp;gt;PMID:11563911&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
Even if the most important function of the HMG box is binding and bending DNA, it is also involved in DNA condensation, recombination and repair.&lt;br /&gt;
&lt;br /&gt;
There are two kinds of proteins that contain a HMG box:&lt;br /&gt;
* &#039;&#039;&#039;HMG1&#039;&#039;&#039; : It is expressed in few cell types. It is found in transcription factors that contain a single HMG box. The binding of a DNA sequence is specific.&lt;br /&gt;
* &#039;&#039;&#039;HMG2&#039;&#039;&#039; : It is found in all cell types and is abundant in chromatin. These proteins can contain two or more HMG boxes that can non-specifically bind DNA. &lt;br /&gt;
&lt;br /&gt;
===General structure of SRY===&lt;br /&gt;
&lt;br /&gt;
The overall structure of SRY is organized around the HMG-box.&lt;br /&gt;
3 domains:&lt;br /&gt;
* N-term domain&lt;br /&gt;
* Central domain : DNA binding (HMG box)&lt;br /&gt;
* C-term domain&lt;br /&gt;
&lt;br /&gt;
== Function ==&lt;br /&gt;
&lt;br /&gt;
===Sex determining===&lt;br /&gt;
&lt;br /&gt;
It acts like a sex determining factor thanks to its transcriptional activity. It inhibits the development of female sex structures in the embryonic individual.&lt;br /&gt;
&lt;br /&gt;
The SRY protein contains nuclear localization signals in N and C terminals. An acetylation of these domains allows the exportation of the SRY protein to the nucleus&amp;lt;ref name=&amp;quot;Harley&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
The SRY protein activates the &#039;&#039;SOX9&#039;&#039; (SRY-box9) gene &amp;lt;ref name=&amp;quot;McE&amp;quot; /&amp;gt;. This gene is found in long arm 24.3 of the chromosome 17&amp;lt;ref&amp;gt; NCBI [http://www.ncbi.nlm.nih.gov/gene/6662 NCBI gene: SOX9 SRY-BOX9 Homo sapiens] &amp;lt;/ref&amp;gt; and is implicated in the stimulation of the differentiation of pre-Sertori into Sertoli cells rather than granulosa cells.&lt;br /&gt;
&lt;br /&gt;
The activation of &#039;&#039;SOX&#039;&#039;9 is done by the SRY protein and another transcriptional factor: SF1 (steroidogenic factor 1). These transcriptional factors are bound on an enhancer called: TESCO (Testis-Specific Enhancer of &#039;&#039;SOX9&#039;&#039; core element). The binding of a transcriptional factor on an enhancer provokes a curvature of the DNA (≈75°), allowing a stabilization of the elongation complex on the &#039;&#039;SOX9&#039;&#039; promoter. The SOX9 protein activates the gene &#039;&#039;AMH&#039;&#039; (Anti-Mullerian Hormone)&amp;lt;ref&amp;gt;[http://www.ebi.ac.uk/interpro/entry/IPR006799?q=AMH EBI-Interpro: Anti-Mullerian-Hormon, N-term] &amp;lt;/ref&amp;gt;. Therefore, it allows the degeneration of the channels of Müller in male&amp;lt;ref name=&amp;quot;Harley&amp;quot; /&amp;gt;.&lt;br /&gt;
===Cathecolamines regulation===&lt;br /&gt;
&lt;br /&gt;
It has been shown that SRY is present in brain regions and activates the Tyrosine-3-Hydroxylase expression. This enzyme catalyses the rate-limiting step of catecholamine synthesis (L-Tyrosine to L-DOPA). Furthermore, SRY also activates the expression of Monoamine Oxidase A which is responsible for the inactivation of catecholamines. Therefore, it regulates both positively and negatively the catecholamines concentration&amp;lt;ref name=&amp;quot;Veitia&amp;quot;&amp;gt;PMID: 24604382&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Other extra-testicular effects===&lt;br /&gt;
&lt;br /&gt;
Some knock-down experiments have shown that SRY may also be a major actor in the dopamine pathway. On the peripheral side, it seems to regulate noradrenaline levels and blood pressure&amp;lt;ref name=&amp;quot;Veitia&amp;quot; /&amp;gt;. A researcher who contributed to discovering these effects says it might explain why &amp;quot;the aggressive fight-or-flight reaction is more dominant in men, while women predominantly adopt a less aggressive tend-and-befriend response&amp;quot;&amp;lt;ref&amp;gt;Cohen, Tamara. The &#039;macho&#039; gene that makes men behave aggressively has been found. The Daily Mail (2012). [http://www.dailymail.co.uk/sciencetech/article-2111668/The-macho-gene-makes-men-aggressive-found.html#ixzz3yZC2BV4k]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
It has been shown that SRY may be involved in the regulation of the renin-angiotensin system in mice. Indeed, sequence mutations of the protein lead to hypertension. Because the human&#039;s SRY organisation is very closed to the mouse&#039;s, it has been proposed that SRY may have the same function in humans but it has not been studied directly&amp;lt;ref&amp;gt;PMID:22315667&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
== Diseases==&lt;br /&gt;
&lt;br /&gt;
=== Swyer syndrome (AKA XY gonadal dysgenis) :===&lt;br /&gt;
&lt;br /&gt;
If the TDF protein is not able to bind its targeted DNA sequences, the genes responsible for the testis development are not expressed. The patient owning this defective protein will then develop female characters, even though he has a XY karyotype. This phenomenon is known as the &amp;quot;Swyer Syndrome&amp;quot;. &lt;br /&gt;
Different causes can explain this &amp;quot;XY gonadal dysgenis&amp;quot;, as it is also called. About thirty mutations (named [http://www.uniprot.org/uniprot/Q05066#sequences &amp;quot;SRXY1&amp;quot;]) in the SRY gene have been shown to drive this phenotype development. It can also be due to crossovers during a meiosis. If a Y chromosome portion carrying the SRY gene is recombined into a X chromosome, a sperm cell will get this abnormal Y chromosome. If it then fecundates, a XY karyotype without any SRY gene will be formed. &lt;br /&gt;
&lt;br /&gt;
=== De La Chapelle syndrome (AKA XX male syndrome) :===&lt;br /&gt;
&lt;br /&gt;
From the meiosis just described would also result an abnormal X chromosome, carrying the SRY gene. If the sperm cell owning this chromosome fecundates an ovule, the resulting newborn will have a XX karyotype but a male phenotype. This is called the &amp;quot;De La Chapelle syndrome&amp;quot;. In this case, the patient can either develop testis or both testis and ovarian tissues. As some epigenetic mechanisms can inactivate the X chromosome carrying SRY, this syndrome keeps most of the patients sterile&amp;lt;ref&amp;gt;PMID: 4622299&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Hepatocellular carcinoma===&lt;br /&gt;
 &lt;br /&gt;
In the case on a hepatocellular carcinoma, it has been proved that high expression levels of SRY help cancer progression and poor patient survival. However, it still seems that hepatocellular carcinoma is not most likely to develop in men&amp;lt;ref&amp;gt;PMID: 25274159&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
== Structural highlights ==&lt;br /&gt;
&lt;br /&gt;
This is a sample scene created with SAT to &amp;lt;scene name=&amp;quot;/12/3456/Sample/1&amp;quot;&amp;gt;color&amp;lt;/scene&amp;gt; by Group, and another to make &amp;lt;scene name=&amp;quot;/12/3456/Sample/2&amp;quot;&amp;gt;a transparent representation&amp;lt;/scene&amp;gt; of the protein. You can make your own scenes on SAT starting from scratch or loading and editing one of these sample scenes.&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_1/3&#039;&amp;gt;Helix 1&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_2/2&#039;&amp;gt;Helix 2&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_3/1&#039;&amp;gt;Helix 3&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Long_arm_28a/1&#039;&amp;gt;Long arm (28A)&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Short_arm_22a/1&#039;&amp;gt;Short arm (22A)&amp;lt;/scene&amp;gt;&lt;br /&gt;
&amp;lt;/StructureSection&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== References ==&lt;br /&gt;
&amp;lt;references/&amp;gt;&lt;/div&gt;</summary>
		<author><name>Fantin Mesny</name></author>
	</entry>
	<entry>
		<id>https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2526337</id>
		<title>Sandbox Reserved 1120</title>
		<link rel="alternate" type="text/html" href="https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2526337"/>
		<updated>2016-01-30T14:58:29Z</updated>

		<summary type="html">&lt;p&gt;Fantin Mesny: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{Sandbox_Reserved_ESBS_2015}}&amp;lt;!-- PLEASE ADD YOUR CONTENT BELOW HERE --&amp;gt;&lt;br /&gt;
=SRY protein (AKA TDF protein)=&lt;br /&gt;
{{SRY protein (AKA TDF protein)}}&lt;br /&gt;
&amp;lt;StructureSection load=&#039;1hry&#039; size=&#039;340&#039; frame=&#039;true&#039; side=&#039;right&#039; caption=&#039;The SRY protein linked to DNA&#039; scene=&#039;71/719861/Base/1&#039;&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;table&amp;gt;&amp;lt;tr&amp;gt;&amp;lt;td colspan=&#039;2&#039;&amp;gt;The SRY protein is a 204 residues-long monomeric polypeptide. It is encoded by the SRY gene and is involved in the sex determination in mammals by being responsible for the gonadogenesis and so the male sexual development. It is the HMG-box that gives to the protein its ability to bind DNA by its minor groove&amp;lt;ref name =&amp;quot;Tang&amp;quot;&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;.&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr id=&#039;related&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;[[Related_structure|Related:]]&amp;lt;/b&amp;gt;&amp;lt;/td&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;[[1hrz|1hrz]]&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr id=&#039;resources&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Resources:&amp;lt;/b&amp;gt;&amp;lt;/td&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;&amp;lt;span class=&#039;plainlinks&#039;&amp;gt;[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=1hry FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=1hry OCA], [http://pdbe.org/1hry PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=1hry RCSB], [http://www.ebi.ac.uk/pdbsum/1hry PDBsum]&lt;br /&gt;
&amp;lt;tr id=&#039;Gene&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Encoded by&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;The SRY gene codes for the SRY protein&lt;br /&gt;
&amp;lt;tr id=&#039;Length&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Length&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;204 residues&lt;br /&gt;
&amp;lt;tr id=&#039;Molecular weight&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Molecular weight&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;≈23kDa&lt;br /&gt;
&amp;lt;tr id=&#039;DNA target sequence&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;DNA target sequence&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;(5&#039;-dGCACAAAC)&lt;br /&gt;
&amp;lt;tr id=&#039;Regulation&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Regulation&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;[https://en.wikipedia.org/wiki/Steroidogenic_factor_1 Sf1];[https://en.wikipedia.org/wiki/Sp1_transcription_factor Sp1] (binding site in the promoter of SRY : -150),[https://en.wikipedia.org/wiki/WT1 WT1] (binding site in the promoter of SRY : -87)&lt;br /&gt;
&amp;lt;tr id=&#039;Role&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Role&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;Transcription factor&lt;br /&gt;
&amp;lt;tr id=&#039;Genes targeted&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Genes targeted&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;&amp;lt;i&amp;gt;SOX9&amp;lt;/i&amp;gt;, &amp;lt;i&amp;gt;TH&amp;lt;/i&amp;gt;, &amp;lt;i&amp;gt;MAOA&amp;lt;/i&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;/span&amp;gt;&lt;br /&gt;
&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;/table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==History==&lt;br /&gt;
&lt;br /&gt;
After centuries of unfounded theories mainly based on environmental factors, the first molecular theory concerning the sex determination appeared in 1891. At this time, the german biologist Hermann Henking was studying sperm formation in wasps. As a chromosome which was not present in all the wasps looked different from the others, he suspected it to play a role in sex determination and called it the &amp;quot;X chromosome&amp;quot;.&lt;br /&gt;
Ten years later, Clarence Erwin McClung saw that this chromosome behaved differently during the meiosis and was only present in half the sperm cells of grasshoppers. As the main characteristic that varies in 50/50 proportions among zygotes is the sex, McClung suspected the X chromosome to be implicated in sexual development. &lt;br /&gt;
In 1905, Nettie Stevens discovered the &amp;quot;Y chromosome&amp;quot; (and the female XX and male XY patterns) while she was counting the chromosomes of beetles under the microscope&amp;lt;ref&amp;gt;Sumner, A. T. Sex Chromosomes and Sex Determination. Chromosomes: Organization and Function, 97-108. [http://www.nature.com/scitable/nated/topicpage/Sex-Chromosomes-and-Sex-Determination-44565]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
During the next decades, a few theories were in competition. In 1921, Calvin Bridges&#039;s works on &#039;&#039;Drosophila melanogaster&#039;&#039; seemed to reveal that male characters acquisition is due to a genic balance between the genes contained in the X chromosome and those contained in the autosomes&amp;lt;ref&amp;gt;PMID: 17769897&amp;lt;/ref&amp;gt;.&lt;br /&gt;
In 1930, Ronald Fisher introduced the first Y-based control of sex theory by proposing two different models : either all the genes responsible for the male characters are located on the Y chromosome or there is a Y-located gene which regulates the expression of genes elsewhere in the genome&amp;lt;ref name=&amp;quot;Goodfellow&amp;quot;&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt;.&lt;br /&gt;
As Alfred Jost had shown the testosterone produced by the testis is responsible for the entire male phenotype acquisition&amp;lt;ref&amp;gt;PMID: 4805859&amp;lt;/ref&amp;gt;, Peter Neville Goodfellow proposed in 1988, that there is a gene (&#039;&#039;TDF&#039;&#039; in human, &#039;&#039;Tdy&#039;&#039; in mice)  on the Y chromosome which drives the development of the testis&amp;lt;ref name=&amp;quot;Goodfellow&amp;quot; /&amp;gt;. In 1990, Goodfellow&#039;s hypothesis was validated with the discovery of &#039;&#039;Tdy&#039;&#039;&#039;s localisation. This gene&#039;s product (expressed during the male gonadal development) owns an amino-acid motif which shows homology to other known or putative DNA-binding domains. &#039;&#039;Tdy&#039;&#039; is therefore a transcriptional factor&amp;lt;ref&amp;gt;PMID: 2374589&amp;lt;/ref&amp;gt;. The same year, the human &#039;&#039;SRY&#039;&#039; gene (accepted later as the &#039;&#039;TDF&#039;&#039;) was discovered&amp;lt;ref&amp;gt;PMID: 1695712&amp;lt;/ref&amp;gt;. &lt;br /&gt;
Three dimensional structure of the SRY protein was determined in 1995 using NMR spectroscopy&amp;lt;ref&amp;gt;PMID:7774012&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
==SRY gene==&lt;br /&gt;
&lt;br /&gt;
The SRY gene encodes the SRY protein. The SRY protein is a transcriptional factor that induces the male phenotype in the embryo. The SRY gene is located on the [https://en.wikipedia.org/wiki/Y_chromosome Y chromosome] in the short arm (p) 11.3 &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/gene/6736 NCBI gene]&amp;lt;/ref&amp;gt;. This gene has only one exon that contains the HMG domain (DNA-binding High-Mobility Group box domain). It means that SRY mRNA does not have an alternative splicing, so there is only one isoforme of SRY protein&amp;lt;ref name=&amp;quot;McE&amp;quot;&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;. Moreover, the human genome contains only one copy of the SRY gene, whereas the mouse genome contains 6 copy of this gene&amp;lt;ref&amp;gt; Sekido R, Lovell-Badge R. Genetic control of testis development. Sex Dev Genet Mol Biol Evol Endocrinol Embryol Pathol Sex Determ Differ. 2013;7(1-3):21–32 &amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Sequence of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:90%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
&amp;gt;gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/nuccore NCBI nucleotide]&amp;lt;/ref&amp;gt;&lt;br /&gt;
TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT&lt;br /&gt;
TTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACA&lt;br /&gt;
&amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;ATG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;CAATCATATGCTTCTGCTATGTTAAGCGTATTCAACAGCGATGATTACAGTCCAGCTGTGCAAGAGAAT&lt;br /&gt;
ATTCCCGCTCTCCGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTAAGTATCAGTGTGAAA&lt;br /&gt;
CGGGAGAAAACAGTAAAGGCAACGTCCAGGATAGAGTGAAGCGACCCATGAACGCATTCATCGTGTGGTC&lt;br /&gt;
&#039;&#039;&#039;TCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCAGAGATCAGCAAGCAGCTG&lt;br /&gt;
&#039;&#039;&#039;GGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCATTCTTCCAGGAGGCACAGAAATTACAGG&lt;br /&gt;
&#039;&#039;&#039;CCATGCACAGAGAGAAATACCCGAATTATAAGTATCGA&#039;&#039;&#039;CCTCGTCGGAAGGCGAAGATGCTGCCGAAGAA&lt;br /&gt;
TTGCAGTTTGCTTCCCGCAGATCCCGCTTCGGTACTCTGCAGCGAAGTGCAACTGGACAACAGGTTGTAC&lt;br /&gt;
AGGGATGACTGTACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAACG&lt;br /&gt;
CAGCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTG&amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;TAG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;GACAATCGGGTAACATT&lt;br /&gt;
GGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCACTTTCTTATGTTTAGTTT&lt;br /&gt;
CAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCATTTCA&amp;lt;/small&amp;gt;&lt;br /&gt;
&lt;br /&gt;
(Legend : &amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Initiation codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt; ; &amp;lt;b&amp;gt;HMG sequence&amp;lt;/b&amp;gt; ; &amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Stop codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;)&lt;br /&gt;
&amp;lt;/div&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Regulation of the expression of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
In humans, the SRY promoter is located between −408 and −95 bp. Moreover, the SRY gene has enhancers at -727 pb. The linkage between regulatory proteins and these enhancers has the property to increase the production of SRY proteins. These regulatory proteins could be: SF1 (steroidogenic factor 1), SP1  and WT 1 (Wilms tumor)&amp;lt;ref name=&amp;quot;Harley&amp;quot;&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;SF1&#039;&#039;&#039;: this transcriptional factor belongs to the family of nuclear hormone receptors and contains a zinc finger. The activation of this protein requires a ligand (hormone).&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;SP1&#039;&#039;&#039;: this transcriptional factor is an ubiquitous protein which binds rich GC-sites and is implicated in the transcription of many genes. Moreover, this protein contains a zinc finger.&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;WT1&#039;&#039;&#039; :this transcriptional factor transactivates the SRY gene. It contains a zinc finger&amp;lt;ref&amp;gt;Larney C, Bailey TL, Koopman P. Switching on sex: transcriptional regulation of the testis-determining gene Sry. Dev Camb Engl. 2014 Jun;141(11):2195–205&amp;lt;/ref&amp;gt;. &lt;br /&gt;
&lt;br /&gt;
==Structure==&lt;br /&gt;
&lt;br /&gt;
===The SRY-HMG domain (HMG-Box)===&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;&#039;SRY-HMG&#039;&#039;&#039; stands for &#039;&#039;&#039;S&#039;&#039;&#039;ex determining &#039;&#039;&#039;R&#039;&#039;&#039;egion &#039;&#039;&#039;Y&#039;&#039;&#039; - &#039;&#039;&#039;H&#039;&#039;&#039;igh &#039;&#039;&#039;M&#039;&#039;&#039;obility &#039;&#039;&#039;G&#039;&#039;&#039;roup domain.&lt;br /&gt;
It is approximately 80 residues-long. It mediates the binding of the protein to the minor groove of DNA. It is the most important part of the SRY protein. Not only because it enables  the protein to bind the DNA but also because even a single mutation can cause an inactivation of the protein.&lt;br /&gt;
&lt;br /&gt;
It has a twisted L shape: it has a long (28Å) and a short (22Å) arm. The HMG Box is made of 3 helices. Its N-term and C-term domains are irregular. The overall structure is stabilized by a hydrophobic core especially at the intersection of the 3 helices where 3 aromatics cycles meet, surrounded by aliphatic aminoacids.&lt;br /&gt;
See the different structures:&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_1/3&#039;&amp;gt;Helix 1&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_2/2&#039;&amp;gt;Helix 2&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_3/1&#039;&amp;gt;Helix 3&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Long_arm_28a/1&#039;&amp;gt;Long arm (28Å)&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Short_arm_22a/1&#039;&amp;gt;Short arm (22Å)&amp;lt;/scene&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The interaction between the HMG-Box and DNA is specific and stable.  It is mostly hydrophobic. It permits the DNA to bend of DNA (≈75°). Only one molecule of water interfaces the Box and the DNA. The complex is stabilized by salt bridges between positively charged residues of the HMG domain and negatively charged phosphates&amp;lt;ref name=&amp;quot;Tang&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
[[Image:HHMG-bitmap.png|thumb|alt=Image bitmap|Linear structure of hHMG domain]]&lt;br /&gt;
&lt;br /&gt;
The binding of SRY on DNA is specific. The DNA target site is a DNA octamer :&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:30%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
(5&#039;-dGCACAAAC)&amp;lt;br/&amp;gt;&lt;br /&gt;
(5&#039;-dGTTTGTGC)&lt;br /&gt;
&amp;lt;/small&amp;gt;&amp;lt;/div&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
This sequence is found in the promoters of genes expressed during the testicular development.&lt;br /&gt;
The bend of DNA enables the recruitment of different proteins and the building of massive proteins-DNA complexes that could change the expression of different genes&amp;lt;ref&amp;gt;PMID:11563911&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
Even if the most important function of the HMG box is binding and bending DNA, it is also involved in DNA condensation, recombination and repair.&lt;br /&gt;
&lt;br /&gt;
There are two kinds of proteins that contain a HMG box:&lt;br /&gt;
* &#039;&#039;&#039;HMG1&#039;&#039;&#039; : It is expressed in few cell types. It is found in transcription factors that contain a single HMG box. The binding of a DNA sequence is specific.&lt;br /&gt;
* &#039;&#039;&#039;HMG2&#039;&#039;&#039; : It is found in all cell types and is abundant in chromatin. These proteins can contain two or more HMG boxes that can non-specifically bind DNA. &lt;br /&gt;
&lt;br /&gt;
===General structure of SRY===&lt;br /&gt;
&lt;br /&gt;
The overall structure of SRY is organized around the HMG-box.&lt;br /&gt;
3 domains:&lt;br /&gt;
* N-term domain&lt;br /&gt;
* Central domain : DNA binding (HMG box)&lt;br /&gt;
* C-term domain&lt;br /&gt;
&lt;br /&gt;
== Function ==&lt;br /&gt;
&lt;br /&gt;
===Sex determining===&lt;br /&gt;
&lt;br /&gt;
It acts like a sex determining factor thanks to its transcriptional activity. It inhibits the development of female sex structures in the embryonic individual.&lt;br /&gt;
&lt;br /&gt;
The SRY protein contains nuclear localization signals in N and C terminals. An acetylation of these domains allows the exportation of the SRY protein to the nucleus&amp;lt;ref name=&amp;quot;Harley&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
The SRY protein activates the &#039;&#039;SOX9&#039;&#039; (SRY-box9) gene &amp;lt;ref name=&amp;quot;McE&amp;quot; /&amp;gt;. This gene is found in long arm 24.3 of the chromosome 17&amp;lt;ref&amp;gt; NCBI [http://www.ncbi.nlm.nih.gov/gene/6662 NCBI gene: SOX9 SRY-BOX9 Homo sapiens] &amp;lt;/ref&amp;gt; and is implicated in the stimulation of the differentiation of pre-Sertori into Sertoli cells rather than granulosa cells.&lt;br /&gt;
&lt;br /&gt;
The activation of &#039;&#039;SOX&#039;&#039;9 is done by the SRY protein and another transcriptional factor: SF1 (steroidogenic factor 1). These transcriptional factors are bound on an enhancer called: TESCO (Testis-Specific Enhancer of &#039;&#039;SOX9&#039;&#039; core element). The binding of a transcriptional factor on an enhancer provokes a curvature of the DNA (≈75°), allowing a stabilization of the elongation complex on the &#039;&#039;SOX9&#039;&#039; promoter. The SOX9 protein activates the gene &#039;&#039;AMH&#039;&#039; (Anti-Mullerian Hormone)&amp;lt;ref&amp;gt;[http://www.ebi.ac.uk/interpro/entry/IPR006799?q=AMH EBI-Interpro: Anti-Mullerian-Hormon, N-term] &amp;lt;/ref&amp;gt;. Therefore, it allows the degeneration of the channels of Müller in male&amp;lt;ref name=&amp;quot;Harley&amp;quot; /&amp;gt;.&lt;br /&gt;
===Cathecolamines regulation===&lt;br /&gt;
&lt;br /&gt;
It has been shown that SRY is present in brain regions and activates the Tyrosine-3-Hydroxylase expression. This enzyme catalyses the rate-limiting step of catecholamine synthesis (L-Tyrosine to L-DOPA). Furthermore, SRY also activates the expression of Monoamine Oxidase A which is responsible for the inactivation of catecholamines. Therefore, it regulates both positively and negatively the catecholamines concentration&amp;lt;ref name=&amp;quot;Veitia&amp;quot;&amp;gt;PMID: 24604382&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Other extra-testicular effects===&lt;br /&gt;
&lt;br /&gt;
Some knock-down experiments have shown that SRY may also be a major actor in the dopamine pathway. On the peripheral side, it seems to regulate noradrenaline levels and blood pressure&amp;lt;ref name=&amp;quot;Veitia&amp;quot; /&amp;gt;. A researcher who contributed to discovering these effects says it might explain why &amp;quot;the aggressive fight-or-flight reaction is more dominant in men, while women predominantly adopt a less aggressive tend-and-befriend response&amp;quot;&amp;lt;ref&amp;gt;Cohen, Tamara. The &#039;macho&#039; gene that makes men behave aggressively has been found. The Daily Mail (2012). [http://www.dailymail.co.uk/sciencetech/article-2111668/The-macho-gene-makes-men-aggressive-found.html#ixzz3yZC2BV4k]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
It has been shown that SRY may be involved in the regulation of the renin-angiotensin system in mice. Indeed, sequence mutations of the protein lead to hypertension. Because the human&#039;s SRY organisation is very closed to the mouse&#039;s, it has been proposed that SRY may have the same function in humans but it has not been studied directly&amp;lt;ref&amp;gt;PMID:22315667&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
== Diseases==&lt;br /&gt;
&lt;br /&gt;
=== Swyer syndrome (AKA XY gonadal dysgenis) :===&lt;br /&gt;
&lt;br /&gt;
If the TDF protein is not able to bind its targeted DNA sequences, the genes responsible for the testis development are not expressed. The patient owning this defective protein will then develop female characters, even though he has a XY karyotype. This phenomenon is known as the &amp;quot;Swyer Syndrome&amp;quot;. &lt;br /&gt;
Different causes can explain this &amp;quot;XY gonadal dysgenis&amp;quot;, as it is also called. About thirty mutations (named [http://www.uniprot.org/uniprot/Q05066#sequences &amp;quot;SRXY1&amp;quot;]) in the SRY gene have been shown to drive this phenotype development. It can also be due to crossovers during a meiosis. If a Y chromosome portion carrying the SRY gene is recombined into a X chromosome, a sperm cell will get this abnormal Y chromosome. If it then fecundates, a XY karyotype without any SRY gene will be formed. &lt;br /&gt;
&lt;br /&gt;
=== De La Chapelle syndrome (AKA XX male syndrome) :===&lt;br /&gt;
&lt;br /&gt;
From the meiosis just described would also result an abnormal X chromosome, carrying the SRY gene. If the sperm cell owning this chromosome fecundates an ovule, the resulting newborn will have a XX karyotype but a male phenotype. This is called the &amp;quot;De La Chapelle syndrome&amp;quot;. In this case, the patient can either develop testis or both testis and ovarian tissues. As some epigenetic mechanisms can inactivate the X chromosome carrying SRY, this syndrome keeps most of the patients sterile&amp;lt;ref&amp;gt;PMID: 4622299&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Hepatocellular carcinoma===&lt;br /&gt;
 &lt;br /&gt;
In the case on a hepatocellular carcinoma, it has been proved that high expression levels of SRY help cancer progression and poor patient survival. However, it still seems that hepatocellular carcinoma is not most likely to develop in men&amp;lt;ref&amp;gt;PMID: 25274159&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
== Structural highlights ==&lt;br /&gt;
&lt;br /&gt;
This is a sample scene created with SAT to &amp;lt;scene name=&amp;quot;/12/3456/Sample/1&amp;quot;&amp;gt;color&amp;lt;/scene&amp;gt; by Group, and another to make &amp;lt;scene name=&amp;quot;/12/3456/Sample/2&amp;quot;&amp;gt;a transparent representation&amp;lt;/scene&amp;gt; of the protein. You can make your own scenes on SAT starting from scratch or loading and editing one of these sample scenes.&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_1/3&#039;&amp;gt;Helix 1&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_2/2&#039;&amp;gt;Helix 2&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_3/1&#039;&amp;gt;Helix 3&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Long_arm_28a/1&#039;&amp;gt;Long arm (28A)&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Short_arm_22a/1&#039;&amp;gt;Short arm (22A)&amp;lt;/scene&amp;gt;&lt;br /&gt;
&amp;lt;/StructureSection&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== References ==&lt;br /&gt;
&amp;lt;references/&amp;gt;&lt;/div&gt;</summary>
		<author><name>Fantin Mesny</name></author>
	</entry>
	<entry>
		<id>https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2526336</id>
		<title>Sandbox Reserved 1120</title>
		<link rel="alternate" type="text/html" href="https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2526336"/>
		<updated>2016-01-30T14:57:57Z</updated>

		<summary type="html">&lt;p&gt;Fantin Mesny: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{Sandbox_Reserved_ESBS_2015}}&amp;lt;!-- PLEASE ADD YOUR CONTENT BELOW HERE --&amp;gt;&lt;br /&gt;
=SRY protein (AKA TDF protein)=&lt;br /&gt;
{{SRY protein (AKA TDF protein)}}&lt;br /&gt;
&amp;lt;StructureSection load=&#039;1hry&#039; size=&#039;340&#039; frame=&#039;true&#039; side=&#039;right&#039; caption=&#039;The SRY protein linked to DNA&#039; scene=&#039;71/719861/Base/1&#039;&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;table&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td colspan=&#039;2&#039;&amp;gt;The SRY protein is a 204 residues-long monomeric polypeptide. It is encoded by the SRY gene and is involved in the sex determination in mammals by being responsible for the gonadogenesis and so the male sexual development. It is the HMG-box that gives to the protein its ability to bind DNA by its minor groove&amp;lt;ref name =&amp;quot;Tang&amp;quot;&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;.&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr id=&#039;related&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;[[Related_structure|Related:]]&amp;lt;/b&amp;gt;&amp;lt;/td&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;[[1hrz|1hrz]]&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr id=&#039;resources&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Resources:&amp;lt;/b&amp;gt;&amp;lt;/td&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;&amp;lt;span class=&#039;plainlinks&#039;&amp;gt;[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=1hry FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=1hry OCA], [http://pdbe.org/1hry PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=1hry RCSB], [http://www.ebi.ac.uk/pdbsum/1hry PDBsum]&lt;br /&gt;
&amp;lt;tr id=&#039;Gene&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Encoded by&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;The SRY gene codes for the SRY protein&lt;br /&gt;
&amp;lt;tr id=&#039;Length&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Length&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;204 residues&lt;br /&gt;
&amp;lt;tr id=&#039;Molecular weight&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Molecular weight&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;≈23kDa&lt;br /&gt;
&amp;lt;tr id=&#039;DNA target sequence&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;DNA target sequence&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;(5&#039;-dGCACAAAC)&lt;br /&gt;
&amp;lt;tr id=&#039;Regulation&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Regulation&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;[https://en.wikipedia.org/wiki/Steroidogenic_factor_1 Sf1];[https://en.wikipedia.org/wiki/Sp1_transcription_factor Sp1] (binding site in the promoter of SRY : -150),[https://en.wikipedia.org/wiki/WT1 WT1] (binding site in the promoter of SRY : -87)&lt;br /&gt;
&amp;lt;tr id=&#039;Role&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Role&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;Transcription factor&lt;br /&gt;
&amp;lt;tr id=&#039;Genes targeted&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Genes targeted&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;&amp;lt;i&amp;gt;SOX9&amp;lt;/i&amp;gt;, &amp;lt;i&amp;gt;TH&amp;lt;/i&amp;gt;, &amp;lt;i&amp;gt;MAOA&amp;lt;/i&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;/span&amp;gt;&lt;br /&gt;
&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;/table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==History==&lt;br /&gt;
&lt;br /&gt;
After centuries of unfounded theories mainly based on environmental factors, the first molecular theory concerning the sex determination appeared in 1891. At this time, the german biologist Hermann Henking was studying sperm formation in wasps. As a chromosome which was not present in all the wasps looked different from the others, he suspected it to play a role in sex determination and called it the &amp;quot;X chromosome&amp;quot;.&lt;br /&gt;
Ten years later, Clarence Erwin McClung saw that this chromosome behaved differently during the meiosis and was only present in half the sperm cells of grasshoppers. As the main characteristic that varies in 50/50 proportions among zygotes is the sex, McClung suspected the X chromosome to be implicated in sexual development. &lt;br /&gt;
In 1905, Nettie Stevens discovered the &amp;quot;Y chromosome&amp;quot; (and the female XX and male XY patterns) while she was counting the chromosomes of beetles under the microscope&amp;lt;ref&amp;gt;Sumner, A. T. Sex Chromosomes and Sex Determination. Chromosomes: Organization and Function, 97-108. [http://www.nature.com/scitable/nated/topicpage/Sex-Chromosomes-and-Sex-Determination-44565]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
During the next decades, a few theories were in competition. In 1921, Calvin Bridges&#039;s works on &#039;&#039;Drosophila melanogaster&#039;&#039; seemed to reveal that male characters acquisition is due to a genic balance between the genes contained in the X chromosome and those contained in the autosomes&amp;lt;ref&amp;gt;PMID: 17769897&amp;lt;/ref&amp;gt;.&lt;br /&gt;
In 1930, Ronald Fisher introduced the first Y-based control of sex theory by proposing two different models : either all the genes responsible for the male characters are located on the Y chromosome or there is a Y-located gene which regulates the expression of genes elsewhere in the genome&amp;lt;ref name=&amp;quot;Goodfellow&amp;quot;&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt;.&lt;br /&gt;
As Alfred Jost had shown the testosterone produced by the testis is responsible for the entire male phenotype acquisition&amp;lt;ref&amp;gt;PMID: 4805859&amp;lt;/ref&amp;gt;, Peter Neville Goodfellow proposed in 1988, that there is a gene (&#039;&#039;TDF&#039;&#039; in human, &#039;&#039;Tdy&#039;&#039; in mice)  on the Y chromosome which drives the development of the testis&amp;lt;ref name=&amp;quot;Goodfellow&amp;quot; /&amp;gt;. In 1990, Goodfellow&#039;s hypothesis was validated with the discovery of &#039;&#039;Tdy&#039;&#039;&#039;s localisation. This gene&#039;s product (expressed during the male gonadal development) owns an amino-acid motif which shows homology to other known or putative DNA-binding domains. &#039;&#039;Tdy&#039;&#039; is therefore a transcriptional factor&amp;lt;ref&amp;gt;PMID: 2374589&amp;lt;/ref&amp;gt;. The same year, the human &#039;&#039;SRY&#039;&#039; gene (accepted later as the &#039;&#039;TDF&#039;&#039;) was discovered&amp;lt;ref&amp;gt;PMID: 1695712&amp;lt;/ref&amp;gt;. &lt;br /&gt;
Three dimensional structure of the SRY protein was determined in 1995 using NMR spectroscopy&amp;lt;ref&amp;gt;PMID:7774012&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
==SRY gene==&lt;br /&gt;
&lt;br /&gt;
The SRY gene encodes the SRY protein. The SRY protein is a transcriptional factor that induces the male phenotype in the embryo. The SRY gene is located on the [https://en.wikipedia.org/wiki/Y_chromosome Y chromosome] in the short arm (p) 11.3 &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/gene/6736 NCBI gene]&amp;lt;/ref&amp;gt;. This gene has only one exon that contains the HMG domain (DNA-binding High-Mobility Group box domain). It means that SRY mRNA does not have an alternative splicing, so there is only one isoforme of SRY protein&amp;lt;ref name=&amp;quot;McE&amp;quot;&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;. Moreover, the human genome contains only one copy of the SRY gene, whereas the mouse genome contains 6 copy of this gene&amp;lt;ref&amp;gt; Sekido R, Lovell-Badge R. Genetic control of testis development. Sex Dev Genet Mol Biol Evol Endocrinol Embryol Pathol Sex Determ Differ. 2013;7(1-3):21–32 &amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Sequence of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:90%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
&amp;gt;gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/nuccore NCBI nucleotide]&amp;lt;/ref&amp;gt;&lt;br /&gt;
TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT&lt;br /&gt;
TTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACA&lt;br /&gt;
&amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;ATG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;CAATCATATGCTTCTGCTATGTTAAGCGTATTCAACAGCGATGATTACAGTCCAGCTGTGCAAGAGAAT&lt;br /&gt;
ATTCCCGCTCTCCGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTAAGTATCAGTGTGAAA&lt;br /&gt;
CGGGAGAAAACAGTAAAGGCAACGTCCAGGATAGAGTGAAGCGACCCATGAACGCATTCATCGTGTGGTC&lt;br /&gt;
&#039;&#039;&#039;TCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCAGAGATCAGCAAGCAGCTG&lt;br /&gt;
&#039;&#039;&#039;GGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCATTCTTCCAGGAGGCACAGAAATTACAGG&lt;br /&gt;
&#039;&#039;&#039;CCATGCACAGAGAGAAATACCCGAATTATAAGTATCGA&#039;&#039;&#039;CCTCGTCGGAAGGCGAAGATGCTGCCGAAGAA&lt;br /&gt;
TTGCAGTTTGCTTCCCGCAGATCCCGCTTCGGTACTCTGCAGCGAAGTGCAACTGGACAACAGGTTGTAC&lt;br /&gt;
AGGGATGACTGTACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAACG&lt;br /&gt;
CAGCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTG&amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;TAG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;GACAATCGGGTAACATT&lt;br /&gt;
GGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCACTTTCTTATGTTTAGTTT&lt;br /&gt;
CAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCATTTCA&amp;lt;/small&amp;gt;&lt;br /&gt;
&lt;br /&gt;
(Legend : &amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Initiation codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt; ; &amp;lt;b&amp;gt;HMG sequence&amp;lt;/b&amp;gt; ; &amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Stop codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;)&lt;br /&gt;
&amp;lt;/div&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Regulation of the expression of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
In humans, the SRY promoter is located between −408 and −95 bp. Moreover, the SRY gene has enhancers at -727 pb. The linkage between regulatory proteins and these enhancers has the property to increase the production of SRY proteins. These regulatory proteins could be: SF1 (steroidogenic factor 1), SP1  and WT 1 (Wilms tumor)&amp;lt;ref name=&amp;quot;Harley&amp;quot;&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;SF1&#039;&#039;&#039;: this transcriptional factor belongs to the family of nuclear hormone receptors and contains a zinc finger. The activation of this protein requires a ligand (hormone).&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;SP1&#039;&#039;&#039;: this transcriptional factor is an ubiquitous protein which binds rich GC-sites and is implicated in the transcription of many genes. Moreover, this protein contains a zinc finger.&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;WT1&#039;&#039;&#039; :this transcriptional factor transactivates the SRY gene. It contains a zinc finger&amp;lt;ref&amp;gt;Larney C, Bailey TL, Koopman P. Switching on sex: transcriptional regulation of the testis-determining gene Sry. Dev Camb Engl. 2014 Jun;141(11):2195–205&amp;lt;/ref&amp;gt;. &lt;br /&gt;
&lt;br /&gt;
==Structure==&lt;br /&gt;
&lt;br /&gt;
===The SRY-HMG domain (HMG-Box)===&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;&#039;SRY-HMG&#039;&#039;&#039; stands for &#039;&#039;&#039;S&#039;&#039;&#039;ex determining &#039;&#039;&#039;R&#039;&#039;&#039;egion &#039;&#039;&#039;Y&#039;&#039;&#039; - &#039;&#039;&#039;H&#039;&#039;&#039;igh &#039;&#039;&#039;M&#039;&#039;&#039;obility &#039;&#039;&#039;G&#039;&#039;&#039;roup domain.&lt;br /&gt;
It is approximately 80 residues-long. It mediates the binding of the protein to the minor groove of DNA. It is the most important part of the SRY protein. Not only because it enables  the protein to bind the DNA but also because even a single mutation can cause an inactivation of the protein.&lt;br /&gt;
&lt;br /&gt;
It has a twisted L shape: it has a long (28Å) and a short (22Å) arm. The HMG Box is made of 3 helices. Its N-term and C-term domains are irregular. The overall structure is stabilized by a hydrophobic core especially at the intersection of the 3 helices where 3 aromatics cycles meet, surrounded by aliphatic aminoacids.&lt;br /&gt;
See the different structures:&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_1/3&#039;&amp;gt;Helix 1&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_2/2&#039;&amp;gt;Helix 2&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_3/1&#039;&amp;gt;Helix 3&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Long_arm_28a/1&#039;&amp;gt;Long arm (28Å)&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Short_arm_22a/1&#039;&amp;gt;Short arm (22Å)&amp;lt;/scene&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The interaction between the HMG-Box and DNA is specific and stable.  It is mostly hydrophobic. It permits the DNA to bend of DNA (≈75°). Only one molecule of water interfaces the Box and the DNA. The complex is stabilized by salt bridges between positively charged residues of the HMG domain and negatively charged phosphates&amp;lt;ref name=&amp;quot;Tang&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
[[Image:HHMG-bitmap.png|thumb|alt=Image bitmap|Linear structure of hHMG domain]]&lt;br /&gt;
&lt;br /&gt;
The binding of SRY on DNA is specific. The DNA target site is a DNA octamer :&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:30%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
(5&#039;-dGCACAAAC)&amp;lt;br/&amp;gt;&lt;br /&gt;
(5&#039;-dGTTTGTGC)&lt;br /&gt;
&amp;lt;/small&amp;gt;&amp;lt;/div&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
This sequence is found in the promoters of genes expressed during the testicular development.&lt;br /&gt;
The bend of DNA enables the recruitment of different proteins and the building of massive proteins-DNA complexes that could change the expression of different genes&amp;lt;ref&amp;gt;PMID:11563911&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
Even if the most important function of the HMG box is binding and bending DNA, it is also involved in DNA condensation, recombination and repair.&lt;br /&gt;
&lt;br /&gt;
There are two kinds of proteins that contain a HMG box:&lt;br /&gt;
* &#039;&#039;&#039;HMG1&#039;&#039;&#039; : It is expressed in few cell types. It is found in transcription factors that contain a single HMG box. The binding of a DNA sequence is specific.&lt;br /&gt;
* &#039;&#039;&#039;HMG2&#039;&#039;&#039; : It is found in all cell types and is abundant in chromatin. These proteins can contain two or more HMG boxes that can non-specifically bind DNA. &lt;br /&gt;
&lt;br /&gt;
===General structure of SRY===&lt;br /&gt;
&lt;br /&gt;
The overall structure of SRY is organized around the HMG-box.&lt;br /&gt;
3 domains:&lt;br /&gt;
* N-term domain&lt;br /&gt;
* Central domain : DNA binding (HMG box)&lt;br /&gt;
* C-term domain&lt;br /&gt;
&lt;br /&gt;
== Function ==&lt;br /&gt;
&lt;br /&gt;
===Sex determining===&lt;br /&gt;
&lt;br /&gt;
It acts like a sex determining factor thanks to its transcriptional activity. It inhibits the development of female sex structures in the embryonic individual.&lt;br /&gt;
&lt;br /&gt;
The SRY protein contains nuclear localization signals in N and C terminals. An acetylation of these domains allows the exportation of the SRY protein to the nucleus&amp;lt;ref name=&amp;quot;Harley&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
The SRY protein activates the &#039;&#039;SOX9&#039;&#039; (SRY-box9) gene &amp;lt;ref name=&amp;quot;McE&amp;quot; /&amp;gt;. This gene is found in long arm 24.3 of the chromosome 17&amp;lt;ref&amp;gt; NCBI [http://www.ncbi.nlm.nih.gov/gene/6662 NCBI gene: SOX9 SRY-BOX9 Homo sapiens] &amp;lt;/ref&amp;gt; and is implicated in the stimulation of the differentiation of pre-Sertori into Sertoli cells rather than granulosa cells.&lt;br /&gt;
&lt;br /&gt;
The activation of &#039;&#039;SOX&#039;&#039;9 is done by the SRY protein and another transcriptional factor: SF1 (steroidogenic factor 1). These transcriptional factors are bound on an enhancer called: TESCO (Testis-Specific Enhancer of &#039;&#039;SOX9&#039;&#039; core element). The binding of a transcriptional factor on an enhancer provokes a curvature of the DNA (≈75°), allowing a stabilization of the elongation complex on the &#039;&#039;SOX9&#039;&#039; promoter. The SOX9 protein activates the gene &#039;&#039;AMH&#039;&#039; (Anti-Mullerian Hormone)&amp;lt;ref&amp;gt;[http://www.ebi.ac.uk/interpro/entry/IPR006799?q=AMH EBI-Interpro: Anti-Mullerian-Hormon, N-term] &amp;lt;/ref&amp;gt;. Therefore, it allows the degeneration of the channels of Müller in male&amp;lt;ref name=&amp;quot;Harley&amp;quot; /&amp;gt;.&lt;br /&gt;
===Cathecolamines regulation===&lt;br /&gt;
&lt;br /&gt;
It has been shown that SRY is present in brain regions and activates the Tyrosine-3-Hydroxylase expression. This enzyme catalyses the rate-limiting step of catecholamine synthesis (L-Tyrosine to L-DOPA). Furthermore, SRY also activates the expression of Monoamine Oxidase A which is responsible for the inactivation of catecholamines. Therefore, it regulates both positively and negatively the catecholamines concentration&amp;lt;ref name=&amp;quot;Veitia&amp;quot;&amp;gt;PMID: 24604382&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Other extra-testicular effects===&lt;br /&gt;
&lt;br /&gt;
Some knock-down experiments have shown that SRY may also be a major actor in the dopamine pathway. On the peripheral side, it seems to regulate noradrenaline levels and blood pressure&amp;lt;ref name=&amp;quot;Veitia&amp;quot; /&amp;gt;. A researcher who contributed to discovering these effects says it might explain why &amp;quot;the aggressive fight-or-flight reaction is more dominant in men, while women predominantly adopt a less aggressive tend-and-befriend response&amp;quot;&amp;lt;ref&amp;gt;Cohen, Tamara. The &#039;macho&#039; gene that makes men behave aggressively has been found. The Daily Mail (2012). [http://www.dailymail.co.uk/sciencetech/article-2111668/The-macho-gene-makes-men-aggressive-found.html#ixzz3yZC2BV4k]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
It has been shown that SRY may be involved in the regulation of the renin-angiotensin system in mice. Indeed, sequence mutations of the protein lead to hypertension. Because the human&#039;s SRY organisation is very closed to the mouse&#039;s, it has been proposed that SRY may have the same function in humans but it has not been studied directly&amp;lt;ref&amp;gt;PMID:22315667&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
== Diseases==&lt;br /&gt;
&lt;br /&gt;
=== Swyer syndrome (AKA XY gonadal dysgenis) :===&lt;br /&gt;
&lt;br /&gt;
If the TDF protein is not able to bind its targeted DNA sequences, the genes responsible for the testis development are not expressed. The patient owning this defective protein will then develop female characters, even though he has a XY karyotype. This phenomenon is known as the &amp;quot;Swyer Syndrome&amp;quot;. &lt;br /&gt;
Different causes can explain this &amp;quot;XY gonadal dysgenis&amp;quot;, as it is also called. About thirty mutations (named [http://www.uniprot.org/uniprot/Q05066#sequences &amp;quot;SRXY1&amp;quot;]) in the SRY gene have been shown to drive this phenotype development. It can also be due to crossovers during a meiosis. If a Y chromosome portion carrying the SRY gene is recombined into a X chromosome, a sperm cell will get this abnormal Y chromosome. If it then fecundates, a XY karyotype without any SRY gene will be formed. &lt;br /&gt;
&lt;br /&gt;
=== De La Chapelle syndrome (AKA XX male syndrome) :===&lt;br /&gt;
&lt;br /&gt;
From the meiosis just described would also result an abnormal X chromosome, carrying the SRY gene. If the sperm cell owning this chromosome fecundates an ovule, the resulting newborn will have a XX karyotype but a male phenotype. This is called the &amp;quot;De La Chapelle syndrome&amp;quot;. In this case, the patient can either develop testis or both testis and ovarian tissues. As some epigenetic mechanisms can inactivate the X chromosome carrying SRY, this syndrome keeps most of the patients sterile&amp;lt;ref&amp;gt;PMID: 4622299&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Hepatocellular carcinoma===&lt;br /&gt;
 &lt;br /&gt;
In the case on a hepatocellular carcinoma, it has been proved that high expression levels of SRY help cancer progression and poor patient survival. However, it still seems that hepatocellular carcinoma is not most likely to develop in men&amp;lt;ref&amp;gt;PMID: 25274159&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
== Structural highlights ==&lt;br /&gt;
&lt;br /&gt;
This is a sample scene created with SAT to &amp;lt;scene name=&amp;quot;/12/3456/Sample/1&amp;quot;&amp;gt;color&amp;lt;/scene&amp;gt; by Group, and another to make &amp;lt;scene name=&amp;quot;/12/3456/Sample/2&amp;quot;&amp;gt;a transparent representation&amp;lt;/scene&amp;gt; of the protein. You can make your own scenes on SAT starting from scratch or loading and editing one of these sample scenes.&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_1/3&#039;&amp;gt;Helix 1&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_2/2&#039;&amp;gt;Helix 2&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_3/1&#039;&amp;gt;Helix 3&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Long_arm_28a/1&#039;&amp;gt;Long arm (28A)&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Short_arm_22a/1&#039;&amp;gt;Short arm (22A)&amp;lt;/scene&amp;gt;&lt;br /&gt;
&amp;lt;/StructureSection&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== References ==&lt;br /&gt;
&amp;lt;references/&amp;gt;&lt;/div&gt;</summary>
		<author><name>Fantin Mesny</name></author>
	</entry>
	<entry>
		<id>https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2526335</id>
		<title>Sandbox Reserved 1120</title>
		<link rel="alternate" type="text/html" href="https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2526335"/>
		<updated>2016-01-30T14:56:39Z</updated>

		<summary type="html">&lt;p&gt;Fantin Mesny: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{Sandbox_Reserved_ESBS_2015}}&amp;lt;!-- PLEASE ADD YOUR CONTENT BELOW HERE --&amp;gt;&lt;br /&gt;
=SRY protein (AKA TDF protein)=&lt;br /&gt;
{{SRY protein (AKA TDF protein)}}&lt;br /&gt;
&amp;lt;StructureSection load=&#039;1hry&#039; size=&#039;340&#039; frame=&#039;true&#039; side=&#039;right&#039; caption=&#039;The SRY protein linked to DNA&#039; scene=&#039;71/719861/Base/1&#039;&amp;gt;&lt;br /&gt;
&amp;lt;table&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td colspan=&#039;2&#039;&amp;gt;The SRY protein is a 204 residues-long monomeric polypeptide. It is encoded by the SRY gene and is involved in the sex determination in mammals by being responsible for the gonadogenesis and so the male sexual development. It is the HMG-box that gives to the protein its ability to bind DNA by its minor groove&amp;lt;ref name =&amp;quot;Tang&amp;quot;&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;.&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr id=&#039;related&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;[[Related_structure|Related:]]&amp;lt;/b&amp;gt;&amp;lt;/td&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;[[1hrz|1hrz]]&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr id=&#039;resources&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Resources:&amp;lt;/b&amp;gt;&amp;lt;/td&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;&amp;lt;span class=&#039;plainlinks&#039;&amp;gt;[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=1hry FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=1hry OCA], [http://pdbe.org/1hry PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=1hry RCSB], [http://www.ebi.ac.uk/pdbsum/1hry PDBsum]&lt;br /&gt;
&amp;lt;tr id=&#039;Gene&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Encoded by&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;The SRY gene codes for the SRY protein&lt;br /&gt;
&amp;lt;tr id=&#039;Length&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Length&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;204 residues&lt;br /&gt;
&amp;lt;tr id=&#039;Molecular weight&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Molecular weight&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;≈23kDa&lt;br /&gt;
&amp;lt;tr id=&#039;DNA target sequence&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;DNA target sequence&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;(5&#039;-dGCACAAAC)&lt;br /&gt;
&amp;lt;tr id=&#039;Regulation&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Regulation&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;[https://en.wikipedia.org/wiki/Steroidogenic_factor_1 Sf1];[https://en.wikipedia.org/wiki/Sp1_transcription_factor Sp1] (binding site in the promoter of SRY : -150),[https://en.wikipedia.org/wiki/WT1 WT1] (binding site in the promoter of SRY : -87)&lt;br /&gt;
&amp;lt;tr id=&#039;Role&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Role&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;Transcription factor&lt;br /&gt;
&amp;lt;tr id=&#039;Genes targeted&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Genes targeted&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;&amp;lt;i&amp;gt;SOX9&amp;lt;/i&amp;gt;, &amp;lt;i&amp;gt;TH&amp;lt;/i&amp;gt;, &amp;lt;i&amp;gt;MAOA&amp;lt;/i&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;/span&amp;gt;&lt;br /&gt;
&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;/table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==History==&lt;br /&gt;
&lt;br /&gt;
After centuries of unfounded theories mainly based on environmental factors, the first molecular theory concerning the sex determination appeared in 1891. At this time, the german biologist Hermann Henking was studying sperm formation in wasps. As a chromosome which was not present in all the wasps looked different from the others, he suspected it to play a role in sex determination and called it the &amp;quot;X chromosome&amp;quot;.&lt;br /&gt;
Ten years later, Clarence Erwin McClung saw that this chromosome behaved differently during the meiosis and was only present in half the sperm cells of grasshoppers. As the main characteristic that varies in 50/50 proportions among zygotes is the sex, McClung suspected the X chromosome to be implicated in sexual development. &lt;br /&gt;
In 1905, Nettie Stevens discovered the &amp;quot;Y chromosome&amp;quot; (and the female XX and male XY patterns) while she was counting the chromosomes of beetles under the microscope&amp;lt;ref&amp;gt;Sumner, A. T. Sex Chromosomes and Sex Determination. Chromosomes: Organization and Function, 97-108. [http://www.nature.com/scitable/nated/topicpage/Sex-Chromosomes-and-Sex-Determination-44565]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
During the next decades, a few theories were in competition. In 1921, Calvin Bridges&#039;s works on &#039;&#039;Drosophila melanogaster&#039;&#039; seemed to reveal that male characters acquisition is due to a genic balance between the genes contained in the X chromosome and those contained in the autosomes&amp;lt;ref&amp;gt;PMID: 17769897&amp;lt;/ref&amp;gt;.&lt;br /&gt;
In 1930, Ronald Fisher introduced the first Y-based control of sex theory by proposing two different models : either all the genes responsible for the male characters are located on the Y chromosome or there is a Y-located gene which regulates the expression of genes elsewhere in the genome&amp;lt;ref name=&amp;quot;Goodfellow&amp;quot;&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt;.&lt;br /&gt;
As Alfred Jost had shown the testosterone produced by the testis is responsible for the entire male phenotype acquisition&amp;lt;ref&amp;gt;PMID: 4805859&amp;lt;/ref&amp;gt;, Peter Neville Goodfellow proposed in 1988, that there is a gene (&#039;&#039;TDF&#039;&#039; in human, &#039;&#039;Tdy&#039;&#039; in mice)  on the Y chromosome which drives the development of the testis&amp;lt;ref name=&amp;quot;Goodfellow&amp;quot; /&amp;gt;. In 1990, Goodfellow&#039;s hypothesis was validated with the discovery of &#039;&#039;Tdy&#039;&#039;&#039;s localisation. This gene&#039;s product (expressed during the male gonadal development) owns an amino-acid motif which shows homology to other known or putative DNA-binding domains. &#039;&#039;Tdy&#039;&#039; is therefore a transcriptional factor&amp;lt;ref&amp;gt;PMID: 2374589&amp;lt;/ref&amp;gt;. The same year, the human &#039;&#039;SRY&#039;&#039; gene (accepted later as the &#039;&#039;TDF&#039;&#039;) was discovered&amp;lt;ref&amp;gt;PMID: 1695712&amp;lt;/ref&amp;gt;. &lt;br /&gt;
Three dimensional structure of the SRY protein was determined in 1995 using NMR spectroscopy&amp;lt;ref&amp;gt;PMID:7774012&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
==SRY gene==&lt;br /&gt;
&lt;br /&gt;
The SRY gene encodes the SRY protein. The SRY protein is a transcriptional factor that induces the male phenotype in the embryo. The SRY gene is located on the [https://en.wikipedia.org/wiki/Y_chromosome Y chromosome] in the short arm (p) 11.3 &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/gene/6736 NCBI gene]&amp;lt;/ref&amp;gt;. This gene has only one exon that contains the HMG domain (DNA-binding High-Mobility Group box domain). It means that SRY mRNA does not have an alternative splicing, so there is only one isoforme of SRY protein&amp;lt;ref name=&amp;quot;McE&amp;quot;&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;. Moreover, the human genome contains only one copy of the SRY gene, whereas the mouse genome contains 6 copy of this gene&amp;lt;ref&amp;gt; Sekido R, Lovell-Badge R. Genetic control of testis development. Sex Dev Genet Mol Biol Evol Endocrinol Embryol Pathol Sex Determ Differ. 2013;7(1-3):21–32 &amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Sequence of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:90%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
&amp;gt;gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/nuccore NCBI nucleotide]&amp;lt;/ref&amp;gt;&lt;br /&gt;
TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT&lt;br /&gt;
TTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACA&lt;br /&gt;
&amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;ATG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;CAATCATATGCTTCTGCTATGTTAAGCGTATTCAACAGCGATGATTACAGTCCAGCTGTGCAAGAGAAT&lt;br /&gt;
ATTCCCGCTCTCCGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTAAGTATCAGTGTGAAA&lt;br /&gt;
CGGGAGAAAACAGTAAAGGCAACGTCCAGGATAGAGTGAAGCGACCCATGAACGCATTCATCGTGTGGTC&lt;br /&gt;
&#039;&#039;&#039;TCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCAGAGATCAGCAAGCAGCTG&lt;br /&gt;
&#039;&#039;&#039;GGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCATTCTTCCAGGAGGCACAGAAATTACAGG&lt;br /&gt;
&#039;&#039;&#039;CCATGCACAGAGAGAAATACCCGAATTATAAGTATCGA&#039;&#039;&#039;CCTCGTCGGAAGGCGAAGATGCTGCCGAAGAA&lt;br /&gt;
TTGCAGTTTGCTTCCCGCAGATCCCGCTTCGGTACTCTGCAGCGAAGTGCAACTGGACAACAGGTTGTAC&lt;br /&gt;
AGGGATGACTGTACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAACG&lt;br /&gt;
CAGCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTG&amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;TAG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;GACAATCGGGTAACATT&lt;br /&gt;
GGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCACTTTCTTATGTTTAGTTT&lt;br /&gt;
CAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCATTTCA&amp;lt;/small&amp;gt;&lt;br /&gt;
&lt;br /&gt;
(Legend : &amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Initiation codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt; ; &amp;lt;b&amp;gt;HMG sequence&amp;lt;/b&amp;gt; ; &amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Stop codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;)&lt;br /&gt;
&amp;lt;/div&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Regulation of the expression of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
In humans, the SRY promoter is located between −408 and −95 bp. Moreover, the SRY gene has enhancers at -727 pb. The linkage between regulatory proteins and these enhancers has the property to increase the production of SRY proteins. These regulatory proteins could be: SF1 (steroidogenic factor 1), SP1  and WT 1 (Wilms tumor)&amp;lt;ref name=&amp;quot;Harley&amp;quot;&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;SF1&#039;&#039;&#039;: this transcriptional factor belongs to the family of nuclear hormone receptors and contains a zinc finger. The activation of this protein requires a ligand (hormone).&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;SP1&#039;&#039;&#039;: this transcriptional factor is an ubiquitous protein which binds rich GC-sites and is implicated in the transcription of many genes. Moreover, this protein contains a zinc finger.&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;WT1&#039;&#039;&#039; :this transcriptional factor transactivates the SRY gene. It contains a zinc finger&amp;lt;ref&amp;gt;Larney C, Bailey TL, Koopman P. Switching on sex: transcriptional regulation of the testis-determining gene Sry. Dev Camb Engl. 2014 Jun;141(11):2195–205&amp;lt;/ref&amp;gt;. &lt;br /&gt;
&lt;br /&gt;
==Structure==&lt;br /&gt;
&lt;br /&gt;
===The SRY-HMG domain (HMG-Box)===&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;&#039;SRY-HMG&#039;&#039;&#039; stands for &#039;&#039;&#039;S&#039;&#039;&#039;ex determining &#039;&#039;&#039;R&#039;&#039;&#039;egion &#039;&#039;&#039;Y&#039;&#039;&#039; - &#039;&#039;&#039;H&#039;&#039;&#039;igh &#039;&#039;&#039;M&#039;&#039;&#039;obility &#039;&#039;&#039;G&#039;&#039;&#039;roup domain.&lt;br /&gt;
It is approximately 80 residues-long. It mediates the binding of the protein to the minor groove of DNA. It is the most important part of the SRY protein. Not only because it enables  the protein to bind the DNA but also because even a single mutation can cause an inactivation of the protein.&lt;br /&gt;
&lt;br /&gt;
It has a twisted L shape: it has a long (28Å) and a short (22Å) arm. The HMG Box is made of 3 helices. Its N-term and C-term domains are irregular. The overall structure is stabilized by a hydrophobic core especially at the intersection of the 3 helices where 3 aromatics cycles meet, surrounded by aliphatic aminoacids.&lt;br /&gt;
See the different structures:&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_1/3&#039;&amp;gt;Helix 1&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_2/2&#039;&amp;gt;Helix 2&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_3/1&#039;&amp;gt;Helix 3&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Long_arm_28a/1&#039;&amp;gt;Long arm (28Å)&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Short_arm_22a/1&#039;&amp;gt;Short arm (22Å)&amp;lt;/scene&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The interaction between the HMG-Box and DNA is specific and stable.  It is mostly hydrophobic. It permits the DNA to bend of DNA (≈75°). Only one molecule of water interfaces the Box and the DNA. The complex is stabilized by salt bridges between positively charged residues of the HMG domain and negatively charged phosphates&amp;lt;ref name=&amp;quot;Tang&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
[[Image:HHMG-bitmap.png|thumb|alt=Image bitmap|Linear structure of hHMG domain]]&lt;br /&gt;
&lt;br /&gt;
The binding of SRY on DNA is specific. The DNA target site is a DNA octamer :&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:30%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
(5&#039;-dGCACAAAC)&amp;lt;br/&amp;gt;&lt;br /&gt;
(5&#039;-dGTTTGTGC)&lt;br /&gt;
&amp;lt;/small&amp;gt;&amp;lt;/div&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
This sequence is found in the promoters of genes expressed during the testicular development.&lt;br /&gt;
The bend of DNA enables the recruitment of different proteins and the building of massive proteins-DNA complexes that could change the expression of different genes&amp;lt;ref&amp;gt;PMID:11563911&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
Even if the most important function of the HMG box is binding and bending DNA, it is also involved in DNA condensation, recombination and repair.&lt;br /&gt;
&lt;br /&gt;
There are two kinds of proteins that contain a HMG box:&lt;br /&gt;
* &#039;&#039;&#039;HMG1&#039;&#039;&#039; : It is expressed in few cell types. It is found in transcription factors that contain a single HMG box. The binding of a DNA sequence is specific.&lt;br /&gt;
* &#039;&#039;&#039;HMG2&#039;&#039;&#039; : It is found in all cell types and is abundant in chromatin. These proteins can contain two or more HMG boxes that can non-specifically bind DNA. &lt;br /&gt;
&lt;br /&gt;
===General structure of SRY===&lt;br /&gt;
&lt;br /&gt;
The overall structure of SRY is organized around the HMG-box.&lt;br /&gt;
3 domains:&lt;br /&gt;
* N-term domain&lt;br /&gt;
* Central domain : DNA binding (HMG box)&lt;br /&gt;
* C-term domain&lt;br /&gt;
&lt;br /&gt;
== Function ==&lt;br /&gt;
&lt;br /&gt;
===Sex determining===&lt;br /&gt;
&lt;br /&gt;
It acts like a sex determining factor thanks to its transcriptional activity. It inhibits the development of female sex structures in the embryonic individual.&lt;br /&gt;
&lt;br /&gt;
The SRY protein contains nuclear localization signals in N and C terminals. An acetylation of these domains allows the exportation of the SRY protein to the nucleus&amp;lt;ref name=&amp;quot;Harley&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
The SRY protein activates the &#039;&#039;SOX9&#039;&#039; (SRY-box9) gene &amp;lt;ref name=&amp;quot;McE&amp;quot; /&amp;gt;. This gene is found in long arm 24.3 of the chromosome 17&amp;lt;ref&amp;gt; NCBI [http://www.ncbi.nlm.nih.gov/gene/6662 NCBI gene: SOX9 SRY-BOX9 Homo sapiens] &amp;lt;/ref&amp;gt; and is implicated in the stimulation of the differentiation of pre-Sertori into Sertoli cells rather than granulosa cells.&lt;br /&gt;
&lt;br /&gt;
The activation of &#039;&#039;SOX&#039;&#039;9 is done by the SRY protein and another transcriptional factor: SF1 (steroidogenic factor 1). These transcriptional factors are bound on an enhancer called: TESCO (Testis-Specific Enhancer of &#039;&#039;SOX9&#039;&#039; core element). The binding of a transcriptional factor on an enhancer provokes a curvature of the DNA (≈75°), allowing a stabilization of the elongation complex on the &#039;&#039;SOX9&#039;&#039; promoter. The SOX9 protein activates the gene &#039;&#039;AMH&#039;&#039; (Anti-Mullerian Hormone)&amp;lt;ref&amp;gt;[http://www.ebi.ac.uk/interpro/entry/IPR006799?q=AMH EBI-Interpro: Anti-Mullerian-Hormon, N-term] &amp;lt;/ref&amp;gt;. Therefore, it allows the degeneration of the channels of Müller in male&amp;lt;ref name=&amp;quot;Harley&amp;quot; /&amp;gt;.&lt;br /&gt;
===Cathecolamines regulation===&lt;br /&gt;
&lt;br /&gt;
It has been shown that SRY is present in brain regions and activates the Tyrosine-3-Hydroxylase expression. This enzyme catalyses the rate-limiting step of catecholamine synthesis (L-Tyrosine to L-DOPA). Furthermore, SRY also activates the expression of Monoamine Oxidase A which is responsible for the inactivation of catecholamines. Therefore, it regulates both positively and negatively the catecholamines concentration&amp;lt;ref name=&amp;quot;Veitia&amp;quot;&amp;gt;PMID: 24604382&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Other extra-testicular effects===&lt;br /&gt;
&lt;br /&gt;
Some knock-down experiments have shown that SRY may also be a major actor in the dopamine pathway. On the peripheral side, it seems to regulate noradrenaline levels and blood pressure&amp;lt;ref name=&amp;quot;Veitia&amp;quot; /&amp;gt;. A researcher who contributed to discovering these effects says it might explain why &amp;quot;the aggressive fight-or-flight reaction is more dominant in men, while women predominantly adopt a less aggressive tend-and-befriend response&amp;quot;&amp;lt;ref&amp;gt;Cohen, Tamara. The &#039;macho&#039; gene that makes men behave aggressively has been found. The Daily Mail (2012). [http://www.dailymail.co.uk/sciencetech/article-2111668/The-macho-gene-makes-men-aggressive-found.html#ixzz3yZC2BV4k]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
It has been shown that SRY may be involved in the regulation of the renin-angiotensin system in mice. Indeed, sequence mutations of the protein lead to hypertension. Because the human&#039;s SRY organisation is very closed to the mouse&#039;s, it has been proposed that SRY may have the same function in humans but it has not been studied directly&amp;lt;ref&amp;gt;PMID:22315667&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
== Diseases==&lt;br /&gt;
&lt;br /&gt;
=== Swyer syndrome (AKA XY gonadal dysgenis) :===&lt;br /&gt;
&lt;br /&gt;
If the TDF protein is not able to bind its targeted DNA sequences, the genes responsible for the testis development are not expressed. The patient owning this defective protein will then develop female characters, even though he has a XY karyotype. This phenomenon is known as the &amp;quot;Swyer Syndrome&amp;quot;. &lt;br /&gt;
Different causes can explain this &amp;quot;XY gonadal dysgenis&amp;quot;, as it is also called. About thirty mutations (named [http://www.uniprot.org/uniprot/Q05066#sequences &amp;quot;SRXY1&amp;quot;]) in the SRY gene have been shown to drive this phenotype development. It can also be due to crossovers during a meiosis. If a Y chromosome portion carrying the SRY gene is recombined into a X chromosome, a sperm cell will get this abnormal Y chromosome. If it then fecundates, a XY karyotype without any SRY gene will be formed. &lt;br /&gt;
&lt;br /&gt;
=== De La Chapelle syndrome (AKA XX male syndrome) :===&lt;br /&gt;
&lt;br /&gt;
From the meiosis just described would also result an abnormal X chromosome, carrying the SRY gene. If the sperm cell owning this chromosome fecundates an ovule, the resulting newborn will have a XX karyotype but a male phenotype. This is called the &amp;quot;De La Chapelle syndrome&amp;quot;. In this case, the patient can either develop testis or both testis and ovarian tissues. As some epigenetic mechanisms can inactivate the X chromosome carrying SRY, this syndrome keeps most of the patients sterile&amp;lt;ref&amp;gt;PMID: 4622299&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Hepatocellular carcinoma===&lt;br /&gt;
 &lt;br /&gt;
In the case on a hepatocellular carcinoma, it has been proved that high expression levels of SRY help cancer progression and poor patient survival. However, it still seems that hepatocellular carcinoma is not most likely to develop in men&amp;lt;ref&amp;gt;PMID: 25274159&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
== Structural highlights ==&lt;br /&gt;
&lt;br /&gt;
This is a sample scene created with SAT to &amp;lt;scene name=&amp;quot;/12/3456/Sample/1&amp;quot;&amp;gt;color&amp;lt;/scene&amp;gt; by Group, and another to make &amp;lt;scene name=&amp;quot;/12/3456/Sample/2&amp;quot;&amp;gt;a transparent representation&amp;lt;/scene&amp;gt; of the protein. You can make your own scenes on SAT starting from scratch or loading and editing one of these sample scenes.&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_1/3&#039;&amp;gt;Helix 1&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_2/2&#039;&amp;gt;Helix 2&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_3/1&#039;&amp;gt;Helix 3&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Long_arm_28a/1&#039;&amp;gt;Long arm (28A)&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Short_arm_22a/1&#039;&amp;gt;Short arm (22A)&amp;lt;/scene&amp;gt;&lt;br /&gt;
&amp;lt;/StructureSection&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== References ==&lt;br /&gt;
&amp;lt;references/&amp;gt;&lt;/div&gt;</summary>
		<author><name>Fantin Mesny</name></author>
	</entry>
	<entry>
		<id>https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2526333</id>
		<title>Sandbox Reserved 1120</title>
		<link rel="alternate" type="text/html" href="https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2526333"/>
		<updated>2016-01-30T14:53:57Z</updated>

		<summary type="html">&lt;p&gt;Fantin Mesny: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{Sandbox_Reserved_ESBS_2015}}&amp;lt;!-- PLEASE ADD YOUR CONTENT BELOW HERE --&amp;gt;&lt;br /&gt;
=SRY protein (AKA TDF protein)=&lt;br /&gt;
{{SRY protein (AKA TDF protein)}}&lt;br /&gt;
&amp;lt;StructureSection load=&#039;1hry&#039; size=&#039;340&#039; frame=&#039;true&#039; side=&#039;right&#039; caption=&#039;The SRY protein linked to DNA&#039; scene=&#039;71/719861/Base/1&#039;&amp;gt;&lt;br /&gt;
&amp;lt;table&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td colspan=&#039;2&#039;&amp;gt;The SRY protein is a 204 residues-long monomeric polypeptide. It is encoded by the SRY gene and is involved in the sex determination in mammals by being responsible for the gonadogenesis and so the male sexual development. It is the HMG-box that gives to the protein its ability to bind DNA by its minor groove&amp;lt;ref name =&amp;quot;Tang&amp;quot;&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;.&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr id=&#039;related&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;[[Related_structure|Related:]]&amp;lt;/b&amp;gt;&amp;lt;/td&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;[[1hrz|1hrz]]&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr id=&#039;resources&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Resources:&amp;lt;/b&amp;gt;&amp;lt;/td&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;&amp;lt;span class=&#039;plainlinks&#039;&amp;gt;[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=1hry FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=1hry OCA], [http://pdbe.org/1hry PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=1hry RCSB], [http://www.ebi.ac.uk/pdbsum/1hry PDBsum]&lt;br /&gt;
&amp;lt;tr id=&#039;Gene&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Encoded by&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;The SRY gene codes for the SRY protein&lt;br /&gt;
&amp;lt;tr id=&#039;Length&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Length&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;204 residues&lt;br /&gt;
&amp;lt;tr id=&#039;Molecular weight&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Molecular weight&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;≈23kDa&lt;br /&gt;
&amp;lt;tr id=&#039;DNA target sequence&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;DNA target sequence&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;(5&#039;-dGCACAAAC)&lt;br /&gt;
&amp;lt;tr id=&#039;Regulation&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Regulation&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;[https://en.wikipedia.org/wiki/Steroidogenic_factor_1 Sf1];[https://en.wikipedia.org/wiki/Sp1_transcription_factor Sp1] (binding site in the promoter of SRY : -150),[https://en.wikipedia.org/wiki/WT1 WT1] (binding site in the promoter of SRY : -87)&lt;br /&gt;
&amp;lt;tr id=&#039;Role&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Role&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;Transcription factor&lt;br /&gt;
&amp;lt;tr id=&#039;Genes targeted&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Genes targeted&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;SOX9&lt;br /&gt;
&lt;br /&gt;
&amp;lt;/span&amp;gt;&lt;br /&gt;
&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;/table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==History==&lt;br /&gt;
&lt;br /&gt;
After centuries of unfounded theories mainly based on environmental factors, the first molecular theory concerning the sex determination appeared in 1891. At this time, the german biologist Hermann Henking was studying sperm formation in wasps. As a chromosome which was not present in all the wasps looked different from the others, he suspected it to play a role in sex determination and called it the &amp;quot;X chromosome&amp;quot;.&lt;br /&gt;
Ten years later, Clarence Erwin McClung saw that this chromosome behaved differently during the meiosis and was only present in half the sperm cells of grasshoppers. As the main characteristic that varies in 50/50 proportions among zygotes is the sex, McClung suspected the X chromosome to be implicated in sexual development. &lt;br /&gt;
In 1905, Nettie Stevens discovered the &amp;quot;Y chromosome&amp;quot; (and the female XX and male XY patterns) while she was counting the chromosomes of beetles under the microscope&amp;lt;ref&amp;gt;Sumner, A. T. Sex Chromosomes and Sex Determination. Chromosomes: Organization and Function, 97-108. [http://www.nature.com/scitable/nated/topicpage/Sex-Chromosomes-and-Sex-Determination-44565]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
During the next decades, a few theories were in competition. In 1921, Calvin Bridges&#039;s works on &#039;&#039;Drosophila melanogaster&#039;&#039; seemed to reveal that male characters acquisition is due to a genic balance between the genes contained in the X chromosome and those contained in the autosomes&amp;lt;ref&amp;gt;PMID: 17769897&amp;lt;/ref&amp;gt;.&lt;br /&gt;
In 1930, Ronald Fisher introduced the first Y-based control of sex theory by proposing two different models : either all the genes responsible for the male characters are located on the Y chromosome or there is a Y-located gene which regulates the expression of genes elsewhere in the genome&amp;lt;ref name=&amp;quot;Goodfellow&amp;quot;&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt;.&lt;br /&gt;
As Alfred Jost had shown the testosterone produced by the testis is responsible for the entire male phenotype acquisition&amp;lt;ref&amp;gt;PMID: 4805859&amp;lt;/ref&amp;gt;, Peter Neville Goodfellow proposed in 1988, that there is a gene (&#039;&#039;TDF&#039;&#039; in human, &#039;&#039;Tdy&#039;&#039; in mice)  on the Y chromosome which drives the development of the testis&amp;lt;ref name=&amp;quot;Goodfellow&amp;quot; /&amp;gt;. In 1990, Goodfellow&#039;s hypothesis was validated with the discovery of &#039;&#039;Tdy&#039;&#039;&#039;s localisation. This gene&#039;s product (expressed during the male gonadal development) owns an amino-acid motif which shows homology to other known or putative DNA-binding domains. &#039;&#039;Tdy&#039;&#039; is therefore a transcriptional factor&amp;lt;ref&amp;gt;PMID: 2374589&amp;lt;/ref&amp;gt;. The same year, the human &#039;&#039;SRY&#039;&#039; gene (accepted later as the &#039;&#039;TDF&#039;&#039;) was discovered&amp;lt;ref&amp;gt;PMID: 1695712&amp;lt;/ref&amp;gt;. &lt;br /&gt;
Three dimensional structure of the SRY protein was determined in 1995 using NMR spectroscopy&amp;lt;ref&amp;gt;PMID:7774012&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
==SRY gene==&lt;br /&gt;
&lt;br /&gt;
The SRY gene encodes the SRY protein. The SRY protein is a transcriptional factor that induces the male phenotype in the embryo. The SRY gene is located on the [https://en.wikipedia.org/wiki/Y_chromosome Y chromosome] in the short arm (p) 11.3 &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/gene/6736 NCBI gene]&amp;lt;/ref&amp;gt;. This gene has only one exon that contains the HMG domain (DNA-binding High-Mobility Group box domain). It means that SRY mRNA does not have an alternative splicing, so there is only one isoforme of SRY protein&amp;lt;ref name=&amp;quot;McE&amp;quot;&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;. Moreover, the human genome contains only one copy of the SRY gene, whereas the mouse genome contains 6 copy of this gene&amp;lt;ref&amp;gt; Sekido R, Lovell-Badge R. Genetic control of testis development. Sex Dev Genet Mol Biol Evol Endocrinol Embryol Pathol Sex Determ Differ. 2013;7(1-3):21–32 &amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Sequence of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:90%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
&amp;gt;gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/nuccore NCBI nucleotide]&amp;lt;/ref&amp;gt;&lt;br /&gt;
TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT&lt;br /&gt;
TTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACA&lt;br /&gt;
&amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;ATG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;CAATCATATGCTTCTGCTATGTTAAGCGTATTCAACAGCGATGATTACAGTCCAGCTGTGCAAGAGAAT&lt;br /&gt;
ATTCCCGCTCTCCGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTAAGTATCAGTGTGAAA&lt;br /&gt;
CGGGAGAAAACAGTAAAGGCAACGTCCAGGATAGAGTGAAGCGACCCATGAACGCATTCATCGTGTGGTC&lt;br /&gt;
&#039;&#039;&#039;TCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCAGAGATCAGCAAGCAGCTG&lt;br /&gt;
&#039;&#039;&#039;GGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCATTCTTCCAGGAGGCACAGAAATTACAGG&lt;br /&gt;
&#039;&#039;&#039;CCATGCACAGAGAGAAATACCCGAATTATAAGTATCGA&#039;&#039;&#039;CCTCGTCGGAAGGCGAAGATGCTGCCGAAGAA&lt;br /&gt;
TTGCAGTTTGCTTCCCGCAGATCCCGCTTCGGTACTCTGCAGCGAAGTGCAACTGGACAACAGGTTGTAC&lt;br /&gt;
AGGGATGACTGTACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAACG&lt;br /&gt;
CAGCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTG&amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;TAG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;GACAATCGGGTAACATT&lt;br /&gt;
GGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCACTTTCTTATGTTTAGTTT&lt;br /&gt;
CAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCATTTCA&amp;lt;/small&amp;gt;&lt;br /&gt;
&lt;br /&gt;
(Legend : &amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Initiation codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt; ; &amp;lt;b&amp;gt;HMG sequence&amp;lt;/b&amp;gt; ; &amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Stop codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;)&lt;br /&gt;
&amp;lt;/div&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Regulation of the expression of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
In humans, the SRY promoter is located between −408 and −95 bp. Moreover, the SRY gene has enhancers at -727 pb. The linkage between regulatory proteins and these enhancers has the property to increase the production of SRY proteins. These regulatory proteins could be: SF1 (steroidogenic factor 1), SP1  and WT 1 (Wilms tumor)&amp;lt;ref name=&amp;quot;Harley&amp;quot;&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;SF1&#039;&#039;&#039;: this transcriptional factor belongs to the family of nuclear hormone receptors and contains a zinc finger. The activation of this protein requires a ligand (hormone).&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;SP1&#039;&#039;&#039;: this transcriptional factor is an ubiquitous protein which binds rich GC-sites and is implicated in the transcription of many genes. Moreover, this protein contains a zinc finger.&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;WT1&#039;&#039;&#039; :this transcriptional factor transactivates the SRY gene. It contains a zinc finger&amp;lt;ref&amp;gt;Larney C, Bailey TL, Koopman P. Switching on sex: transcriptional regulation of the testis-determining gene Sry. Dev Camb Engl. 2014 Jun;141(11):2195–205&amp;lt;/ref&amp;gt;. &lt;br /&gt;
&lt;br /&gt;
==Structure==&lt;br /&gt;
&lt;br /&gt;
===The SRY-HMG domain (HMG-Box)===&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;&#039;SRY-HMG&#039;&#039;&#039; stands for &#039;&#039;&#039;S&#039;&#039;&#039;ex determining &#039;&#039;&#039;R&#039;&#039;&#039;egion &#039;&#039;&#039;Y&#039;&#039;&#039; - &#039;&#039;&#039;H&#039;&#039;&#039;igh &#039;&#039;&#039;M&#039;&#039;&#039;obility &#039;&#039;&#039;G&#039;&#039;&#039;roup domain.&lt;br /&gt;
It is approximately 80 residues-long. It mediates the binding of the protein to the minor groove of DNA. It is the most important part of the SRY protein. Not only because it enables  the protein to bind the DNA but also because even a single mutation can cause an inactivation of the protein.&lt;br /&gt;
&lt;br /&gt;
It has a twisted L shape: it has a long (28Å) and a short (22Å) arm. The HMG Box is made of 3 helices. Its N-term and C-term domains are irregular. The overall structure is stabilized by a hydrophobic core especially at the intersection of the 3 helices where 3 aromatics cycles meet, surrounded by aliphatic aminoacids.&lt;br /&gt;
See the different structures:&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_1/3&#039;&amp;gt;Helix 1&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_2/2&#039;&amp;gt;Helix 2&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_3/1&#039;&amp;gt;Helix 3&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Long_arm_28a/1&#039;&amp;gt;Long arm (28Å)&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Short_arm_22a/1&#039;&amp;gt;Short arm (22Å)&amp;lt;/scene&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The interaction between the HMG-Box and DNA is specific and stable.  It is mostly hydrophobic. It permits the DNA to bend of DNA (≈75°). Only one molecule of water interfaces the Box and the DNA. The complex is stabilized by salt bridges between positively charged residues of the HMG domain and negatively charged phosphates&amp;lt;ref name=&amp;quot;Tang&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
[[Image:HHMG-bitmap.png|thumb|alt=Image bitmap|Linear structure of hHMG domain]]&lt;br /&gt;
&lt;br /&gt;
The binding of SRY on DNA is specific. The DNA target site is a DNA octamer :&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:30%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
(5&#039;-dGCACAAAC)&amp;lt;br/&amp;gt;&lt;br /&gt;
(5&#039;-dGTTTGTGC)&lt;br /&gt;
&amp;lt;/small&amp;gt;&amp;lt;/div&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
This sequence is found in the promoters of genes expressed during the testicular development.&lt;br /&gt;
The bend of DNA enables the recruitment of different proteins and the building of massive proteins-DNA complexes that could change the expression of different genes&amp;lt;ref&amp;gt;PMID:11563911&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
Even if the most important function of the HMG box is binding and bending DNA, it is also involved in DNA condensation, recombination and repair.&lt;br /&gt;
&lt;br /&gt;
There are two kinds of proteins that contain a HMG box:&lt;br /&gt;
* &#039;&#039;&#039;HMG1&#039;&#039;&#039; : It is expressed in few cell types. It is found in transcription factors that contain a single HMG box. The binding of a DNA sequence is specific.&lt;br /&gt;
* &#039;&#039;&#039;HMG2&#039;&#039;&#039; : It is found in all cell types and is abundant in chromatin. These proteins can contain two or more HMG boxes that can non-specifically bind DNA. &lt;br /&gt;
&lt;br /&gt;
===General structure of SRY===&lt;br /&gt;
&lt;br /&gt;
The overall structure of SRY is organized around the HMG-box.&lt;br /&gt;
3 domains:&lt;br /&gt;
* N-term domain&lt;br /&gt;
* Central domain : DNA binding (HMG box)&lt;br /&gt;
* C-term domain&lt;br /&gt;
&lt;br /&gt;
== Function ==&lt;br /&gt;
&lt;br /&gt;
===Sex determining===&lt;br /&gt;
&lt;br /&gt;
It acts like a sex determining factor thanks to its transcriptional activity. It inhibits the development of female sex structures in the embryonic individual.&lt;br /&gt;
&lt;br /&gt;
The SRY protein contains nuclear localization signals in N and C terminals. An acetylation of these domains allows the exportation of the SRY protein to the nucleus&amp;lt;ref name=&amp;quot;Harley&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
The SRY protein activates the &#039;&#039;SOX9&#039;&#039; (SRY-box9) gene &amp;lt;ref name=&amp;quot;McE&amp;quot; /&amp;gt;. This gene is found in long arm 24.3 of the chromosome 17&amp;lt;ref&amp;gt; NCBI [http://www.ncbi.nlm.nih.gov/gene/6662 NCBI gene: SOX9 SRY-BOX9 Homo sapiens] &amp;lt;/ref&amp;gt; and is implicated in the stimulation of the differentiation of pre-Sertori into Sertoli cells rather than granulosa cells.&lt;br /&gt;
&lt;br /&gt;
The activation of &#039;&#039;SOX&#039;&#039;9 is done by the SRY protein and another transcriptional factor: SF1 (steroidogenic factor 1). These transcriptional factors are bound on an enhancer called: TESCO (Testis-Specific Enhancer of &#039;&#039;SOX9&#039;&#039; core element). The binding of a transcriptional factor on an enhancer provokes a curvature of the DNA (≈75°), allowing a stabilization of the elongation complex on the &#039;&#039;SOX9&#039;&#039; promoter. The SOX9 protein activates the gene &#039;&#039;AMH&#039;&#039; (Anti-Mullerian Hormone)&amp;lt;ref&amp;gt;[http://www.ebi.ac.uk/interpro/entry/IPR006799?q=AMH EBI-Interpro: Anti-Mullerian-Hormon, N-term] &amp;lt;/ref&amp;gt;. Therefore, it allows the degeneration of the channels of Müller in male&amp;lt;ref name=&amp;quot;Harley&amp;quot; /&amp;gt;.&lt;br /&gt;
===Cathecolamines regulation===&lt;br /&gt;
&lt;br /&gt;
It has been shown that SRY is present in brain regions and activates the Tyrosine-3-Hydroxylase expression. This enzyme catalyses the rate-limiting step of catecholamine synthesis (L-Tyrosine to L-DOPA). Furthermore, SRY also activates the expression of Monoamine Oxidase A which is responsible for the inactivation of catecholamines. Therefore, it regulates both positively and negatively the catecholamines concentration&amp;lt;ref name=&amp;quot;Veitia&amp;quot;&amp;gt;PMID: 24604382&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Other extra-testicular effects===&lt;br /&gt;
&lt;br /&gt;
Some knock-down experiments have shown that SRY may also be a major actor in the dopamine pathway. On the peripheral side, it seems to regulate noradrenaline levels and blood pressure&amp;lt;ref name=&amp;quot;Veitia&amp;quot; /&amp;gt;. A researcher who contributed to discovering these effects says it might explain why &amp;quot;the aggressive fight-or-flight reaction is more dominant in men, while women predominantly adopt a less aggressive tend-and-befriend response&amp;quot;&amp;lt;ref&amp;gt;Cohen, Tamara. The &#039;macho&#039; gene that makes men behave aggressively has been found. The Daily Mail (2012). [http://www.dailymail.co.uk/sciencetech/article-2111668/The-macho-gene-makes-men-aggressive-found.html#ixzz3yZC2BV4k]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
It has been shown that SRY may be involved in the regulation of the renin-angiotensin system in mice. Indeed, sequence mutations of the protein lead to hypertension. Because the human&#039;s SRY organisation is very closed to the mouse&#039;s, it has been proposed that SRY may have the same function in humans but it has not been studied directly&amp;lt;ref&amp;gt;PMID:22315667&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
== Diseases==&lt;br /&gt;
&lt;br /&gt;
=== Swyer syndrome (AKA XY gonadal dysgenis) :===&lt;br /&gt;
&lt;br /&gt;
If the TDF protein is not able to bind its targeted DNA sequences, the genes responsible for the testis development are not expressed. The patient owning this defective protein will then develop female characters, even though he has a XY karyotype. This phenomenon is known as the &amp;quot;Swyer Syndrome&amp;quot;. &lt;br /&gt;
Different causes can explain this &amp;quot;XY gonadal dysgenis&amp;quot;, as it is also called. About thirty mutations (named [http://www.uniprot.org/uniprot/Q05066#sequences &amp;quot;SRXY1&amp;quot;]) in the SRY gene have been shown to drive this phenotype development. It can also be due to crossovers during a meiosis. If a Y chromosome portion carrying the SRY gene is recombined into a X chromosome, a sperm cell will get this abnormal Y chromosome. If it then fecundates, a XY karyotype without any SRY gene will be formed. &lt;br /&gt;
&lt;br /&gt;
=== De La Chapelle syndrome (AKA XX male syndrome) :===&lt;br /&gt;
&lt;br /&gt;
From the meiosis just described would also result an abnormal X chromosome, carrying the SRY gene. If the sperm cell owning this chromosome fecundates an ovule, the resulting newborn will have a XX karyotype but a male phenotype. This is called the &amp;quot;De La Chapelle syndrome&amp;quot;. In this case, the patient can either develop testis or both testis and ovarian tissues. As some epigenetic mechanisms can inactivate the X chromosome carrying SRY, this syndrome keeps most of the patients sterile&amp;lt;ref&amp;gt;PMID: 4622299&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Hepatocellular carcinoma===&lt;br /&gt;
 &lt;br /&gt;
In the case on a hepatocellular carcinoma, it has been proved that high expression levels of SRY help cancer progression and poor patient survival. However, it still seems that hepatocellular carcinoma is not most likely to develop in men&amp;lt;ref&amp;gt;PMID: 25274159&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
== Structural highlights ==&lt;br /&gt;
&lt;br /&gt;
This is a sample scene created with SAT to &amp;lt;scene name=&amp;quot;/12/3456/Sample/1&amp;quot;&amp;gt;color&amp;lt;/scene&amp;gt; by Group, and another to make &amp;lt;scene name=&amp;quot;/12/3456/Sample/2&amp;quot;&amp;gt;a transparent representation&amp;lt;/scene&amp;gt; of the protein. You can make your own scenes on SAT starting from scratch or loading and editing one of these sample scenes.&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_1/3&#039;&amp;gt;Helix 1&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_2/2&#039;&amp;gt;Helix 2&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_3/1&#039;&amp;gt;Helix 3&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Long_arm_28a/1&#039;&amp;gt;Long arm (28A)&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Short_arm_22a/1&#039;&amp;gt;Short arm (22A)&amp;lt;/scene&amp;gt;&lt;br /&gt;
&amp;lt;/StructureSection&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== References ==&lt;br /&gt;
&amp;lt;references/&amp;gt;&lt;/div&gt;</summary>
		<author><name>Fantin Mesny</name></author>
	</entry>
	<entry>
		<id>https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2526328</id>
		<title>Sandbox Reserved 1120</title>
		<link rel="alternate" type="text/html" href="https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2526328"/>
		<updated>2016-01-30T14:51:19Z</updated>

		<summary type="html">&lt;p&gt;Fantin Mesny: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{Sandbox_Reserved_ESBS_2015}}&amp;lt;!-- PLEASE ADD YOUR CONTENT BELOW HERE --&amp;gt;&lt;br /&gt;
=SRY protein (AKA TDF protein)=&lt;br /&gt;
{{SRY protein (AKA TDF protein)}}&lt;br /&gt;
&amp;lt;StructureSection load=&#039;1hry&#039; size=&#039;340&#039; frame=&#039;true&#039; side=&#039;right&#039; caption=&#039;The SRY protein linked to DNA&#039; scene=&#039;71/719861/Base/1&#039;&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td colspan=&#039;2&#039;&amp;gt;The SRY protein is a 204 residues-long monomeric polypeptide. It is encoded by the SRY gene and is involved in the sex determination in mammals by being responsible for the gonadogenesis and so the male sexual development. It is the HMG-box that gives to the protein its ability to bind DNA by its minor groove&amp;lt;ref name =&amp;quot;Tang&amp;quot;&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;.&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr id=&#039;related&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;[[Related_structure|Related:]]&amp;lt;/b&amp;gt;&amp;lt;/td&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;[[1hrz|1hrz]]&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr id=&#039;resources&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Resources:&amp;lt;/b&amp;gt;&amp;lt;/td&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;&amp;lt;span class=&#039;plainlinks&#039;&amp;gt;[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=1hry FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=1hry OCA], [http://pdbe.org/1hry PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=1hry RCSB], [http://www.ebi.ac.uk/pdbsum/1hry PDBsum]&lt;br /&gt;
&amp;lt;tr id=&#039;Gene&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Encoded by&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;The SRY gene codes for the SRY protein&lt;br /&gt;
&amp;lt;tr id=&#039;Length&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Length&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;204 residues&lt;br /&gt;
&amp;lt;tr id=&#039;Molecular weight&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Molecular weight&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;≈23kDa&lt;br /&gt;
&amp;lt;tr id=&#039;DNA target sequence&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;DNA target sequence&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;(5&#039;-dGCACAAAC)&lt;br /&gt;
&amp;lt;tr id=&#039;Regulation&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Regulation&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;[https://en.wikipedia.org/wiki/Steroidogenic_factor_1 Sf1];[https://en.wikipedia.org/wiki/Sp1_transcription_factor Sp1] (binding site in the promoter of SRY : -150),[https://en.wikipedia.org/wiki/WT1 WT1] (binding site in the promoter of SRY : -87)&lt;br /&gt;
&amp;lt;tr id=&#039;Role&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Role&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;Transcription factor&lt;br /&gt;
&amp;lt;tr id=&#039;Genes targeted&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Genes targeted&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;SOX9&lt;br /&gt;
&lt;br /&gt;
&amp;lt;/span&amp;gt;&lt;br /&gt;
&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;/table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==History==&lt;br /&gt;
&lt;br /&gt;
After centuries of unfounded theories mainly based on environmental factors, the first molecular theory concerning the sex determination appeared in 1891. At this time, the german biologist Hermann Henking was studying sperm formation in wasps. As a chromosome which was not present in all the wasps looked different from the others, he suspected it to play a role in sex determination and called it the &amp;quot;X chromosome&amp;quot;.&lt;br /&gt;
Ten years later, Clarence Erwin McClung saw that this chromosome behaved differently during the meiosis and was only present in half the sperm cells of grasshoppers. As the main characteristic that varies in 50/50 proportions among zygotes is the sex, McClung suspected the X chromosome to be implicated in sexual development. &lt;br /&gt;
In 1905, Nettie Stevens discovered the &amp;quot;Y chromosome&amp;quot; (and the female XX and male XY patterns) while she was counting the chromosomes of beetles under the microscope&amp;lt;ref&amp;gt;Sumner, A. T. Sex Chromosomes and Sex Determination. Chromosomes: Organization and Function, 97-108. [http://www.nature.com/scitable/nated/topicpage/Sex-Chromosomes-and-Sex-Determination-44565]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
During the next decades, a few theories were in competition. In 1921, Calvin Bridges&#039;s works on &#039;&#039;Drosophila melanogaster&#039;&#039; seemed to reveal that male characters acquisition is due to a genic balance between the genes contained in the X chromosome and those contained in the autosomes&amp;lt;ref&amp;gt;PMID: 17769897&amp;lt;/ref&amp;gt;.&lt;br /&gt;
In 1930, Ronald Fisher introduced the first Y-based control of sex theory by proposing two different models : either all the genes responsible for the male characters are located on the Y chromosome or there is a Y-located gene which regulates the expression of genes elsewhere in the genome&amp;lt;ref name=&amp;quot;Goodfellow&amp;quot;&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt;.&lt;br /&gt;
As Alfred Jost had shown the testosterone produced by the testis is responsible for the entire male phenotype acquisition&amp;lt;ref&amp;gt;PMID: 4805859&amp;lt;/ref&amp;gt;, Peter Neville Goodfellow proposed in 1988, that there is a gene (&#039;&#039;TDF&#039;&#039; in human, &#039;&#039;Tdy&#039;&#039; in mice)  on the Y chromosome which drives the development of the testis&amp;lt;ref name=&amp;quot;Goodfellow&amp;quot; /&amp;gt;. In 1990, Goodfellow&#039;s hypothesis was validated with the discovery of &#039;&#039;Tdy&#039;&#039;&#039;s localisation. This gene&#039;s product (expressed during the male gonadal development) owns an amino-acid motif which shows homology to other known or putative DNA-binding domains. &#039;&#039;Tdy&#039;&#039; is therefore a transcriptional factor&amp;lt;ref&amp;gt;PMID: 2374589&amp;lt;/ref&amp;gt;. The same year, the human &#039;&#039;SRY&#039;&#039; gene (accepted later as the &#039;&#039;TDF&#039;&#039;) was discovered&amp;lt;ref&amp;gt;PMID: 1695712&amp;lt;/ref&amp;gt;. &lt;br /&gt;
Three dimensional structure of the SRY protein was determined in 1995 using NMR spectroscopy&amp;lt;ref&amp;gt;PMID:7774012&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
==SRY gene==&lt;br /&gt;
&lt;br /&gt;
The SRY gene encodes the SRY protein. The SRY protein is a transcriptional factor that induces the male phenotype in the embryo. The SRY gene is located on the [https://en.wikipedia.org/wiki/Y_chromosome Y chromosome] in the short arm (p) 11.3 &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/gene/6736 NCBI gene]&amp;lt;/ref&amp;gt;. This gene has only one exon that contains the HMG domain (DNA-binding High-Mobility Group box domain). It means that SRY mRNA does not have an alternative splicing, so there is only one isoforme of SRY protein&amp;lt;ref name=&amp;quot;McE&amp;quot;&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;. Moreover, the human genome contains only one copy of the SRY gene, whereas the mouse genome contains 6 copy of this gene&amp;lt;ref&amp;gt; Sekido R, Lovell-Badge R. Genetic control of testis development. Sex Dev Genet Mol Biol Evol Endocrinol Embryol Pathol Sex Determ Differ. 2013;7(1-3):21–32 &amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Sequence of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:90%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
&amp;gt;gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/nuccore NCBI nucleotide]&amp;lt;/ref&amp;gt;&lt;br /&gt;
TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT&lt;br /&gt;
TTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACA&lt;br /&gt;
&amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;ATG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;CAATCATATGCTTCTGCTATGTTAAGCGTATTCAACAGCGATGATTACAGTCCAGCTGTGCAAGAGAAT&lt;br /&gt;
ATTCCCGCTCTCCGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTAAGTATCAGTGTGAAA&lt;br /&gt;
CGGGAGAAAACAGTAAAGGCAACGTCCAGGATAGAGTGAAGCGACCCATGAACGCATTCATCGTGTGGTC&lt;br /&gt;
&#039;&#039;&#039;TCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCAGAGATCAGCAAGCAGCTG&lt;br /&gt;
&#039;&#039;&#039;GGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCATTCTTCCAGGAGGCACAGAAATTACAGG&lt;br /&gt;
&#039;&#039;&#039;CCATGCACAGAGAGAAATACCCGAATTATAAGTATCGA&#039;&#039;&#039;CCTCGTCGGAAGGCGAAGATGCTGCCGAAGAA&lt;br /&gt;
TTGCAGTTTGCTTCCCGCAGATCCCGCTTCGGTACTCTGCAGCGAAGTGCAACTGGACAACAGGTTGTAC&lt;br /&gt;
AGGGATGACTGTACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAACG&lt;br /&gt;
CAGCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTG&amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;TAG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;GACAATCGGGTAACATT&lt;br /&gt;
GGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCACTTTCTTATGTTTAGTTT&lt;br /&gt;
CAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCATTTCA&amp;lt;/small&amp;gt;&lt;br /&gt;
&lt;br /&gt;
(Legend : &amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Initiation codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt; ; &amp;lt;b&amp;gt;HMG sequence&amp;lt;/b&amp;gt; ; &amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Stop codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;)&lt;br /&gt;
&amp;lt;/div&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Regulation of the expression of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
In humans, the SRY promoter is located between −408 and −95 bp. Moreover, the SRY gene has enhancers at -727 pb. The linkage between regulatory proteins and these enhancers has the property to increase the production of SRY proteins. These regulatory proteins could be: SF1 (steroidogenic factor 1), SP1  and WT 1 (Wilms tumor)&amp;lt;ref name=&amp;quot;Harley&amp;quot;&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;SF1&#039;&#039;&#039;: this transcriptional factor belongs to the family of nuclear hormone receptors and contains a zinc finger. The activation of this protein requires a ligand (hormone).&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;SP1&#039;&#039;&#039;: this transcriptional factor is an ubiquitous protein which binds rich GC-sites and is implicated in the transcription of many genes. Moreover, this protein contains a zinc finger.&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;WT1&#039;&#039;&#039; :this transcriptional factor transactivates the SRY gene. It contains a zinc finger&amp;lt;ref&amp;gt;Larney C, Bailey TL, Koopman P. Switching on sex: transcriptional regulation of the testis-determining gene Sry. Dev Camb Engl. 2014 Jun;141(11):2195–205&amp;lt;/ref&amp;gt;. &lt;br /&gt;
&lt;br /&gt;
==Structure==&lt;br /&gt;
&lt;br /&gt;
===The SRY-HMG domain (HMG-Box)===&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;&#039;SRY-HMG&#039;&#039;&#039; stands for &#039;&#039;&#039;S&#039;&#039;&#039;ex determining &#039;&#039;&#039;R&#039;&#039;&#039;egion &#039;&#039;&#039;Y&#039;&#039;&#039; - &#039;&#039;&#039;H&#039;&#039;&#039;igh &#039;&#039;&#039;M&#039;&#039;&#039;obility &#039;&#039;&#039;G&#039;&#039;&#039;roup domain.&lt;br /&gt;
It is approximately 80 residues-long. It mediates the binding of the protein to the minor groove of DNA. It is the most important part of the SRY protein. Not only because it enables  the protein to bind the DNA but also because even a single mutation can cause an inactivation of the protein.&lt;br /&gt;
&lt;br /&gt;
It has a twisted L shape: it has a long (28Å) and a short (22Å) arm. The HMG Box is made of 3 helices. Its N-term and C-term domains are irregular. The overall structure is stabilized by a hydrophobic core especially at the intersection of the 3 helices where 3 aromatics cycles meet, surrounded by aliphatic aminoacids.&lt;br /&gt;
See the different structures:&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_1/3&#039;&amp;gt;Helix 1&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_2/2&#039;&amp;gt;Helix 2&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_3/1&#039;&amp;gt;Helix 3&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Long_arm_28a/1&#039;&amp;gt;Long arm (28Å)&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Short_arm_22a/1&#039;&amp;gt;Short arm (22Å)&amp;lt;/scene&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The interaction between the HMG-Box and DNA is specific and stable.  It is mostly hydrophobic. It permits the DNA to bend of DNA (≈75°). Only one molecule of water interfaces the Box and the DNA. The complex is stabilized by salt bridges between positively charged residues of the HMG domain and negatively charged phosphates&amp;lt;ref name=&amp;quot;Tang&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
[[Image:HHMG-bitmap.png|thumb|alt=Image bitmap|Linear structure of hHMG domain]]&lt;br /&gt;
&lt;br /&gt;
The binding of SRY on DNA is specific. The DNA target site is a DNA octamer :&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:30%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
(5&#039;-dGCACAAAC)&amp;lt;br/&amp;gt;&lt;br /&gt;
(5&#039;-dGTTTGTGC)&lt;br /&gt;
&amp;lt;/small&amp;gt;&amp;lt;/div&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
This sequence is found in the promoters of genes expressed during the testicular development.&lt;br /&gt;
The bend of DNA enables the recruitment of different proteins and the building of massive proteins-DNA complexes that could change the expression of different genes&amp;lt;ref&amp;gt;PMID:11563911&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
Even if the most important function of the HMG box is binding and bending DNA, it is also involved in DNA condensation, recombination and repair.&lt;br /&gt;
&lt;br /&gt;
There are two kinds of proteins that contain a HMG box:&lt;br /&gt;
* &#039;&#039;&#039;HMG1&#039;&#039;&#039; : It is expressed in few cell types. It is found in transcription factors that contain a single HMG box. The binding of a DNA sequence is specific.&lt;br /&gt;
* &#039;&#039;&#039;HMG2&#039;&#039;&#039; : It is found in all cell types and is abundant in chromatin. These proteins can contain two or more HMG boxes that can non-specifically bind DNA. &lt;br /&gt;
&lt;br /&gt;
===General structure of SRY===&lt;br /&gt;
&lt;br /&gt;
The overall structure of SRY is organized around the HMG-box.&lt;br /&gt;
3 domains:&lt;br /&gt;
* N-term domain&lt;br /&gt;
* Central domain : DNA binding (HMG box)&lt;br /&gt;
* C-term domain&lt;br /&gt;
&lt;br /&gt;
== Function ==&lt;br /&gt;
&lt;br /&gt;
===Sex determining===&lt;br /&gt;
&lt;br /&gt;
It acts like a sex determining factor thanks to its transcriptional activity. It inhibits the development of female sex structures in the embryonic individual.&lt;br /&gt;
&lt;br /&gt;
The SRY protein contains nuclear localization signals in N and C terminals. An acetylation of these domains allows the exportation of the SRY protein to the nucleus&amp;lt;ref name=&amp;quot;Harley&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
The SRY protein activates the &#039;&#039;SOX9&#039;&#039; (SRY-box9) gene &amp;lt;ref name=&amp;quot;McE&amp;quot; /&amp;gt;. This gene is found in long arm 24.3 of the chromosome 17&amp;lt;ref&amp;gt; NCBI [http://www.ncbi.nlm.nih.gov/gene/6662 NCBI gene: SOX9 SRY-BOX9 Homo sapiens] &amp;lt;/ref&amp;gt; and is implicated in the stimulation of the differentiation of pre-Sertori into Sertoli cells rather than granulosa cells.&lt;br /&gt;
&lt;br /&gt;
The activation of &#039;&#039;SOX&#039;&#039;9 is done by the SRY protein and another transcriptional factor: SF1 (steroidogenic factor 1). These transcriptional factors are bound on an enhancer called: TESCO (Testis-Specific Enhancer of &#039;&#039;SOX9&#039;&#039; core element). The binding of a transcriptional factor on an enhancer provokes a curvature of the DNA (≈75°), allowing a stabilization of the elongation complex on the &#039;&#039;SOX9&#039;&#039; promoter. The SOX9 protein activates the gene &#039;&#039;AMH&#039;&#039; (Anti-Mullerian Hormone)&amp;lt;ref&amp;gt;[http://www.ebi.ac.uk/interpro/entry/IPR006799?q=AMH EBI-Interpro: Anti-Mullerian-Hormon, N-term] &amp;lt;/ref&amp;gt;. Therefore, it allows the degeneration of the channels of Müller in male&amp;lt;ref name=&amp;quot;Harley&amp;quot; /&amp;gt;.&lt;br /&gt;
===Cathecolamines regulation===&lt;br /&gt;
&lt;br /&gt;
It has been shown that SRY is present in brain regions and activates the Tyrosine-3-Hydroxylase expression. This enzyme catalyses the rate-limiting step of catecholamine synthesis (L-Tyrosine to L-DOPA). Furthermore, SRY also activates the expression of Monoamine Oxidase A which is responsible for the inactivation of catecholamines. Therefore, it regulates both positively and negatively the catecholamines concentration&amp;lt;ref name=&amp;quot;Veitia&amp;quot;&amp;gt;PMID: 24604382&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Other extra-testicular effects===&lt;br /&gt;
&lt;br /&gt;
Some knock-down experiments have shown that SRY may also be a major actor in the dopamine pathway. On the peripheral side, it seems to regulate noradrenaline levels and blood pressure&amp;lt;ref name=&amp;quot;Veitia&amp;quot; /&amp;gt;. A researcher who contributed to discovering these effects says it might explain why &amp;quot;the aggressive fight-or-flight reaction is more dominant in men, while women predominantly adopt a less aggressive tend-and-befriend response&amp;quot;&amp;lt;ref&amp;gt;Cohen, Tamara. The &#039;macho&#039; gene that makes men behave aggressively has been found. The Daily Mail (2012). [http://www.dailymail.co.uk/sciencetech/article-2111668/The-macho-gene-makes-men-aggressive-found.html#ixzz3yZC2BV4k]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
It has been shown that SRY may be involved in the regulation of the renin-angiotensin system in mice. Indeed, sequence mutations of the protein lead to hypertension. Because the human&#039;s SRY organisation is very closed to the mouse&#039;s, it has been proposed that SRY may have the same function in humans but it has not been studied directly&amp;lt;ref&amp;gt;PMID:22315667&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
== Diseases==&lt;br /&gt;
&lt;br /&gt;
=== Swyer syndrome (AKA XY gonadal dysgenis) :===&lt;br /&gt;
&lt;br /&gt;
If the TDF protein is not able to bind its targeted DNA sequences, the genes responsible for the testis development are not expressed. The patient owning this defective protein will then develop female characters, even though he has a XY karyotype. This phenomenon is known as the &amp;quot;Swyer Syndrome&amp;quot;. &lt;br /&gt;
Different causes can explain this &amp;quot;XY gonadal dysgenis&amp;quot;, as it is also called. About thirty mutations (named [http://www.uniprot.org/uniprot/Q05066#sequences &amp;quot;SRXY1&amp;quot;]) in the SRY gene have been shown to drive this phenotype development. It can also be due to crossovers during a meiosis. If a Y chromosome portion carrying the SRY gene is recombined into a X chromosome, a sperm cell will get this abnormal Y chromosome. If it then fecundates, a XY karyotype without any SRY gene will be formed. &lt;br /&gt;
&lt;br /&gt;
=== De La Chapelle syndrome (AKA XX male syndrome) :===&lt;br /&gt;
&lt;br /&gt;
From the meiosis just described would also result an abnormal X chromosome, carrying the SRY gene. If the sperm cell owning this chromosome fecundates an ovule, the resulting newborn will have a XX karyotype but a male phenotype. This is called the &amp;quot;De La Chapelle syndrome&amp;quot;. In this case, the patient can either develop testis or both testis and ovarian tissues. As some epigenetic mechanisms can inactivate the X chromosome carrying SRY, this syndrome keeps most of the patients sterile&amp;lt;ref&amp;gt;PMID: 4622299&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Hepatocellular carcinoma===&lt;br /&gt;
 &lt;br /&gt;
In the case on a hepatocellular carcinoma, it has been proved that high expression levels of SRY help cancer progression and poor patient survival. However, it still seems that hepatocellular carcinoma is not most likely to develop in men&amp;lt;ref&amp;gt;PMID: 25274159&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
== Structural highlights ==&lt;br /&gt;
&lt;br /&gt;
This is a sample scene created with SAT to &amp;lt;scene name=&amp;quot;/12/3456/Sample/1&amp;quot;&amp;gt;color&amp;lt;/scene&amp;gt; by Group, and another to make &amp;lt;scene name=&amp;quot;/12/3456/Sample/2&amp;quot;&amp;gt;a transparent representation&amp;lt;/scene&amp;gt; of the protein. You can make your own scenes on SAT starting from scratch or loading and editing one of these sample scenes.&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_1/3&#039;&amp;gt;Helix 1&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_2/2&#039;&amp;gt;Helix 2&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_3/1&#039;&amp;gt;Helix 3&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Long_arm_28a/1&#039;&amp;gt;Long arm (28A)&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Short_arm_22a/1&#039;&amp;gt;Short arm (22A)&amp;lt;/scene&amp;gt;&lt;br /&gt;
&amp;lt;/StructureSection&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== References ==&lt;br /&gt;
&amp;lt;references/&amp;gt;&lt;/div&gt;</summary>
		<author><name>Fantin Mesny</name></author>
	</entry>
	<entry>
		<id>https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2526326</id>
		<title>Sandbox Reserved 1120</title>
		<link rel="alternate" type="text/html" href="https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2526326"/>
		<updated>2016-01-30T14:50:43Z</updated>

		<summary type="html">&lt;p&gt;Fantin Mesny: Undo revision 2526325 by Fantin Mesny (Talk)&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;StructureSection load=&#039;1hry&#039; size=&#039;340&#039; frame=&#039;true&#039; side=&#039;right&#039; caption=&#039;The SRY protein linked to DNA&#039; scene=&#039;71/719861/Base/1&#039;&amp;gt;&lt;br /&gt;
{{Sandbox_Reserved_ESBS_2015}}&amp;lt;!-- PLEASE ADD YOUR CONTENT BELOW HERE --&amp;gt;&lt;br /&gt;
=SRY protein (AKA TDF protein)=&lt;br /&gt;
{{SRY protein (AKA TDF protein)}}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td colspan=&#039;2&#039;&amp;gt;The SRY protein is a 204 residues-long monomeric polypeptide. It is encoded by the SRY gene and is involved in the sex determination in mammals by being responsible for the gonadogenesis and so the male sexual development. It is the HMG-box that gives to the protein its ability to bind DNA by its minor groove&amp;lt;ref name =&amp;quot;Tang&amp;quot;&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;.&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr id=&#039;related&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;[[Related_structure|Related:]]&amp;lt;/b&amp;gt;&amp;lt;/td&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;[[1hrz|1hrz]]&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr id=&#039;resources&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Resources:&amp;lt;/b&amp;gt;&amp;lt;/td&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;&amp;lt;span class=&#039;plainlinks&#039;&amp;gt;[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=1hry FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=1hry OCA], [http://pdbe.org/1hry PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=1hry RCSB], [http://www.ebi.ac.uk/pdbsum/1hry PDBsum]&lt;br /&gt;
&amp;lt;tr id=&#039;Gene&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Encoded by&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;The SRY gene codes for the SRY protein&lt;br /&gt;
&amp;lt;tr id=&#039;Length&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Length&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;204 residues&lt;br /&gt;
&amp;lt;tr id=&#039;Molecular weight&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Molecular weight&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;≈23kDa&lt;br /&gt;
&amp;lt;tr id=&#039;DNA target sequence&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;DNA target sequence&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;(5&#039;-dGCACAAAC)&lt;br /&gt;
&amp;lt;tr id=&#039;Regulation&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Regulation&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;[https://en.wikipedia.org/wiki/Steroidogenic_factor_1 Sf1];[https://en.wikipedia.org/wiki/Sp1_transcription_factor Sp1] (binding site in the promoter of SRY : -150),[https://en.wikipedia.org/wiki/WT1 WT1] (binding site in the promoter of SRY : -87)&lt;br /&gt;
&amp;lt;tr id=&#039;Role&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Role&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;Transcription factor&lt;br /&gt;
&amp;lt;tr id=&#039;Genes targeted&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Genes targeted&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;SOX9&lt;br /&gt;
&lt;br /&gt;
&amp;lt;/span&amp;gt;&lt;br /&gt;
&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;/table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==History==&lt;br /&gt;
&lt;br /&gt;
After centuries of unfounded theories mainly based on environmental factors, the first molecular theory concerning the sex determination appeared in 1891. At this time, the german biologist Hermann Henking was studying sperm formation in wasps. As a chromosome which was not present in all the wasps looked different from the others, he suspected it to play a role in sex determination and called it the &amp;quot;X chromosome&amp;quot;.&lt;br /&gt;
Ten years later, Clarence Erwin McClung saw that this chromosome behaved differently during the meiosis and was only present in half the sperm cells of grasshoppers. As the main characteristic that varies in 50/50 proportions among zygotes is the sex, McClung suspected the X chromosome to be implicated in sexual development. &lt;br /&gt;
In 1905, Nettie Stevens discovered the &amp;quot;Y chromosome&amp;quot; (and the female XX and male XY patterns) while she was counting the chromosomes of beetles under the microscope&amp;lt;ref&amp;gt;Sumner, A. T. Sex Chromosomes and Sex Determination. Chromosomes: Organization and Function, 97-108. [http://www.nature.com/scitable/nated/topicpage/Sex-Chromosomes-and-Sex-Determination-44565]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
During the next decades, a few theories were in competition. In 1921, Calvin Bridges&#039;s works on &#039;&#039;Drosophila melanogaster&#039;&#039; seemed to reveal that male characters acquisition is due to a genic balance between the genes contained in the X chromosome and those contained in the autosomes&amp;lt;ref&amp;gt;PMID: 17769897&amp;lt;/ref&amp;gt;.&lt;br /&gt;
In 1930, Ronald Fisher introduced the first Y-based control of sex theory by proposing two different models : either all the genes responsible for the male characters are located on the Y chromosome or there is a Y-located gene which regulates the expression of genes elsewhere in the genome&amp;lt;ref name=&amp;quot;Goodfellow&amp;quot;&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt;.&lt;br /&gt;
As Alfred Jost had shown the testosterone produced by the testis is responsible for the entire male phenotype acquisition&amp;lt;ref&amp;gt;PMID: 4805859&amp;lt;/ref&amp;gt;, Peter Neville Goodfellow proposed in 1988, that there is a gene (&#039;&#039;TDF&#039;&#039; in human, &#039;&#039;Tdy&#039;&#039; in mice)  on the Y chromosome which drives the development of the testis&amp;lt;ref name=&amp;quot;Goodfellow&amp;quot; /&amp;gt;. In 1990, Goodfellow&#039;s hypothesis was validated with the discovery of &#039;&#039;Tdy&#039;&#039;&#039;s localisation. This gene&#039;s product (expressed during the male gonadal development) owns an amino-acid motif which shows homology to other known or putative DNA-binding domains. &#039;&#039;Tdy&#039;&#039; is therefore a transcriptional factor&amp;lt;ref&amp;gt;PMID: 2374589&amp;lt;/ref&amp;gt;. The same year, the human &#039;&#039;SRY&#039;&#039; gene (accepted later as the &#039;&#039;TDF&#039;&#039;) was discovered&amp;lt;ref&amp;gt;PMID: 1695712&amp;lt;/ref&amp;gt;. &lt;br /&gt;
Three dimensional structure of the SRY protein was determined in 1995 using NMR spectroscopy&amp;lt;ref&amp;gt;PMID:7774012&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
==SRY gene==&lt;br /&gt;
&lt;br /&gt;
The SRY gene encodes the SRY protein. The SRY protein is a transcriptional factor that induces the male phenotype in the embryo. The SRY gene is located on the [https://en.wikipedia.org/wiki/Y_chromosome Y chromosome] in the short arm (p) 11.3 &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/gene/6736 NCBI gene]&amp;lt;/ref&amp;gt;. This gene has only one exon that contains the HMG domain (DNA-binding High-Mobility Group box domain). It means that SRY mRNA does not have an alternative splicing, so there is only one isoforme of SRY protein&amp;lt;ref name=&amp;quot;McE&amp;quot;&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;. Moreover, the human genome contains only one copy of the SRY gene, whereas the mouse genome contains 6 copy of this gene&amp;lt;ref&amp;gt; Sekido R, Lovell-Badge R. Genetic control of testis development. Sex Dev Genet Mol Biol Evol Endocrinol Embryol Pathol Sex Determ Differ. 2013;7(1-3):21–32 &amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Sequence of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:90%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
&amp;gt;gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/nuccore NCBI nucleotide]&amp;lt;/ref&amp;gt;&lt;br /&gt;
TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT&lt;br /&gt;
TTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACA&lt;br /&gt;
&amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;ATG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;CAATCATATGCTTCTGCTATGTTAAGCGTATTCAACAGCGATGATTACAGTCCAGCTGTGCAAGAGAAT&lt;br /&gt;
ATTCCCGCTCTCCGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTAAGTATCAGTGTGAAA&lt;br /&gt;
CGGGAGAAAACAGTAAAGGCAACGTCCAGGATAGAGTGAAGCGACCCATGAACGCATTCATCGTGTGGTC&lt;br /&gt;
&#039;&#039;&#039;TCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCAGAGATCAGCAAGCAGCTG&lt;br /&gt;
&#039;&#039;&#039;GGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCATTCTTCCAGGAGGCACAGAAATTACAGG&lt;br /&gt;
&#039;&#039;&#039;CCATGCACAGAGAGAAATACCCGAATTATAAGTATCGA&#039;&#039;&#039;CCTCGTCGGAAGGCGAAGATGCTGCCGAAGAA&lt;br /&gt;
TTGCAGTTTGCTTCCCGCAGATCCCGCTTCGGTACTCTGCAGCGAAGTGCAACTGGACAACAGGTTGTAC&lt;br /&gt;
AGGGATGACTGTACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAACG&lt;br /&gt;
CAGCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTG&amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;TAG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;GACAATCGGGTAACATT&lt;br /&gt;
GGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCACTTTCTTATGTTTAGTTT&lt;br /&gt;
CAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCATTTCA&amp;lt;/small&amp;gt;&lt;br /&gt;
&lt;br /&gt;
(Legend : &amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Initiation codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt; ; &amp;lt;b&amp;gt;HMG sequence&amp;lt;/b&amp;gt; ; &amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Stop codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;)&lt;br /&gt;
&amp;lt;/div&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Regulation of the expression of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
In humans, the SRY promoter is located between −408 and −95 bp. Moreover, the SRY gene has enhancers at -727 pb. The linkage between regulatory proteins and these enhancers has the property to increase the production of SRY proteins. These regulatory proteins could be: SF1 (steroidogenic factor 1), SP1  and WT 1 (Wilms tumor)&amp;lt;ref name=&amp;quot;Harley&amp;quot;&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;SF1&#039;&#039;&#039;: this transcriptional factor belongs to the family of nuclear hormone receptors and contains a zinc finger. The activation of this protein requires a ligand (hormone).&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;SP1&#039;&#039;&#039;: this transcriptional factor is an ubiquitous protein which binds rich GC-sites and is implicated in the transcription of many genes. Moreover, this protein contains a zinc finger.&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;WT1&#039;&#039;&#039; :this transcriptional factor transactivates the SRY gene. It contains a zinc finger&amp;lt;ref&amp;gt;Larney C, Bailey TL, Koopman P. Switching on sex: transcriptional regulation of the testis-determining gene Sry. Dev Camb Engl. 2014 Jun;141(11):2195–205&amp;lt;/ref&amp;gt;. &lt;br /&gt;
&lt;br /&gt;
==Structure==&lt;br /&gt;
&lt;br /&gt;
===The SRY-HMG domain (HMG-Box)===&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;&#039;SRY-HMG&#039;&#039;&#039; stands for &#039;&#039;&#039;S&#039;&#039;&#039;ex determining &#039;&#039;&#039;R&#039;&#039;&#039;egion &#039;&#039;&#039;Y&#039;&#039;&#039; - &#039;&#039;&#039;H&#039;&#039;&#039;igh &#039;&#039;&#039;M&#039;&#039;&#039;obility &#039;&#039;&#039;G&#039;&#039;&#039;roup domain.&lt;br /&gt;
It is approximately 80 residues-long. It mediates the binding of the protein to the minor groove of DNA. It is the most important part of the SRY protein. Not only because it enables  the protein to bind the DNA but also because even a single mutation can cause an inactivation of the protein.&lt;br /&gt;
&lt;br /&gt;
It has a twisted L shape: it has a long (28Å) and a short (22Å) arm. The HMG Box is made of 3 helices. Its N-term and C-term domains are irregular. The overall structure is stabilized by a hydrophobic core especially at the intersection of the 3 helices where 3 aromatics cycles meet, surrounded by aliphatic aminoacids.&lt;br /&gt;
See the different structures:&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_1/3&#039;&amp;gt;Helix 1&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_2/2&#039;&amp;gt;Helix 2&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_3/1&#039;&amp;gt;Helix 3&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Long_arm_28a/1&#039;&amp;gt;Long arm (28Å)&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Short_arm_22a/1&#039;&amp;gt;Short arm (22Å)&amp;lt;/scene&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The interaction between the HMG-Box and DNA is specific and stable.  It is mostly hydrophobic. It permits the DNA to bend of DNA (≈75°). Only one molecule of water interfaces the Box and the DNA. The complex is stabilized by salt bridges between positively charged residues of the HMG domain and negatively charged phosphates&amp;lt;ref name=&amp;quot;Tang&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
[[Image:HHMG-bitmap.png|thumb|alt=Image bitmap|Linear structure of hHMG domain]]&lt;br /&gt;
&lt;br /&gt;
The binding of SRY on DNA is specific. The DNA target site is a DNA octamer :&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:30%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
(5&#039;-dGCACAAAC)&amp;lt;br/&amp;gt;&lt;br /&gt;
(5&#039;-dGTTTGTGC)&lt;br /&gt;
&amp;lt;/small&amp;gt;&amp;lt;/div&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
This sequence is found in the promoters of genes expressed during the testicular development.&lt;br /&gt;
The bend of DNA enables the recruitment of different proteins and the building of massive proteins-DNA complexes that could change the expression of different genes&amp;lt;ref&amp;gt;PMID:11563911&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
Even if the most important function of the HMG box is binding and bending DNA, it is also involved in DNA condensation, recombination and repair.&lt;br /&gt;
&lt;br /&gt;
There are two kinds of proteins that contain a HMG box:&lt;br /&gt;
* &#039;&#039;&#039;HMG1&#039;&#039;&#039; : It is expressed in few cell types. It is found in transcription factors that contain a single HMG box. The binding of a DNA sequence is specific.&lt;br /&gt;
* &#039;&#039;&#039;HMG2&#039;&#039;&#039; : It is found in all cell types and is abundant in chromatin. These proteins can contain two or more HMG boxes that can non-specifically bind DNA. &lt;br /&gt;
&lt;br /&gt;
===General structure of SRY===&lt;br /&gt;
&lt;br /&gt;
The overall structure of SRY is organized around the HMG-box.&lt;br /&gt;
3 domains:&lt;br /&gt;
* N-term domain&lt;br /&gt;
* Central domain : DNA binding (HMG box)&lt;br /&gt;
* C-term domain&lt;br /&gt;
&lt;br /&gt;
== Function ==&lt;br /&gt;
&lt;br /&gt;
===Sex determining===&lt;br /&gt;
&lt;br /&gt;
It acts like a sex determining factor thanks to its transcriptional activity. It inhibits the development of female sex structures in the embryonic individual.&lt;br /&gt;
&lt;br /&gt;
The SRY protein contains nuclear localization signals in N and C terminals. An acetylation of these domains allows the exportation of the SRY protein to the nucleus&amp;lt;ref name=&amp;quot;Harley&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
The SRY protein activates the &#039;&#039;SOX9&#039;&#039; (SRY-box9) gene &amp;lt;ref name=&amp;quot;McE&amp;quot; /&amp;gt;. This gene is found in long arm 24.3 of the chromosome 17&amp;lt;ref&amp;gt; NCBI [http://www.ncbi.nlm.nih.gov/gene/6662 NCBI gene: SOX9 SRY-BOX9 Homo sapiens] &amp;lt;/ref&amp;gt; and is implicated in the stimulation of the differentiation of pre-Sertori into Sertoli cells rather than granulosa cells.&lt;br /&gt;
&lt;br /&gt;
The activation of &#039;&#039;SOX&#039;&#039;9 is done by the SRY protein and another transcriptional factor: SF1 (steroidogenic factor 1). These transcriptional factors are bound on an enhancer called: TESCO (Testis-Specific Enhancer of &#039;&#039;SOX9&#039;&#039; core element). The binding of a transcriptional factor on an enhancer provokes a curvature of the DNA (≈75°), allowing a stabilization of the elongation complex on the &#039;&#039;SOX9&#039;&#039; promoter. The SOX9 protein activates the gene &#039;&#039;AMH&#039;&#039; (Anti-Mullerian Hormone)&amp;lt;ref&amp;gt;[http://www.ebi.ac.uk/interpro/entry/IPR006799?q=AMH EBI-Interpro: Anti-Mullerian-Hormon, N-term] &amp;lt;/ref&amp;gt;. Therefore, it allows the degeneration of the channels of Müller in male&amp;lt;ref name=&amp;quot;Harley&amp;quot; /&amp;gt;.&lt;br /&gt;
===Cathecolamines regulation===&lt;br /&gt;
&lt;br /&gt;
It has been shown that SRY is present in brain regions and activates the Tyrosine-3-Hydroxylase expression. This enzyme catalyses the rate-limiting step of catecholamine synthesis (L-Tyrosine to L-DOPA). Furthermore, SRY also activates the expression of Monoamine Oxidase A which is responsible for the inactivation of catecholamines. Therefore, it regulates both positively and negatively the catecholamines concentration&amp;lt;ref name=&amp;quot;Veitia&amp;quot;&amp;gt;PMID: 24604382&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Other extra-testicular effects===&lt;br /&gt;
&lt;br /&gt;
Some knock-down experiments have shown that SRY may also be a major actor in the dopamine pathway. On the peripheral side, it seems to regulate noradrenaline levels and blood pressure&amp;lt;ref name=&amp;quot;Veitia&amp;quot; /&amp;gt;. A researcher who contributed to discovering these effects says it might explain why &amp;quot;the aggressive fight-or-flight reaction is more dominant in men, while women predominantly adopt a less aggressive tend-and-befriend response&amp;quot;&amp;lt;ref&amp;gt;Cohen, Tamara. The &#039;macho&#039; gene that makes men behave aggressively has been found. The Daily Mail (2012). [http://www.dailymail.co.uk/sciencetech/article-2111668/The-macho-gene-makes-men-aggressive-found.html#ixzz3yZC2BV4k]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
It has been shown that SRY may be involved in the regulation of the renin-angiotensin system in mice. Indeed, sequence mutations of the protein lead to hypertension. Because the human&#039;s SRY organisation is very closed to the mouse&#039;s, it has been proposed that SRY may have the same function in humans but it has not been studied directly&amp;lt;ref&amp;gt;PMID:22315667&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
== Diseases==&lt;br /&gt;
&lt;br /&gt;
=== Swyer syndrome (AKA XY gonadal dysgenis) :===&lt;br /&gt;
&lt;br /&gt;
If the TDF protein is not able to bind its targeted DNA sequences, the genes responsible for the testis development are not expressed. The patient owning this defective protein will then develop female characters, even though he has a XY karyotype. This phenomenon is known as the &amp;quot;Swyer Syndrome&amp;quot;. &lt;br /&gt;
Different causes can explain this &amp;quot;XY gonadal dysgenis&amp;quot;, as it is also called. About thirty mutations (named [http://www.uniprot.org/uniprot/Q05066#sequences &amp;quot;SRXY1&amp;quot;]) in the SRY gene have been shown to drive this phenotype development. It can also be due to crossovers during a meiosis. If a Y chromosome portion carrying the SRY gene is recombined into a X chromosome, a sperm cell will get this abnormal Y chromosome. If it then fecundates, a XY karyotype without any SRY gene will be formed. &lt;br /&gt;
&lt;br /&gt;
=== De La Chapelle syndrome (AKA XX male syndrome) :===&lt;br /&gt;
&lt;br /&gt;
From the meiosis just described would also result an abnormal X chromosome, carrying the SRY gene. If the sperm cell owning this chromosome fecundates an ovule, the resulting newborn will have a XX karyotype but a male phenotype. This is called the &amp;quot;De La Chapelle syndrome&amp;quot;. In this case, the patient can either develop testis or both testis and ovarian tissues. As some epigenetic mechanisms can inactivate the X chromosome carrying SRY, this syndrome keeps most of the patients sterile&amp;lt;ref&amp;gt;PMID: 4622299&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Hepatocellular carcinoma===&lt;br /&gt;
 &lt;br /&gt;
In the case on a hepatocellular carcinoma, it has been proved that high expression levels of SRY help cancer progression and poor patient survival. However, it still seems that hepatocellular carcinoma is not most likely to develop in men&amp;lt;ref&amp;gt;PMID: 25274159&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
== Structural highlights ==&lt;br /&gt;
&lt;br /&gt;
This is a sample scene created with SAT to &amp;lt;scene name=&amp;quot;/12/3456/Sample/1&amp;quot;&amp;gt;color&amp;lt;/scene&amp;gt; by Group, and another to make &amp;lt;scene name=&amp;quot;/12/3456/Sample/2&amp;quot;&amp;gt;a transparent representation&amp;lt;/scene&amp;gt; of the protein. You can make your own scenes on SAT starting from scratch or loading and editing one of these sample scenes.&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_1/3&#039;&amp;gt;Helix 1&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_2/2&#039;&amp;gt;Helix 2&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_3/1&#039;&amp;gt;Helix 3&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Long_arm_28a/1&#039;&amp;gt;Long arm (28A)&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Short_arm_22a/1&#039;&amp;gt;Short arm (22A)&amp;lt;/scene&amp;gt;&lt;br /&gt;
&amp;lt;/StructureSection&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== References ==&lt;br /&gt;
&amp;lt;references/&amp;gt;&lt;/div&gt;</summary>
		<author><name>Fantin Mesny</name></author>
	</entry>
	<entry>
		<id>https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2526325</id>
		<title>Sandbox Reserved 1120</title>
		<link rel="alternate" type="text/html" href="https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2526325"/>
		<updated>2016-01-30T14:50:02Z</updated>

		<summary type="html">&lt;p&gt;Fantin Mesny: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;StructureSection load=&#039;1hry&#039; size=&#039;340&#039; frame=&#039;true&#039; side=&#039;right&#039; caption=&#039;The SRY protein linked to DNA&#039; scene=&#039;71/719861/Base/1&#039;&amp;gt;&lt;br /&gt;
=SRY protein (AKA TDF protein)=&lt;br /&gt;
{{SRY protein (AKA TDF protein)}}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td colspan=&#039;2&#039;&amp;gt;The SRY protein is a 204 residues-long monomeric polypeptide. It is encoded by the SRY gene and is involved in the sex determination in mammals by being responsible for the gonadogenesis and so the male sexual development. It is the HMG-box that gives to the protein its ability to bind DNA by its minor groove&amp;lt;ref name =&amp;quot;Tang&amp;quot;&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;.&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr id=&#039;related&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;[[Related_structure|Related:]]&amp;lt;/b&amp;gt;&amp;lt;/td&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;[[1hrz|1hrz]]&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr id=&#039;resources&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Resources:&amp;lt;/b&amp;gt;&amp;lt;/td&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;&amp;lt;span class=&#039;plainlinks&#039;&amp;gt;[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=1hry FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=1hry OCA], [http://pdbe.org/1hry PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=1hry RCSB], [http://www.ebi.ac.uk/pdbsum/1hry PDBsum]&lt;br /&gt;
&amp;lt;tr id=&#039;Gene&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Encoded by&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;The SRY gene codes for the SRY protein&lt;br /&gt;
&amp;lt;tr id=&#039;Length&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Length&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;204 residues&lt;br /&gt;
&amp;lt;tr id=&#039;Molecular weight&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Molecular weight&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;≈23kDa&lt;br /&gt;
&amp;lt;tr id=&#039;DNA target sequence&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;DNA target sequence&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;(5&#039;-dGCACAAAC)&lt;br /&gt;
&amp;lt;tr id=&#039;Regulation&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Regulation&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;[https://en.wikipedia.org/wiki/Steroidogenic_factor_1 Sf1];[https://en.wikipedia.org/wiki/Sp1_transcription_factor Sp1] (binding site in the promoter of SRY : -150),[https://en.wikipedia.org/wiki/WT1 WT1] (binding site in the promoter of SRY : -87)&lt;br /&gt;
&amp;lt;tr id=&#039;Role&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Role&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;Transcription factor&lt;br /&gt;
&amp;lt;tr id=&#039;Genes targeted&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Genes targeted&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;SOX9&lt;br /&gt;
&lt;br /&gt;
&amp;lt;/span&amp;gt;&lt;br /&gt;
&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;/table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==History==&lt;br /&gt;
&lt;br /&gt;
After centuries of unfounded theories mainly based on environmental factors, the first molecular theory concerning the sex determination appeared in 1891. At this time, the german biologist Hermann Henking was studying sperm formation in wasps. As a chromosome which was not present in all the wasps looked different from the others, he suspected it to play a role in sex determination and called it the &amp;quot;X chromosome&amp;quot;.&lt;br /&gt;
Ten years later, Clarence Erwin McClung saw that this chromosome behaved differently during the meiosis and was only present in half the sperm cells of grasshoppers. As the main characteristic that varies in 50/50 proportions among zygotes is the sex, McClung suspected the X chromosome to be implicated in sexual development. &lt;br /&gt;
In 1905, Nettie Stevens discovered the &amp;quot;Y chromosome&amp;quot; (and the female XX and male XY patterns) while she was counting the chromosomes of beetles under the microscope&amp;lt;ref&amp;gt;Sumner, A. T. Sex Chromosomes and Sex Determination. Chromosomes: Organization and Function, 97-108. [http://www.nature.com/scitable/nated/topicpage/Sex-Chromosomes-and-Sex-Determination-44565]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
During the next decades, a few theories were in competition. In 1921, Calvin Bridges&#039;s works on &#039;&#039;Drosophila melanogaster&#039;&#039; seemed to reveal that male characters acquisition is due to a genic balance between the genes contained in the X chromosome and those contained in the autosomes&amp;lt;ref&amp;gt;PMID: 17769897&amp;lt;/ref&amp;gt;.&lt;br /&gt;
In 1930, Ronald Fisher introduced the first Y-based control of sex theory by proposing two different models : either all the genes responsible for the male characters are located on the Y chromosome or there is a Y-located gene which regulates the expression of genes elsewhere in the genome&amp;lt;ref name=&amp;quot;Goodfellow&amp;quot;&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt;.&lt;br /&gt;
As Alfred Jost had shown the testosterone produced by the testis is responsible for the entire male phenotype acquisition&amp;lt;ref&amp;gt;PMID: 4805859&amp;lt;/ref&amp;gt;, Peter Neville Goodfellow proposed in 1988, that there is a gene (&#039;&#039;TDF&#039;&#039; in human, &#039;&#039;Tdy&#039;&#039; in mice)  on the Y chromosome which drives the development of the testis&amp;lt;ref name=&amp;quot;Goodfellow&amp;quot; /&amp;gt;. In 1990, Goodfellow&#039;s hypothesis was validated with the discovery of &#039;&#039;Tdy&#039;&#039;&#039;s localisation. This gene&#039;s product (expressed during the male gonadal development) owns an amino-acid motif which shows homology to other known or putative DNA-binding domains. &#039;&#039;Tdy&#039;&#039; is therefore a transcriptional factor&amp;lt;ref&amp;gt;PMID: 2374589&amp;lt;/ref&amp;gt;. The same year, the human &#039;&#039;SRY&#039;&#039; gene (accepted later as the &#039;&#039;TDF&#039;&#039;) was discovered&amp;lt;ref&amp;gt;PMID: 1695712&amp;lt;/ref&amp;gt;. &lt;br /&gt;
Three dimensional structure of the SRY protein was determined in 1995 using NMR spectroscopy&amp;lt;ref&amp;gt;PMID:7774012&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
==SRY gene==&lt;br /&gt;
&lt;br /&gt;
The SRY gene encodes the SRY protein. The SRY protein is a transcriptional factor that induces the male phenotype in the embryo. The SRY gene is located on the [https://en.wikipedia.org/wiki/Y_chromosome Y chromosome] in the short arm (p) 11.3 &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/gene/6736 NCBI gene]&amp;lt;/ref&amp;gt;. This gene has only one exon that contains the HMG domain (DNA-binding High-Mobility Group box domain). It means that SRY mRNA does not have an alternative splicing, so there is only one isoforme of SRY protein&amp;lt;ref name=&amp;quot;McE&amp;quot;&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;. Moreover, the human genome contains only one copy of the SRY gene, whereas the mouse genome contains 6 copy of this gene&amp;lt;ref&amp;gt; Sekido R, Lovell-Badge R. Genetic control of testis development. Sex Dev Genet Mol Biol Evol Endocrinol Embryol Pathol Sex Determ Differ. 2013;7(1-3):21–32 &amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Sequence of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:90%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
&amp;gt;gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/nuccore NCBI nucleotide]&amp;lt;/ref&amp;gt;&lt;br /&gt;
TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT&lt;br /&gt;
TTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACA&lt;br /&gt;
&amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;ATG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;CAATCATATGCTTCTGCTATGTTAAGCGTATTCAACAGCGATGATTACAGTCCAGCTGTGCAAGAGAAT&lt;br /&gt;
ATTCCCGCTCTCCGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTAAGTATCAGTGTGAAA&lt;br /&gt;
CGGGAGAAAACAGTAAAGGCAACGTCCAGGATAGAGTGAAGCGACCCATGAACGCATTCATCGTGTGGTC&lt;br /&gt;
&#039;&#039;&#039;TCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCAGAGATCAGCAAGCAGCTG&lt;br /&gt;
&#039;&#039;&#039;GGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCATTCTTCCAGGAGGCACAGAAATTACAGG&lt;br /&gt;
&#039;&#039;&#039;CCATGCACAGAGAGAAATACCCGAATTATAAGTATCGA&#039;&#039;&#039;CCTCGTCGGAAGGCGAAGATGCTGCCGAAGAA&lt;br /&gt;
TTGCAGTTTGCTTCCCGCAGATCCCGCTTCGGTACTCTGCAGCGAAGTGCAACTGGACAACAGGTTGTAC&lt;br /&gt;
AGGGATGACTGTACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAACG&lt;br /&gt;
CAGCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTG&amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;TAG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;GACAATCGGGTAACATT&lt;br /&gt;
GGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCACTTTCTTATGTTTAGTTT&lt;br /&gt;
CAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCATTTCA&amp;lt;/small&amp;gt;&lt;br /&gt;
&lt;br /&gt;
(Legend : &amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Initiation codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt; ; &amp;lt;b&amp;gt;HMG sequence&amp;lt;/b&amp;gt; ; &amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Stop codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;)&lt;br /&gt;
&amp;lt;/div&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Regulation of the expression of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
In humans, the SRY promoter is located between −408 and −95 bp. Moreover, the SRY gene has enhancers at -727 pb. The linkage between regulatory proteins and these enhancers has the property to increase the production of SRY proteins. These regulatory proteins could be: SF1 (steroidogenic factor 1), SP1  and WT 1 (Wilms tumor)&amp;lt;ref name=&amp;quot;Harley&amp;quot;&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;SF1&#039;&#039;&#039;: this transcriptional factor belongs to the family of nuclear hormone receptors and contains a zinc finger. The activation of this protein requires a ligand (hormone).&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;SP1&#039;&#039;&#039;: this transcriptional factor is an ubiquitous protein which binds rich GC-sites and is implicated in the transcription of many genes. Moreover, this protein contains a zinc finger.&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;WT1&#039;&#039;&#039; :this transcriptional factor transactivates the SRY gene. It contains a zinc finger&amp;lt;ref&amp;gt;Larney C, Bailey TL, Koopman P. Switching on sex: transcriptional regulation of the testis-determining gene Sry. Dev Camb Engl. 2014 Jun;141(11):2195–205&amp;lt;/ref&amp;gt;. &lt;br /&gt;
&lt;br /&gt;
==Structure==&lt;br /&gt;
&lt;br /&gt;
===The SRY-HMG domain (HMG-Box)===&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;&#039;SRY-HMG&#039;&#039;&#039; stands for &#039;&#039;&#039;S&#039;&#039;&#039;ex determining &#039;&#039;&#039;R&#039;&#039;&#039;egion &#039;&#039;&#039;Y&#039;&#039;&#039; - &#039;&#039;&#039;H&#039;&#039;&#039;igh &#039;&#039;&#039;M&#039;&#039;&#039;obility &#039;&#039;&#039;G&#039;&#039;&#039;roup domain.&lt;br /&gt;
It is approximately 80 residues-long. It mediates the binding of the protein to the minor groove of DNA. It is the most important part of the SRY protein. Not only because it enables  the protein to bind the DNA but also because even a single mutation can cause an inactivation of the protein.&lt;br /&gt;
&lt;br /&gt;
It has a twisted L shape: it has a long (28Å) and a short (22Å) arm. The HMG Box is made of 3 helices. Its N-term and C-term domains are irregular. The overall structure is stabilized by a hydrophobic core especially at the intersection of the 3 helices where 3 aromatics cycles meet, surrounded by aliphatic aminoacids.&lt;br /&gt;
See the different structures:&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_1/3&#039;&amp;gt;Helix 1&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_2/2&#039;&amp;gt;Helix 2&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_3/1&#039;&amp;gt;Helix 3&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Long_arm_28a/1&#039;&amp;gt;Long arm (28Å)&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Short_arm_22a/1&#039;&amp;gt;Short arm (22Å)&amp;lt;/scene&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The interaction between the HMG-Box and DNA is specific and stable.  It is mostly hydrophobic. It permits the DNA to bend of DNA (≈75°). Only one molecule of water interfaces the Box and the DNA. The complex is stabilized by salt bridges between positively charged residues of the HMG domain and negatively charged phosphates&amp;lt;ref name=&amp;quot;Tang&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
[[Image:HHMG-bitmap.png|thumb|alt=Image bitmap|Linear structure of hHMG domain]]&lt;br /&gt;
&lt;br /&gt;
The binding of SRY on DNA is specific. The DNA target site is a DNA octamer :&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:30%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
(5&#039;-dGCACAAAC)&amp;lt;br/&amp;gt;&lt;br /&gt;
(5&#039;-dGTTTGTGC)&lt;br /&gt;
&amp;lt;/small&amp;gt;&amp;lt;/div&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
This sequence is found in the promoters of genes expressed during the testicular development.&lt;br /&gt;
The bend of DNA enables the recruitment of different proteins and the building of massive proteins-DNA complexes that could change the expression of different genes&amp;lt;ref&amp;gt;PMID:11563911&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
Even if the most important function of the HMG box is binding and bending DNA, it is also involved in DNA condensation, recombination and repair.&lt;br /&gt;
&lt;br /&gt;
There are two kinds of proteins that contain a HMG box:&lt;br /&gt;
* &#039;&#039;&#039;HMG1&#039;&#039;&#039; : It is expressed in few cell types. It is found in transcription factors that contain a single HMG box. The binding of a DNA sequence is specific.&lt;br /&gt;
* &#039;&#039;&#039;HMG2&#039;&#039;&#039; : It is found in all cell types and is abundant in chromatin. These proteins can contain two or more HMG boxes that can non-specifically bind DNA. &lt;br /&gt;
&lt;br /&gt;
===General structure of SRY===&lt;br /&gt;
&lt;br /&gt;
The overall structure of SRY is organized around the HMG-box.&lt;br /&gt;
3 domains:&lt;br /&gt;
* N-term domain&lt;br /&gt;
* Central domain : DNA binding (HMG box)&lt;br /&gt;
* C-term domain&lt;br /&gt;
&lt;br /&gt;
== Function ==&lt;br /&gt;
&lt;br /&gt;
===Sex determining===&lt;br /&gt;
&lt;br /&gt;
It acts like a sex determining factor thanks to its transcriptional activity. It inhibits the development of female sex structures in the embryonic individual.&lt;br /&gt;
&lt;br /&gt;
The SRY protein contains nuclear localization signals in N and C terminals. An acetylation of these domains allows the exportation of the SRY protein to the nucleus&amp;lt;ref name=&amp;quot;Harley&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
The SRY protein activates the &#039;&#039;SOX9&#039;&#039; (SRY-box9) gene &amp;lt;ref name=&amp;quot;McE&amp;quot; /&amp;gt;. This gene is found in long arm 24.3 of the chromosome 17&amp;lt;ref&amp;gt; NCBI [http://www.ncbi.nlm.nih.gov/gene/6662 NCBI gene: SOX9 SRY-BOX9 Homo sapiens] &amp;lt;/ref&amp;gt; and is implicated in the stimulation of the differentiation of pre-Sertori into Sertoli cells rather than granulosa cells.&lt;br /&gt;
&lt;br /&gt;
The activation of &#039;&#039;SOX&#039;&#039;9 is done by the SRY protein and another transcriptional factor: SF1 (steroidogenic factor 1). These transcriptional factors are bound on an enhancer called: TESCO (Testis-Specific Enhancer of &#039;&#039;SOX9&#039;&#039; core element). The binding of a transcriptional factor on an enhancer provokes a curvature of the DNA (≈75°), allowing a stabilization of the elongation complex on the &#039;&#039;SOX9&#039;&#039; promoter. The SOX9 protein activates the gene &#039;&#039;AMH&#039;&#039; (Anti-Mullerian Hormone)&amp;lt;ref&amp;gt;[http://www.ebi.ac.uk/interpro/entry/IPR006799?q=AMH EBI-Interpro: Anti-Mullerian-Hormon, N-term] &amp;lt;/ref&amp;gt;. Therefore, it allows the degeneration of the channels of Müller in male&amp;lt;ref name=&amp;quot;Harley&amp;quot; /&amp;gt;.&lt;br /&gt;
===Cathecolamines regulation===&lt;br /&gt;
&lt;br /&gt;
It has been shown that SRY is present in brain regions and activates the Tyrosine-3-Hydroxylase expression. This enzyme catalyses the rate-limiting step of catecholamine synthesis (L-Tyrosine to L-DOPA). Furthermore, SRY also activates the expression of Monoamine Oxidase A which is responsible for the inactivation of catecholamines. Therefore, it regulates both positively and negatively the catecholamines concentration&amp;lt;ref name=&amp;quot;Veitia&amp;quot;&amp;gt;PMID: 24604382&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Other extra-testicular effects===&lt;br /&gt;
&lt;br /&gt;
Some knock-down experiments have shown that SRY may also be a major actor in the dopamine pathway. On the peripheral side, it seems to regulate noradrenaline levels and blood pressure&amp;lt;ref name=&amp;quot;Veitia&amp;quot; /&amp;gt;. A researcher who contributed to discovering these effects says it might explain why &amp;quot;the aggressive fight-or-flight reaction is more dominant in men, while women predominantly adopt a less aggressive tend-and-befriend response&amp;quot;&amp;lt;ref&amp;gt;Cohen, Tamara. The &#039;macho&#039; gene that makes men behave aggressively has been found. The Daily Mail (2012). [http://www.dailymail.co.uk/sciencetech/article-2111668/The-macho-gene-makes-men-aggressive-found.html#ixzz3yZC2BV4k]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
It has been shown that SRY may be involved in the regulation of the renin-angiotensin system in mice. Indeed, sequence mutations of the protein lead to hypertension. Because the human&#039;s SRY organisation is very closed to the mouse&#039;s, it has been proposed that SRY may have the same function in humans but it has not been studied directly&amp;lt;ref&amp;gt;PMID:22315667&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
== Diseases==&lt;br /&gt;
&lt;br /&gt;
=== Swyer syndrome (AKA XY gonadal dysgenis) :===&lt;br /&gt;
&lt;br /&gt;
If the TDF protein is not able to bind its targeted DNA sequences, the genes responsible for the testis development are not expressed. The patient owning this defective protein will then develop female characters, even though he has a XY karyotype. This phenomenon is known as the &amp;quot;Swyer Syndrome&amp;quot;. &lt;br /&gt;
Different causes can explain this &amp;quot;XY gonadal dysgenis&amp;quot;, as it is also called. About thirty mutations (named [http://www.uniprot.org/uniprot/Q05066#sequences &amp;quot;SRXY1&amp;quot;]) in the SRY gene have been shown to drive this phenotype development. It can also be due to crossovers during a meiosis. If a Y chromosome portion carrying the SRY gene is recombined into a X chromosome, a sperm cell will get this abnormal Y chromosome. If it then fecundates, a XY karyotype without any SRY gene will be formed. &lt;br /&gt;
&lt;br /&gt;
=== De La Chapelle syndrome (AKA XX male syndrome) :===&lt;br /&gt;
&lt;br /&gt;
From the meiosis just described would also result an abnormal X chromosome, carrying the SRY gene. If the sperm cell owning this chromosome fecundates an ovule, the resulting newborn will have a XX karyotype but a male phenotype. This is called the &amp;quot;De La Chapelle syndrome&amp;quot;. In this case, the patient can either develop testis or both testis and ovarian tissues. As some epigenetic mechanisms can inactivate the X chromosome carrying SRY, this syndrome keeps most of the patients sterile&amp;lt;ref&amp;gt;PMID: 4622299&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Hepatocellular carcinoma===&lt;br /&gt;
 &lt;br /&gt;
In the case on a hepatocellular carcinoma, it has been proved that high expression levels of SRY help cancer progression and poor patient survival. However, it still seems that hepatocellular carcinoma is not most likely to develop in men&amp;lt;ref&amp;gt;PMID: 25274159&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
== Structural highlights ==&lt;br /&gt;
&lt;br /&gt;
This is a sample scene created with SAT to &amp;lt;scene name=&amp;quot;/12/3456/Sample/1&amp;quot;&amp;gt;color&amp;lt;/scene&amp;gt; by Group, and another to make &amp;lt;scene name=&amp;quot;/12/3456/Sample/2&amp;quot;&amp;gt;a transparent representation&amp;lt;/scene&amp;gt; of the protein. You can make your own scenes on SAT starting from scratch or loading and editing one of these sample scenes.&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_1/3&#039;&amp;gt;Helix 1&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_2/2&#039;&amp;gt;Helix 2&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_3/1&#039;&amp;gt;Helix 3&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Long_arm_28a/1&#039;&amp;gt;Long arm (28A)&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Short_arm_22a/1&#039;&amp;gt;Short arm (22A)&amp;lt;/scene&amp;gt;&lt;br /&gt;
&amp;lt;/StructureSection&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== References ==&lt;br /&gt;
&amp;lt;references/&amp;gt;&lt;/div&gt;</summary>
		<author><name>Fantin Mesny</name></author>
	</entry>
	<entry>
		<id>https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2526324</id>
		<title>Sandbox Reserved 1120</title>
		<link rel="alternate" type="text/html" href="https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2526324"/>
		<updated>2016-01-30T14:49:23Z</updated>

		<summary type="html">&lt;p&gt;Fantin Mesny: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;StructureSection load=&#039;1hry&#039; size=&#039;340&#039; frame=&#039;true&#039; side=&#039;right&#039; caption=&#039;The SRY protein linked to DNA&#039; scene=&#039;71/719861/Base/1&#039;&amp;gt;&lt;br /&gt;
{{Sandbox_Reserved_ESBS_2015}}&amp;lt;!-- PLEASE ADD YOUR CONTENT BELOW HERE --&amp;gt;&lt;br /&gt;
=SRY protein (AKA TDF protein)=&lt;br /&gt;
{{SRY protein (AKA TDF protein)}}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td colspan=&#039;2&#039;&amp;gt;The SRY protein is a 204 residues-long monomeric polypeptide. It is encoded by the SRY gene and is involved in the sex determination in mammals by being responsible for the gonadogenesis and so the male sexual development. It is the HMG-box that gives to the protein its ability to bind DNA by its minor groove&amp;lt;ref name =&amp;quot;Tang&amp;quot;&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;.&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr id=&#039;related&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;[[Related_structure|Related:]]&amp;lt;/b&amp;gt;&amp;lt;/td&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;[[1hrz|1hrz]]&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr id=&#039;resources&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Resources:&amp;lt;/b&amp;gt;&amp;lt;/td&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;&amp;lt;span class=&#039;plainlinks&#039;&amp;gt;[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=1hry FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=1hry OCA], [http://pdbe.org/1hry PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=1hry RCSB], [http://www.ebi.ac.uk/pdbsum/1hry PDBsum]&lt;br /&gt;
&amp;lt;tr id=&#039;Gene&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Encoded by&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;The SRY gene codes for the SRY protein&lt;br /&gt;
&amp;lt;tr id=&#039;Length&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Length&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;204 residues&lt;br /&gt;
&amp;lt;tr id=&#039;Molecular weight&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Molecular weight&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;≈23kDa&lt;br /&gt;
&amp;lt;tr id=&#039;DNA target sequence&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;DNA target sequence&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;(5&#039;-dGCACAAAC)&lt;br /&gt;
&amp;lt;tr id=&#039;Regulation&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Regulation&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;[https://en.wikipedia.org/wiki/Steroidogenic_factor_1 Sf1];[https://en.wikipedia.org/wiki/Sp1_transcription_factor Sp1] (binding site in the promoter of SRY : -150),[https://en.wikipedia.org/wiki/WT1 WT1] (binding site in the promoter of SRY : -87)&lt;br /&gt;
&amp;lt;tr id=&#039;Role&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Role&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;Transcription factor&lt;br /&gt;
&amp;lt;tr id=&#039;Genes targeted&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Genes targeted&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;SOX9&lt;br /&gt;
&lt;br /&gt;
&amp;lt;/span&amp;gt;&lt;br /&gt;
&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;/table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==History==&lt;br /&gt;
&lt;br /&gt;
After centuries of unfounded theories mainly based on environmental factors, the first molecular theory concerning the sex determination appeared in 1891. At this time, the german biologist Hermann Henking was studying sperm formation in wasps. As a chromosome which was not present in all the wasps looked different from the others, he suspected it to play a role in sex determination and called it the &amp;quot;X chromosome&amp;quot;.&lt;br /&gt;
Ten years later, Clarence Erwin McClung saw that this chromosome behaved differently during the meiosis and was only present in half the sperm cells of grasshoppers. As the main characteristic that varies in 50/50 proportions among zygotes is the sex, McClung suspected the X chromosome to be implicated in sexual development. &lt;br /&gt;
In 1905, Nettie Stevens discovered the &amp;quot;Y chromosome&amp;quot; (and the female XX and male XY patterns) while she was counting the chromosomes of beetles under the microscope&amp;lt;ref&amp;gt;Sumner, A. T. Sex Chromosomes and Sex Determination. Chromosomes: Organization and Function, 97-108. [http://www.nature.com/scitable/nated/topicpage/Sex-Chromosomes-and-Sex-Determination-44565]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
During the next decades, a few theories were in competition. In 1921, Calvin Bridges&#039;s works on &#039;&#039;Drosophila melanogaster&#039;&#039; seemed to reveal that male characters acquisition is due to a genic balance between the genes contained in the X chromosome and those contained in the autosomes&amp;lt;ref&amp;gt;PMID: 17769897&amp;lt;/ref&amp;gt;.&lt;br /&gt;
In 1930, Ronald Fisher introduced the first Y-based control of sex theory by proposing two different models : either all the genes responsible for the male characters are located on the Y chromosome or there is a Y-located gene which regulates the expression of genes elsewhere in the genome&amp;lt;ref name=&amp;quot;Goodfellow&amp;quot;&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt;.&lt;br /&gt;
As Alfred Jost had shown the testosterone produced by the testis is responsible for the entire male phenotype acquisition&amp;lt;ref&amp;gt;PMID: 4805859&amp;lt;/ref&amp;gt;, Peter Neville Goodfellow proposed in 1988, that there is a gene (&#039;&#039;TDF&#039;&#039; in human, &#039;&#039;Tdy&#039;&#039; in mice)  on the Y chromosome which drives the development of the testis&amp;lt;ref name=&amp;quot;Goodfellow&amp;quot; /&amp;gt;. In 1990, Goodfellow&#039;s hypothesis was validated with the discovery of &#039;&#039;Tdy&#039;&#039;&#039;s localisation. This gene&#039;s product (expressed during the male gonadal development) owns an amino-acid motif which shows homology to other known or putative DNA-binding domains. &#039;&#039;Tdy&#039;&#039; is therefore a transcriptional factor&amp;lt;ref&amp;gt;PMID: 2374589&amp;lt;/ref&amp;gt;. The same year, the human &#039;&#039;SRY&#039;&#039; gene (accepted later as the &#039;&#039;TDF&#039;&#039;) was discovered&amp;lt;ref&amp;gt;PMID: 1695712&amp;lt;/ref&amp;gt;. &lt;br /&gt;
Three dimensional structure of the SRY protein was determined in 1995 using NMR spectroscopy&amp;lt;ref&amp;gt;PMID:7774012&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
==SRY gene==&lt;br /&gt;
&lt;br /&gt;
The SRY gene encodes the SRY protein. The SRY protein is a transcriptional factor that induces the male phenotype in the embryo. The SRY gene is located on the [https://en.wikipedia.org/wiki/Y_chromosome Y chromosome] in the short arm (p) 11.3 &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/gene/6736 NCBI gene]&amp;lt;/ref&amp;gt;. This gene has only one exon that contains the HMG domain (DNA-binding High-Mobility Group box domain). It means that SRY mRNA does not have an alternative splicing, so there is only one isoforme of SRY protein&amp;lt;ref name=&amp;quot;McE&amp;quot;&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;. Moreover, the human genome contains only one copy of the SRY gene, whereas the mouse genome contains 6 copy of this gene&amp;lt;ref&amp;gt; Sekido R, Lovell-Badge R. Genetic control of testis development. Sex Dev Genet Mol Biol Evol Endocrinol Embryol Pathol Sex Determ Differ. 2013;7(1-3):21–32 &amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Sequence of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:90%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
&amp;gt;gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/nuccore NCBI nucleotide]&amp;lt;/ref&amp;gt;&lt;br /&gt;
TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT&lt;br /&gt;
TTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACA&lt;br /&gt;
&amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;ATG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;CAATCATATGCTTCTGCTATGTTAAGCGTATTCAACAGCGATGATTACAGTCCAGCTGTGCAAGAGAAT&lt;br /&gt;
ATTCCCGCTCTCCGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTAAGTATCAGTGTGAAA&lt;br /&gt;
CGGGAGAAAACAGTAAAGGCAACGTCCAGGATAGAGTGAAGCGACCCATGAACGCATTCATCGTGTGGTC&lt;br /&gt;
&#039;&#039;&#039;TCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCAGAGATCAGCAAGCAGCTG&lt;br /&gt;
&#039;&#039;&#039;GGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCATTCTTCCAGGAGGCACAGAAATTACAGG&lt;br /&gt;
&#039;&#039;&#039;CCATGCACAGAGAGAAATACCCGAATTATAAGTATCGA&#039;&#039;&#039;CCTCGTCGGAAGGCGAAGATGCTGCCGAAGAA&lt;br /&gt;
TTGCAGTTTGCTTCCCGCAGATCCCGCTTCGGTACTCTGCAGCGAAGTGCAACTGGACAACAGGTTGTAC&lt;br /&gt;
AGGGATGACTGTACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAACG&lt;br /&gt;
CAGCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTG&amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;TAG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;GACAATCGGGTAACATT&lt;br /&gt;
GGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCACTTTCTTATGTTTAGTTT&lt;br /&gt;
CAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCATTTCA&amp;lt;/small&amp;gt;&lt;br /&gt;
&lt;br /&gt;
(Legend : &amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Initiation codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt; ; &amp;lt;b&amp;gt;HMG sequence&amp;lt;/b&amp;gt; ; &amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Stop codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;)&lt;br /&gt;
&amp;lt;/div&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Regulation of the expression of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
In humans, the SRY promoter is located between −408 and −95 bp. Moreover, the SRY gene has enhancers at -727 pb. The linkage between regulatory proteins and these enhancers has the property to increase the production of SRY proteins. These regulatory proteins could be: SF1 (steroidogenic factor 1), SP1  and WT 1 (Wilms tumor)&amp;lt;ref name=&amp;quot;Harley&amp;quot;&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;SF1&#039;&#039;&#039;: this transcriptional factor belongs to the family of nuclear hormone receptors and contains a zinc finger. The activation of this protein requires a ligand (hormone).&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;SP1&#039;&#039;&#039;: this transcriptional factor is an ubiquitous protein which binds rich GC-sites and is implicated in the transcription of many genes. Moreover, this protein contains a zinc finger.&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;WT1&#039;&#039;&#039; :this transcriptional factor transactivates the SRY gene. It contains a zinc finger&amp;lt;ref&amp;gt;Larney C, Bailey TL, Koopman P. Switching on sex: transcriptional regulation of the testis-determining gene Sry. Dev Camb Engl. 2014 Jun;141(11):2195–205&amp;lt;/ref&amp;gt;. &lt;br /&gt;
&lt;br /&gt;
==Structure==&lt;br /&gt;
&lt;br /&gt;
===The SRY-HMG domain (HMG-Box)===&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;&#039;SRY-HMG&#039;&#039;&#039; stands for &#039;&#039;&#039;S&#039;&#039;&#039;ex determining &#039;&#039;&#039;R&#039;&#039;&#039;egion &#039;&#039;&#039;Y&#039;&#039;&#039; - &#039;&#039;&#039;H&#039;&#039;&#039;igh &#039;&#039;&#039;M&#039;&#039;&#039;obility &#039;&#039;&#039;G&#039;&#039;&#039;roup domain.&lt;br /&gt;
It is approximately 80 residues-long. It mediates the binding of the protein to the minor groove of DNA. It is the most important part of the SRY protein. Not only because it enables  the protein to bind the DNA but also because even a single mutation can cause an inactivation of the protein.&lt;br /&gt;
&lt;br /&gt;
It has a twisted L shape: it has a long (28Å) and a short (22Å) arm. The HMG Box is made of 3 helices. Its N-term and C-term domains are irregular. The overall structure is stabilized by a hydrophobic core especially at the intersection of the 3 helices where 3 aromatics cycles meet, surrounded by aliphatic aminoacids.&lt;br /&gt;
See the different structures:&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_1/3&#039;&amp;gt;Helix 1&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_2/2&#039;&amp;gt;Helix 2&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_3/1&#039;&amp;gt;Helix 3&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Long_arm_28a/1&#039;&amp;gt;Long arm (28Å)&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Short_arm_22a/1&#039;&amp;gt;Short arm (22Å)&amp;lt;/scene&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The interaction between the HMG-Box and DNA is specific and stable.  It is mostly hydrophobic. It permits the DNA to bend of DNA (≈75°). Only one molecule of water interfaces the Box and the DNA. The complex is stabilized by salt bridges between positively charged residues of the HMG domain and negatively charged phosphates&amp;lt;ref name=&amp;quot;Tang&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
[[Image:HHMG-bitmap.png|thumb|alt=Image bitmap|Linear structure of hHMG domain]]&lt;br /&gt;
&lt;br /&gt;
The binding of SRY on DNA is specific. The DNA target site is a DNA octamer :&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:30%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
(5&#039;-dGCACAAAC)&amp;lt;br/&amp;gt;&lt;br /&gt;
(5&#039;-dGTTTGTGC)&lt;br /&gt;
&amp;lt;/small&amp;gt;&amp;lt;/div&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
This sequence is found in the promoters of genes expressed during the testicular development.&lt;br /&gt;
The bend of DNA enables the recruitment of different proteins and the building of massive proteins-DNA complexes that could change the expression of different genes&amp;lt;ref&amp;gt;PMID:11563911&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
Even if the most important function of the HMG box is binding and bending DNA, it is also involved in DNA condensation, recombination and repair.&lt;br /&gt;
&lt;br /&gt;
There are two kinds of proteins that contain a HMG box:&lt;br /&gt;
* &#039;&#039;&#039;HMG1&#039;&#039;&#039; : It is expressed in few cell types. It is found in transcription factors that contain a single HMG box. The binding of a DNA sequence is specific.&lt;br /&gt;
* &#039;&#039;&#039;HMG2&#039;&#039;&#039; : It is found in all cell types and is abundant in chromatin. These proteins can contain two or more HMG boxes that can non-specifically bind DNA. &lt;br /&gt;
&lt;br /&gt;
===General structure of SRY===&lt;br /&gt;
&lt;br /&gt;
The overall structure of SRY is organized around the HMG-box.&lt;br /&gt;
3 domains:&lt;br /&gt;
* N-term domain&lt;br /&gt;
* Central domain : DNA binding (HMG box)&lt;br /&gt;
* C-term domain&lt;br /&gt;
&lt;br /&gt;
== Function ==&lt;br /&gt;
&lt;br /&gt;
===Sex determining===&lt;br /&gt;
&lt;br /&gt;
It acts like a sex determining factor thanks to its transcriptional activity. It inhibits the development of female sex structures in the embryonic individual.&lt;br /&gt;
&lt;br /&gt;
The SRY protein contains nuclear localization signals in N and C terminals. An acetylation of these domains allows the exportation of the SRY protein to the nucleus&amp;lt;ref name=&amp;quot;Harley&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
The SRY protein activates the &#039;&#039;SOX9&#039;&#039; (SRY-box9) gene &amp;lt;ref name=&amp;quot;McE&amp;quot; /&amp;gt;. This gene is found in long arm 24.3 of the chromosome 17&amp;lt;ref&amp;gt; NCBI [http://www.ncbi.nlm.nih.gov/gene/6662 NCBI gene: SOX9 SRY-BOX9 Homo sapiens] &amp;lt;/ref&amp;gt; and is implicated in the stimulation of the differentiation of pre-Sertori into Sertoli cells rather than granulosa cells.&lt;br /&gt;
&lt;br /&gt;
The activation of &#039;&#039;SOX&#039;&#039;9 is done by the SRY protein and another transcriptional factor: SF1 (steroidogenic factor 1). These transcriptional factors are bound on an enhancer called: TESCO (Testis-Specific Enhancer of &#039;&#039;SOX9&#039;&#039; core element). The binding of a transcriptional factor on an enhancer provokes a curvature of the DNA (≈75°), allowing a stabilization of the elongation complex on the &#039;&#039;SOX9&#039;&#039; promoter. The SOX9 protein activates the gene &#039;&#039;AMH&#039;&#039; (Anti-Mullerian Hormone)&amp;lt;ref&amp;gt;[http://www.ebi.ac.uk/interpro/entry/IPR006799?q=AMH EBI-Interpro: Anti-Mullerian-Hormon, N-term] &amp;lt;/ref&amp;gt;. Therefore, it allows the degeneration of the channels of Müller in male&amp;lt;ref name=&amp;quot;Harley&amp;quot; /&amp;gt;.&lt;br /&gt;
===Cathecolamines regulation===&lt;br /&gt;
&lt;br /&gt;
It has been shown that SRY is present in brain regions and activates the Tyrosine-3-Hydroxylase expression. This enzyme catalyses the rate-limiting step of catecholamine synthesis (L-Tyrosine to L-DOPA). Furthermore, SRY also activates the expression of Monoamine Oxidase A which is responsible for the inactivation of catecholamines. Therefore, it regulates both positively and negatively the catecholamines concentration&amp;lt;ref name=&amp;quot;Veitia&amp;quot;&amp;gt;PMID: 24604382&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Other extra-testicular effects===&lt;br /&gt;
&lt;br /&gt;
Some knock-down experiments have shown that SRY may also be a major actor in the dopamine pathway. On the peripheral side, it seems to regulate noradrenaline levels and blood pressure&amp;lt;ref name=&amp;quot;Veitia&amp;quot; /&amp;gt;. A researcher who contributed to discovering these effects says it might explain why &amp;quot;the aggressive fight-or-flight reaction is more dominant in men, while women predominantly adopt a less aggressive tend-and-befriend response&amp;quot;&amp;lt;ref&amp;gt;Cohen, Tamara. The &#039;macho&#039; gene that makes men behave aggressively has been found. The Daily Mail (2012). [http://www.dailymail.co.uk/sciencetech/article-2111668/The-macho-gene-makes-men-aggressive-found.html#ixzz3yZC2BV4k]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
It has been shown that SRY may be involved in the regulation of the renin-angiotensin system in mice. Indeed, sequence mutations of the protein lead to hypertension. Because the human&#039;s SRY organisation is very closed to the mouse&#039;s, it has been proposed that SRY may have the same function in humans but it has not been studied directly&amp;lt;ref&amp;gt;PMID:22315667&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
== Diseases==&lt;br /&gt;
&lt;br /&gt;
=== Swyer syndrome (AKA XY gonadal dysgenis) :===&lt;br /&gt;
&lt;br /&gt;
If the TDF protein is not able to bind its targeted DNA sequences, the genes responsible for the testis development are not expressed. The patient owning this defective protein will then develop female characters, even though he has a XY karyotype. This phenomenon is known as the &amp;quot;Swyer Syndrome&amp;quot;. &lt;br /&gt;
Different causes can explain this &amp;quot;XY gonadal dysgenis&amp;quot;, as it is also called. About thirty mutations (named [http://www.uniprot.org/uniprot/Q05066#sequences &amp;quot;SRXY1&amp;quot;]) in the SRY gene have been shown to drive this phenotype development. It can also be due to crossovers during a meiosis. If a Y chromosome portion carrying the SRY gene is recombined into a X chromosome, a sperm cell will get this abnormal Y chromosome. If it then fecundates, a XY karyotype without any SRY gene will be formed. &lt;br /&gt;
&lt;br /&gt;
=== De La Chapelle syndrome (AKA XX male syndrome) :===&lt;br /&gt;
&lt;br /&gt;
From the meiosis just described would also result an abnormal X chromosome, carrying the SRY gene. If the sperm cell owning this chromosome fecundates an ovule, the resulting newborn will have a XX karyotype but a male phenotype. This is called the &amp;quot;De La Chapelle syndrome&amp;quot;. In this case, the patient can either develop testis or both testis and ovarian tissues. As some epigenetic mechanisms can inactivate the X chromosome carrying SRY, this syndrome keeps most of the patients sterile&amp;lt;ref&amp;gt;PMID: 4622299&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Hepatocellular carcinoma===&lt;br /&gt;
 &lt;br /&gt;
In the case on a hepatocellular carcinoma, it has been proved that high expression levels of SRY help cancer progression and poor patient survival. However, it still seems that hepatocellular carcinoma is not most likely to develop in men&amp;lt;ref&amp;gt;PMID: 25274159&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
== Structural highlights ==&lt;br /&gt;
&lt;br /&gt;
This is a sample scene created with SAT to &amp;lt;scene name=&amp;quot;/12/3456/Sample/1&amp;quot;&amp;gt;color&amp;lt;/scene&amp;gt; by Group, and another to make &amp;lt;scene name=&amp;quot;/12/3456/Sample/2&amp;quot;&amp;gt;a transparent representation&amp;lt;/scene&amp;gt; of the protein. You can make your own scenes on SAT starting from scratch or loading and editing one of these sample scenes.&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_1/3&#039;&amp;gt;Helix 1&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_2/2&#039;&amp;gt;Helix 2&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_3/1&#039;&amp;gt;Helix 3&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Long_arm_28a/1&#039;&amp;gt;Long arm (28A)&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Short_arm_22a/1&#039;&amp;gt;Short arm (22A)&amp;lt;/scene&amp;gt;&lt;br /&gt;
&amp;lt;/StructureSection&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== References ==&lt;br /&gt;
&amp;lt;references/&amp;gt;&lt;/div&gt;</summary>
		<author><name>Fantin Mesny</name></author>
	</entry>
	<entry>
		<id>https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2526318</id>
		<title>Sandbox Reserved 1120</title>
		<link rel="alternate" type="text/html" href="https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2526318"/>
		<updated>2016-01-30T14:47:15Z</updated>

		<summary type="html">&lt;p&gt;Fantin Mesny: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{Sandbox_Reserved_ESBS_2015}}&amp;lt;!-- PLEASE ADD YOUR CONTENT BELOW HERE --&amp;gt;&lt;br /&gt;
=SRY protein (AKA TDF protein)=&lt;br /&gt;
&amp;lt;StructureSection load=&#039;1hry&#039; size=&#039;340&#039; frame=&#039;true&#039; side=&#039;right&#039; caption=&#039;The SRY protein linked to DNA&#039; scene=&#039;71/719861/Base/1&#039;&amp;gt;&lt;br /&gt;
{{SRY protein (AKA TDF protein)}}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td colspan=&#039;2&#039;&amp;gt;The SRY protein is a 204 residues-long monomeric polypeptide. It is encoded by the SRY gene and is involved in the sex determination in mammals by being responsible for the gonadogenesis and so the male sexual development. It is the HMG-box that gives to the protein its ability to bind DNA by its minor groove&amp;lt;ref name =&amp;quot;Tang&amp;quot;&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;.&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr id=&#039;related&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;[[Related_structure|Related:]]&amp;lt;/b&amp;gt;&amp;lt;/td&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;[[1hrz|1hrz]]&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr id=&#039;resources&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Resources:&amp;lt;/b&amp;gt;&amp;lt;/td&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;&amp;lt;span class=&#039;plainlinks&#039;&amp;gt;[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=1hry FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=1hry OCA], [http://pdbe.org/1hry PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=1hry RCSB], [http://www.ebi.ac.uk/pdbsum/1hry PDBsum]&lt;br /&gt;
&amp;lt;tr id=&#039;Gene&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Encoded by&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;The SRY gene codes for the SRY protein&lt;br /&gt;
&amp;lt;tr id=&#039;Length&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Length&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;204 residues&lt;br /&gt;
&amp;lt;tr id=&#039;Molecular weight&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Molecular weight&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;≈23kDa&lt;br /&gt;
&amp;lt;tr id=&#039;DNA target sequence&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;DNA target sequence&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;(5&#039;-dGCACAAAC)&lt;br /&gt;
&amp;lt;tr id=&#039;Regulation&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Regulation&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;[https://en.wikipedia.org/wiki/Steroidogenic_factor_1 Sf1];[https://en.wikipedia.org/wiki/Sp1_transcription_factor Sp1] (binding site in the promoter of SRY : -150),[https://en.wikipedia.org/wiki/WT1 WT1] (binding site in the promoter of SRY : -87)&lt;br /&gt;
&amp;lt;tr id=&#039;Role&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Role&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;Transcription factor&lt;br /&gt;
&amp;lt;tr id=&#039;Genes targeted&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Genes targeted&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;SOX9&lt;br /&gt;
&lt;br /&gt;
&amp;lt;/span&amp;gt;&lt;br /&gt;
&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;/table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==History==&lt;br /&gt;
&lt;br /&gt;
After centuries of unfounded theories mainly based on environmental factors, the first molecular theory concerning the sex determination appeared in 1891. At this time, the german biologist Hermann Henking was studying sperm formation in wasps. As a chromosome which was not present in all the wasps looked different from the others, he suspected it to play a role in sex determination and called it the &amp;quot;X chromosome&amp;quot;.&lt;br /&gt;
Ten years later, Clarence Erwin McClung saw that this chromosome behaved differently during the meiosis and was only present in half the sperm cells of grasshoppers. As the main characteristic that varies in 50/50 proportions among zygotes is the sex, McClung suspected the X chromosome to be implicated in sexual development. &lt;br /&gt;
In 1905, Nettie Stevens discovered the &amp;quot;Y chromosome&amp;quot; (and the female XX and male XY patterns) while she was counting the chromosomes of beetles under the microscope&amp;lt;ref&amp;gt;Sumner, A. T. Sex Chromosomes and Sex Determination. Chromosomes: Organization and Function, 97-108. [http://www.nature.com/scitable/nated/topicpage/Sex-Chromosomes-and-Sex-Determination-44565]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
During the next decades, a few theories were in competition. In 1921, Calvin Bridges&#039;s works on &#039;&#039;Drosophila melanogaster&#039;&#039; seemed to reveal that male characters acquisition is due to a genic balance between the genes contained in the X chromosome and those contained in the autosomes&amp;lt;ref&amp;gt;PMID: 17769897&amp;lt;/ref&amp;gt;.&lt;br /&gt;
In 1930, Ronald Fisher introduced the first Y-based control of sex theory by proposing two different models : either all the genes responsible for the male characters are located on the Y chromosome or there is a Y-located gene which regulates the expression of genes elsewhere in the genome&amp;lt;ref name=&amp;quot;Goodfellow&amp;quot;&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt;.&lt;br /&gt;
As Alfred Jost had shown the testosterone produced by the testis is responsible for the entire male phenotype acquisition&amp;lt;ref&amp;gt;PMID: 4805859&amp;lt;/ref&amp;gt;, Peter Neville Goodfellow proposed in 1988, that there is a gene (&#039;&#039;TDF&#039;&#039; in human, &#039;&#039;Tdy&#039;&#039; in mice)  on the Y chromosome which drives the development of the testis&amp;lt;ref name=&amp;quot;Goodfellow&amp;quot; /&amp;gt;. In 1990, Goodfellow&#039;s hypothesis was validated with the discovery of &#039;&#039;Tdy&#039;&#039;&#039;s localisation. This gene&#039;s product (expressed during the male gonadal development) owns an amino-acid motif which shows homology to other known or putative DNA-binding domains. &#039;&#039;Tdy&#039;&#039; is therefore a transcriptional factor&amp;lt;ref&amp;gt;PMID: 2374589&amp;lt;/ref&amp;gt;. The same year, the human &#039;&#039;SRY&#039;&#039; gene (accepted later as the &#039;&#039;TDF&#039;&#039;) was discovered&amp;lt;ref&amp;gt;PMID: 1695712&amp;lt;/ref&amp;gt;. &lt;br /&gt;
Three dimensional structure of the SRY protein was determined in 1995 using NMR spectroscopy&amp;lt;ref&amp;gt;PMID:7774012&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
==SRY gene==&lt;br /&gt;
&lt;br /&gt;
The SRY gene encodes the SRY protein. The SRY protein is a transcriptional factor that induces the male phenotype in the embryo. The SRY gene is located on the [https://en.wikipedia.org/wiki/Y_chromosome Y chromosome] in the short arm (p) 11.3 &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/gene/6736 NCBI gene]&amp;lt;/ref&amp;gt;. This gene has only one exon that contains the HMG domain (DNA-binding High-Mobility Group box domain). It means that SRY mRNA does not have an alternative splicing, so there is only one isoforme of SRY protein&amp;lt;ref name=&amp;quot;McE&amp;quot;&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;. Moreover, the human genome contains only one copy of the SRY gene, whereas the mouse genome contains 6 copy of this gene&amp;lt;ref&amp;gt; Sekido R, Lovell-Badge R. Genetic control of testis development. Sex Dev Genet Mol Biol Evol Endocrinol Embryol Pathol Sex Determ Differ. 2013;7(1-3):21–32 &amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Sequence of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:90%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
&amp;gt;gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/nuccore NCBI nucleotide]&amp;lt;/ref&amp;gt;&lt;br /&gt;
TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT&lt;br /&gt;
TTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACA&lt;br /&gt;
&amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;ATG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;CAATCATATGCTTCTGCTATGTTAAGCGTATTCAACAGCGATGATTACAGTCCAGCTGTGCAAGAGAAT&lt;br /&gt;
ATTCCCGCTCTCCGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTAAGTATCAGTGTGAAA&lt;br /&gt;
CGGGAGAAAACAGTAAAGGCAACGTCCAGGATAGAGTGAAGCGACCCATGAACGCATTCATCGTGTGGTC&lt;br /&gt;
&#039;&#039;&#039;TCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCAGAGATCAGCAAGCAGCTG&lt;br /&gt;
&#039;&#039;&#039;GGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCATTCTTCCAGGAGGCACAGAAATTACAGG&lt;br /&gt;
&#039;&#039;&#039;CCATGCACAGAGAGAAATACCCGAATTATAAGTATCGA&#039;&#039;&#039;CCTCGTCGGAAGGCGAAGATGCTGCCGAAGAA&lt;br /&gt;
TTGCAGTTTGCTTCCCGCAGATCCCGCTTCGGTACTCTGCAGCGAAGTGCAACTGGACAACAGGTTGTAC&lt;br /&gt;
AGGGATGACTGTACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAACG&lt;br /&gt;
CAGCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTG&amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;TAG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;GACAATCGGGTAACATT&lt;br /&gt;
GGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCACTTTCTTATGTTTAGTTT&lt;br /&gt;
CAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCATTTCA&amp;lt;/small&amp;gt;&lt;br /&gt;
&lt;br /&gt;
(Legend : &amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Initiation codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt; ; &amp;lt;b&amp;gt;HMG sequence&amp;lt;/b&amp;gt; ; &amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Stop codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;)&lt;br /&gt;
&amp;lt;/div&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Regulation of the expression of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
In humans, the SRY promoter is located between −408 and −95 bp. Moreover, the SRY gene has enhancers at -727 pb. The linkage between regulatory proteins and these enhancers has the property to increase the production of SRY proteins. These regulatory proteins could be: SF1 (steroidogenic factor 1), SP1  and WT 1 (Wilms tumor)&amp;lt;ref name=&amp;quot;Harley&amp;quot;&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;SF1&#039;&#039;&#039;: this transcriptional factor belongs to the family of nuclear hormone receptors and contains a zinc finger. The activation of this protein requires a ligand (hormone).&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;SP1&#039;&#039;&#039;: this transcriptional factor is an ubiquitous protein which binds rich GC-sites and is implicated in the transcription of many genes. Moreover, this protein contains a zinc finger.&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;WT1&#039;&#039;&#039; :this transcriptional factor transactivates the SRY gene. It contains a zinc finger&amp;lt;ref&amp;gt;Larney C, Bailey TL, Koopman P. Switching on sex: transcriptional regulation of the testis-determining gene Sry. Dev Camb Engl. 2014 Jun;141(11):2195–205&amp;lt;/ref&amp;gt;. &lt;br /&gt;
&lt;br /&gt;
==Structure==&lt;br /&gt;
&lt;br /&gt;
===The SRY-HMG domain (HMG-Box)===&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;&#039;SRY-HMG&#039;&#039;&#039; stands for &#039;&#039;&#039;S&#039;&#039;&#039;ex determining &#039;&#039;&#039;R&#039;&#039;&#039;egion &#039;&#039;&#039;Y&#039;&#039;&#039; - &#039;&#039;&#039;H&#039;&#039;&#039;igh &#039;&#039;&#039;M&#039;&#039;&#039;obility &#039;&#039;&#039;G&#039;&#039;&#039;roup domain.&lt;br /&gt;
It is approximately 80 residues-long. It mediates the binding of the protein to the minor groove of DNA. It is the most important part of the SRY protein. Not only because it enables  the protein to bind the DNA but also because even a single mutation can cause an inactivation of the protein.&lt;br /&gt;
&lt;br /&gt;
It has a twisted L shape: it has a long (28Å) and a short (22Å) arm. The HMG Box is made of 3 helices. Its N-term and C-term domains are irregular. The overall structure is stabilized by a hydrophobic core especially at the intersection of the 3 helices where 3 aromatics cycles meet, surrounded by aliphatic aminoacids.&lt;br /&gt;
See the different structures:&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_1/3&#039;&amp;gt;Helix 1&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_2/2&#039;&amp;gt;Helix 2&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_3/1&#039;&amp;gt;Helix 3&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Long_arm_28a/1&#039;&amp;gt;Long arm (28Å)&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Short_arm_22a/1&#039;&amp;gt;Short arm (22Å)&amp;lt;/scene&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The interaction between the HMG-Box and DNA is specific and stable.  It is mostly hydrophobic. It permits the DNA to bend of DNA (≈75°). Only one molecule of water interfaces the Box and the DNA. The complex is stabilized by salt bridges between positively charged residues of the HMG domain and negatively charged phosphates&amp;lt;ref name=&amp;quot;Tang&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
[[Image:HHMG-bitmap.png|thumb|alt=Image bitmap|Linear structure of hHMG domain]]&lt;br /&gt;
&lt;br /&gt;
The binding of SRY on DNA is specific. The DNA target site is a DNA octamer :&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:30%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
(5&#039;-dGCACAAAC)&amp;lt;br/&amp;gt;&lt;br /&gt;
(5&#039;-dGTTTGTGC)&lt;br /&gt;
&amp;lt;/small&amp;gt;&amp;lt;/div&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
This sequence is found in the promoters of genes expressed during the testicular development.&lt;br /&gt;
The bend of DNA enables the recruitment of different proteins and the building of massive proteins-DNA complexes that could change the expression of different genes&amp;lt;ref&amp;gt;PMID:11563911&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
Even if the most important function of the HMG box is binding and bending DNA, it is also involved in DNA condensation, recombination and repair.&lt;br /&gt;
&lt;br /&gt;
There are two kinds of proteins that contain a HMG box:&lt;br /&gt;
* &#039;&#039;&#039;HMG1&#039;&#039;&#039; : It is expressed in few cell types. It is found in transcription factors that contain a single HMG box. The binding of a DNA sequence is specific.&lt;br /&gt;
* &#039;&#039;&#039;HMG2&#039;&#039;&#039; : It is found in all cell types and is abundant in chromatin. These proteins can contain two or more HMG boxes that can non-specifically bind DNA. &lt;br /&gt;
&lt;br /&gt;
===General structure of SRY===&lt;br /&gt;
&lt;br /&gt;
The overall structure of SRY is organized around the HMG-box.&lt;br /&gt;
3 domains:&lt;br /&gt;
* N-term domain&lt;br /&gt;
* Central domain : DNA binding (HMG box)&lt;br /&gt;
* C-term domain&lt;br /&gt;
&lt;br /&gt;
== Function ==&lt;br /&gt;
&lt;br /&gt;
===Sex determining===&lt;br /&gt;
&lt;br /&gt;
It acts like a sex determining factor thanks to its transcriptional activity. It inhibits the development of female sex structures in the embryonic individual.&lt;br /&gt;
&lt;br /&gt;
The SRY protein contains nuclear localization signals in N and C terminals. An acetylation of these domains allows the exportation of the SRY protein to the nucleus&amp;lt;ref name=&amp;quot;Harley&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
The SRY protein activates the &#039;&#039;SOX9&#039;&#039; (SRY-box9) gene &amp;lt;ref name=&amp;quot;McE&amp;quot; /&amp;gt;. This gene is found in long arm 24.3 of the chromosome 17&amp;lt;ref&amp;gt; NCBI [http://www.ncbi.nlm.nih.gov/gene/6662 NCBI gene: SOX9 SRY-BOX9 Homo sapiens] &amp;lt;/ref&amp;gt; and is implicated in the stimulation of the differentiation of pre-Sertori into Sertoli cells rather than granulosa cells.&lt;br /&gt;
&lt;br /&gt;
The activation of &#039;&#039;SOX&#039;&#039;9 is done by the SRY protein and another transcriptional factor: SF1 (steroidogenic factor 1). These transcriptional factors are bound on an enhancer called: TESCO (Testis-Specific Enhancer of &#039;&#039;SOX9&#039;&#039; core element). The binding of a transcriptional factor on an enhancer provokes a curvature of the DNA (≈75°), allowing a stabilization of the elongation complex on the &#039;&#039;SOX9&#039;&#039; promoter. The SOX9 protein activates the gene &#039;&#039;AMH&#039;&#039; (Anti-Mullerian Hormone)&amp;lt;ref&amp;gt;[http://www.ebi.ac.uk/interpro/entry/IPR006799?q=AMH EBI-Interpro: Anti-Mullerian-Hormon, N-term] &amp;lt;/ref&amp;gt;. Therefore, it allows the degeneration of the channels of Müller in male&amp;lt;ref name=&amp;quot;Harley&amp;quot; /&amp;gt;.&lt;br /&gt;
===Cathecolamines regulation===&lt;br /&gt;
&lt;br /&gt;
It has been shown that SRY is present in brain regions and activates the Tyrosine-3-Hydroxylase expression. This enzyme catalyses the rate-limiting step of catecholamine synthesis (L-Tyrosine to L-DOPA). Furthermore, SRY also activates the expression of Monoamine Oxidase A which is responsible for the inactivation of catecholamines. Therefore, it regulates both positively and negatively the catecholamines concentration&amp;lt;ref name=&amp;quot;Veitia&amp;quot;&amp;gt;PMID: 24604382&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Other extra-testicular effects===&lt;br /&gt;
&lt;br /&gt;
Some knock-down experiments have shown that SRY may also be a major actor in the dopamine pathway. On the peripheral side, it seems to regulate noradrenaline levels and blood pressure&amp;lt;ref name=&amp;quot;Veitia&amp;quot; /&amp;gt;. A researcher who contributed to discovering these effects says it might explain why &amp;quot;the aggressive fight-or-flight reaction is more dominant in men, while women predominantly adopt a less aggressive tend-and-befriend response&amp;quot;&amp;lt;ref&amp;gt;Cohen, Tamara. The &#039;macho&#039; gene that makes men behave aggressively has been found. The Daily Mail (2012). [http://www.dailymail.co.uk/sciencetech/article-2111668/The-macho-gene-makes-men-aggressive-found.html#ixzz3yZC2BV4k]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
It has been shown that SRY may be involved in the regulation of the renin-angiotensin system in mice. Indeed, sequence mutations of the protein lead to hypertension. Because the human&#039;s SRY organisation is very closed to the mouse&#039;s, it has been proposed that SRY may have the same function in humans but it has not been studied directly&amp;lt;ref&amp;gt;PMID:22315667&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
== Diseases==&lt;br /&gt;
&lt;br /&gt;
=== Swyer syndrome (AKA XY gonadal dysgenis) :===&lt;br /&gt;
&lt;br /&gt;
If the TDF protein is not able to bind its targeted DNA sequences, the genes responsible for the testis development are not expressed. The patient owning this defective protein will then develop female characters, even though he has a XY karyotype. This phenomenon is known as the &amp;quot;Swyer Syndrome&amp;quot;. &lt;br /&gt;
Different causes can explain this &amp;quot;XY gonadal dysgenis&amp;quot;, as it is also called. About thirty mutations (named [http://www.uniprot.org/uniprot/Q05066#sequences &amp;quot;SRXY1&amp;quot;]) in the SRY gene have been shown to drive this phenotype development. It can also be due to crossovers during a meiosis. If a Y chromosome portion carrying the SRY gene is recombined into a X chromosome, a sperm cell will get this abnormal Y chromosome. If it then fecundates, a XY karyotype without any SRY gene will be formed. &lt;br /&gt;
&lt;br /&gt;
=== De La Chapelle syndrome (AKA XX male syndrome) :===&lt;br /&gt;
&lt;br /&gt;
From the meiosis just described would also result an abnormal X chromosome, carrying the SRY gene. If the sperm cell owning this chromosome fecundates an ovule, the resulting newborn will have a XX karyotype but a male phenotype. This is called the &amp;quot;De La Chapelle syndrome&amp;quot;. In this case, the patient can either develop testis or both testis and ovarian tissues. As some epigenetic mechanisms can inactivate the X chromosome carrying SRY, this syndrome keeps most of the patients sterile&amp;lt;ref&amp;gt;PMID: 4622299&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Hepatocellular carcinoma===&lt;br /&gt;
 &lt;br /&gt;
In the case on a hepatocellular carcinoma, it has been proved that high expression levels of SRY help cancer progression and poor patient survival. However, it still seems that hepatocellular carcinoma is not most likely to develop in men&amp;lt;ref&amp;gt;PMID: 25274159&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
== Structural highlights ==&lt;br /&gt;
&lt;br /&gt;
This is a sample scene created with SAT to &amp;lt;scene name=&amp;quot;/12/3456/Sample/1&amp;quot;&amp;gt;color&amp;lt;/scene&amp;gt; by Group, and another to make &amp;lt;scene name=&amp;quot;/12/3456/Sample/2&amp;quot;&amp;gt;a transparent representation&amp;lt;/scene&amp;gt; of the protein. You can make your own scenes on SAT starting from scratch or loading and editing one of these sample scenes.&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_1/3&#039;&amp;gt;Helix 1&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_2/2&#039;&amp;gt;Helix 2&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_3/1&#039;&amp;gt;Helix 3&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Long_arm_28a/1&#039;&amp;gt;Long arm (28A)&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Short_arm_22a/1&#039;&amp;gt;Short arm (22A)&amp;lt;/scene&amp;gt;&lt;br /&gt;
&amp;lt;/StructureSection&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== References ==&lt;br /&gt;
&amp;lt;references/&amp;gt;&lt;/div&gt;</summary>
		<author><name>Fantin Mesny</name></author>
	</entry>
	<entry>
		<id>https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2526317</id>
		<title>Sandbox Reserved 1120</title>
		<link rel="alternate" type="text/html" href="https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2526317"/>
		<updated>2016-01-30T14:46:44Z</updated>

		<summary type="html">&lt;p&gt;Fantin Mesny: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{Sandbox_Reserved_ESBS_2015}}&amp;lt;!-- PLEASE ADD YOUR CONTENT BELOW HERE --&amp;gt;&lt;br /&gt;
=SRY protein (AKA TDF protein)=&lt;br /&gt;
&amp;lt;StructureSection load=&#039;1hry&#039; size=&#039;340&#039; frame=&#039;true&#039; align=&#039;right&#039; caption=&#039;The SRY protein linked to DNA&#039; scene=&#039;71/719861/Base/1&#039;&amp;gt;&lt;br /&gt;
{{SRY protein (AKA TDF protein)}}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td colspan=&#039;2&#039;&amp;gt;The SRY protein is a 204 residues-long monomeric polypeptide. It is encoded by the SRY gene and is involved in the sex determination in mammals by being responsible for the gonadogenesis and so the male sexual development. It is the HMG-box that gives to the protein its ability to bind DNA by its minor groove&amp;lt;ref name =&amp;quot;Tang&amp;quot;&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;.&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr id=&#039;related&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;[[Related_structure|Related:]]&amp;lt;/b&amp;gt;&amp;lt;/td&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;[[1hrz|1hrz]]&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr id=&#039;resources&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Resources:&amp;lt;/b&amp;gt;&amp;lt;/td&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;&amp;lt;span class=&#039;plainlinks&#039;&amp;gt;[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=1hry FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=1hry OCA], [http://pdbe.org/1hry PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=1hry RCSB], [http://www.ebi.ac.uk/pdbsum/1hry PDBsum]&lt;br /&gt;
&amp;lt;tr id=&#039;Gene&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Encoded by&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;The SRY gene codes for the SRY protein&lt;br /&gt;
&amp;lt;tr id=&#039;Length&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Length&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;204 residues&lt;br /&gt;
&amp;lt;tr id=&#039;Molecular weight&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Molecular weight&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;≈23kDa&lt;br /&gt;
&amp;lt;tr id=&#039;DNA target sequence&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;DNA target sequence&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;(5&#039;-dGCACAAAC)&lt;br /&gt;
&amp;lt;tr id=&#039;Regulation&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Regulation&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;[https://en.wikipedia.org/wiki/Steroidogenic_factor_1 Sf1];[https://en.wikipedia.org/wiki/Sp1_transcription_factor Sp1] (binding site in the promoter of SRY : -150),[https://en.wikipedia.org/wiki/WT1 WT1] (binding site in the promoter of SRY : -87)&lt;br /&gt;
&amp;lt;tr id=&#039;Role&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Role&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;Transcription factor&lt;br /&gt;
&amp;lt;tr id=&#039;Genes targeted&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Genes targeted&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;SOX9&lt;br /&gt;
&lt;br /&gt;
&amp;lt;/span&amp;gt;&lt;br /&gt;
&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;/table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==History==&lt;br /&gt;
&lt;br /&gt;
After centuries of unfounded theories mainly based on environmental factors, the first molecular theory concerning the sex determination appeared in 1891. At this time, the german biologist Hermann Henking was studying sperm formation in wasps. As a chromosome which was not present in all the wasps looked different from the others, he suspected it to play a role in sex determination and called it the &amp;quot;X chromosome&amp;quot;.&lt;br /&gt;
Ten years later, Clarence Erwin McClung saw that this chromosome behaved differently during the meiosis and was only present in half the sperm cells of grasshoppers. As the main characteristic that varies in 50/50 proportions among zygotes is the sex, McClung suspected the X chromosome to be implicated in sexual development. &lt;br /&gt;
In 1905, Nettie Stevens discovered the &amp;quot;Y chromosome&amp;quot; (and the female XX and male XY patterns) while she was counting the chromosomes of beetles under the microscope&amp;lt;ref&amp;gt;Sumner, A. T. Sex Chromosomes and Sex Determination. Chromosomes: Organization and Function, 97-108. [http://www.nature.com/scitable/nated/topicpage/Sex-Chromosomes-and-Sex-Determination-44565]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
During the next decades, a few theories were in competition. In 1921, Calvin Bridges&#039;s works on &#039;&#039;Drosophila melanogaster&#039;&#039; seemed to reveal that male characters acquisition is due to a genic balance between the genes contained in the X chromosome and those contained in the autosomes&amp;lt;ref&amp;gt;PMID: 17769897&amp;lt;/ref&amp;gt;.&lt;br /&gt;
In 1930, Ronald Fisher introduced the first Y-based control of sex theory by proposing two different models : either all the genes responsible for the male characters are located on the Y chromosome or there is a Y-located gene which regulates the expression of genes elsewhere in the genome&amp;lt;ref name=&amp;quot;Goodfellow&amp;quot;&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt;.&lt;br /&gt;
As Alfred Jost had shown the testosterone produced by the testis is responsible for the entire male phenotype acquisition&amp;lt;ref&amp;gt;PMID: 4805859&amp;lt;/ref&amp;gt;, Peter Neville Goodfellow proposed in 1988, that there is a gene (&#039;&#039;TDF&#039;&#039; in human, &#039;&#039;Tdy&#039;&#039; in mice)  on the Y chromosome which drives the development of the testis&amp;lt;ref name=&amp;quot;Goodfellow&amp;quot; /&amp;gt;. In 1990, Goodfellow&#039;s hypothesis was validated with the discovery of &#039;&#039;Tdy&#039;&#039;&#039;s localisation. This gene&#039;s product (expressed during the male gonadal development) owns an amino-acid motif which shows homology to other known or putative DNA-binding domains. &#039;&#039;Tdy&#039;&#039; is therefore a transcriptional factor&amp;lt;ref&amp;gt;PMID: 2374589&amp;lt;/ref&amp;gt;. The same year, the human &#039;&#039;SRY&#039;&#039; gene (accepted later as the &#039;&#039;TDF&#039;&#039;) was discovered&amp;lt;ref&amp;gt;PMID: 1695712&amp;lt;/ref&amp;gt;. &lt;br /&gt;
Three dimensional structure of the SRY protein was determined in 1995 using NMR spectroscopy&amp;lt;ref&amp;gt;PMID:7774012&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
==SRY gene==&lt;br /&gt;
&lt;br /&gt;
The SRY gene encodes the SRY protein. The SRY protein is a transcriptional factor that induces the male phenotype in the embryo. The SRY gene is located on the [https://en.wikipedia.org/wiki/Y_chromosome Y chromosome] in the short arm (p) 11.3 &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/gene/6736 NCBI gene]&amp;lt;/ref&amp;gt;. This gene has only one exon that contains the HMG domain (DNA-binding High-Mobility Group box domain). It means that SRY mRNA does not have an alternative splicing, so there is only one isoforme of SRY protein&amp;lt;ref name=&amp;quot;McE&amp;quot;&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;. Moreover, the human genome contains only one copy of the SRY gene, whereas the mouse genome contains 6 copy of this gene&amp;lt;ref&amp;gt; Sekido R, Lovell-Badge R. Genetic control of testis development. Sex Dev Genet Mol Biol Evol Endocrinol Embryol Pathol Sex Determ Differ. 2013;7(1-3):21–32 &amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Sequence of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:90%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
&amp;gt;gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/nuccore NCBI nucleotide]&amp;lt;/ref&amp;gt;&lt;br /&gt;
TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT&lt;br /&gt;
TTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACA&lt;br /&gt;
&amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;ATG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;CAATCATATGCTTCTGCTATGTTAAGCGTATTCAACAGCGATGATTACAGTCCAGCTGTGCAAGAGAAT&lt;br /&gt;
ATTCCCGCTCTCCGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTAAGTATCAGTGTGAAA&lt;br /&gt;
CGGGAGAAAACAGTAAAGGCAACGTCCAGGATAGAGTGAAGCGACCCATGAACGCATTCATCGTGTGGTC&lt;br /&gt;
&#039;&#039;&#039;TCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCAGAGATCAGCAAGCAGCTG&lt;br /&gt;
&#039;&#039;&#039;GGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCATTCTTCCAGGAGGCACAGAAATTACAGG&lt;br /&gt;
&#039;&#039;&#039;CCATGCACAGAGAGAAATACCCGAATTATAAGTATCGA&#039;&#039;&#039;CCTCGTCGGAAGGCGAAGATGCTGCCGAAGAA&lt;br /&gt;
TTGCAGTTTGCTTCCCGCAGATCCCGCTTCGGTACTCTGCAGCGAAGTGCAACTGGACAACAGGTTGTAC&lt;br /&gt;
AGGGATGACTGTACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAACG&lt;br /&gt;
CAGCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTG&amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;TAG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;GACAATCGGGTAACATT&lt;br /&gt;
GGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCACTTTCTTATGTTTAGTTT&lt;br /&gt;
CAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCATTTCA&amp;lt;/small&amp;gt;&lt;br /&gt;
&lt;br /&gt;
(Legend : &amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Initiation codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt; ; &amp;lt;b&amp;gt;HMG sequence&amp;lt;/b&amp;gt; ; &amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Stop codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;)&lt;br /&gt;
&amp;lt;/div&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Regulation of the expression of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
In humans, the SRY promoter is located between −408 and −95 bp. Moreover, the SRY gene has enhancers at -727 pb. The linkage between regulatory proteins and these enhancers has the property to increase the production of SRY proteins. These regulatory proteins could be: SF1 (steroidogenic factor 1), SP1  and WT 1 (Wilms tumor)&amp;lt;ref name=&amp;quot;Harley&amp;quot;&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;SF1&#039;&#039;&#039;: this transcriptional factor belongs to the family of nuclear hormone receptors and contains a zinc finger. The activation of this protein requires a ligand (hormone).&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;SP1&#039;&#039;&#039;: this transcriptional factor is an ubiquitous protein which binds rich GC-sites and is implicated in the transcription of many genes. Moreover, this protein contains a zinc finger.&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;WT1&#039;&#039;&#039; :this transcriptional factor transactivates the SRY gene. It contains a zinc finger&amp;lt;ref&amp;gt;Larney C, Bailey TL, Koopman P. Switching on sex: transcriptional regulation of the testis-determining gene Sry. Dev Camb Engl. 2014 Jun;141(11):2195–205&amp;lt;/ref&amp;gt;. &lt;br /&gt;
&lt;br /&gt;
==Structure==&lt;br /&gt;
&lt;br /&gt;
===The SRY-HMG domain (HMG-Box)===&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;&#039;SRY-HMG&#039;&#039;&#039; stands for &#039;&#039;&#039;S&#039;&#039;&#039;ex determining &#039;&#039;&#039;R&#039;&#039;&#039;egion &#039;&#039;&#039;Y&#039;&#039;&#039; - &#039;&#039;&#039;H&#039;&#039;&#039;igh &#039;&#039;&#039;M&#039;&#039;&#039;obility &#039;&#039;&#039;G&#039;&#039;&#039;roup domain.&lt;br /&gt;
It is approximately 80 residues-long. It mediates the binding of the protein to the minor groove of DNA. It is the most important part of the SRY protein. Not only because it enables  the protein to bind the DNA but also because even a single mutation can cause an inactivation of the protein.&lt;br /&gt;
&lt;br /&gt;
It has a twisted L shape: it has a long (28Å) and a short (22Å) arm. The HMG Box is made of 3 helices. Its N-term and C-term domains are irregular. The overall structure is stabilized by a hydrophobic core especially at the intersection of the 3 helices where 3 aromatics cycles meet, surrounded by aliphatic aminoacids.&lt;br /&gt;
See the different structures:&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_1/3&#039;&amp;gt;Helix 1&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_2/2&#039;&amp;gt;Helix 2&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_3/1&#039;&amp;gt;Helix 3&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Long_arm_28a/1&#039;&amp;gt;Long arm (28Å)&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Short_arm_22a/1&#039;&amp;gt;Short arm (22Å)&amp;lt;/scene&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The interaction between the HMG-Box and DNA is specific and stable.  It is mostly hydrophobic. It permits the DNA to bend of DNA (≈75°). Only one molecule of water interfaces the Box and the DNA. The complex is stabilized by salt bridges between positively charged residues of the HMG domain and negatively charged phosphates&amp;lt;ref name=&amp;quot;Tang&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
[[Image:HHMG-bitmap.png|thumb|alt=Image bitmap|Linear structure of hHMG domain]]&lt;br /&gt;
&lt;br /&gt;
The binding of SRY on DNA is specific. The DNA target site is a DNA octamer :&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:30%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
(5&#039;-dGCACAAAC)&amp;lt;br/&amp;gt;&lt;br /&gt;
(5&#039;-dGTTTGTGC)&lt;br /&gt;
&amp;lt;/small&amp;gt;&amp;lt;/div&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
This sequence is found in the promoters of genes expressed during the testicular development.&lt;br /&gt;
The bend of DNA enables the recruitment of different proteins and the building of massive proteins-DNA complexes that could change the expression of different genes&amp;lt;ref&amp;gt;PMID:11563911&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
Even if the most important function of the HMG box is binding and bending DNA, it is also involved in DNA condensation, recombination and repair.&lt;br /&gt;
&lt;br /&gt;
There are two kinds of proteins that contain a HMG box:&lt;br /&gt;
* &#039;&#039;&#039;HMG1&#039;&#039;&#039; : It is expressed in few cell types. It is found in transcription factors that contain a single HMG box. The binding of a DNA sequence is specific.&lt;br /&gt;
* &#039;&#039;&#039;HMG2&#039;&#039;&#039; : It is found in all cell types and is abundant in chromatin. These proteins can contain two or more HMG boxes that can non-specifically bind DNA. &lt;br /&gt;
&lt;br /&gt;
===General structure of SRY===&lt;br /&gt;
&lt;br /&gt;
The overall structure of SRY is organized around the HMG-box.&lt;br /&gt;
3 domains:&lt;br /&gt;
* N-term domain&lt;br /&gt;
* Central domain : DNA binding (HMG box)&lt;br /&gt;
* C-term domain&lt;br /&gt;
&lt;br /&gt;
== Function ==&lt;br /&gt;
&lt;br /&gt;
===Sex determining===&lt;br /&gt;
&lt;br /&gt;
It acts like a sex determining factor thanks to its transcriptional activity. It inhibits the development of female sex structures in the embryonic individual.&lt;br /&gt;
&lt;br /&gt;
The SRY protein contains nuclear localization signals in N and C terminals. An acetylation of these domains allows the exportation of the SRY protein to the nucleus&amp;lt;ref name=&amp;quot;Harley&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
The SRY protein activates the &#039;&#039;SOX9&#039;&#039; (SRY-box9) gene &amp;lt;ref name=&amp;quot;McE&amp;quot; /&amp;gt;. This gene is found in long arm 24.3 of the chromosome 17&amp;lt;ref&amp;gt; NCBI [http://www.ncbi.nlm.nih.gov/gene/6662 NCBI gene: SOX9 SRY-BOX9 Homo sapiens] &amp;lt;/ref&amp;gt; and is implicated in the stimulation of the differentiation of pre-Sertori into Sertoli cells rather than granulosa cells.&lt;br /&gt;
&lt;br /&gt;
The activation of &#039;&#039;SOX&#039;&#039;9 is done by the SRY protein and another transcriptional factor: SF1 (steroidogenic factor 1). These transcriptional factors are bound on an enhancer called: TESCO (Testis-Specific Enhancer of &#039;&#039;SOX9&#039;&#039; core element). The binding of a transcriptional factor on an enhancer provokes a curvature of the DNA (≈75°), allowing a stabilization of the elongation complex on the &#039;&#039;SOX9&#039;&#039; promoter. The SOX9 protein activates the gene &#039;&#039;AMH&#039;&#039; (Anti-Mullerian Hormone)&amp;lt;ref&amp;gt;[http://www.ebi.ac.uk/interpro/entry/IPR006799?q=AMH EBI-Interpro: Anti-Mullerian-Hormon, N-term] &amp;lt;/ref&amp;gt;. Therefore, it allows the degeneration of the channels of Müller in male&amp;lt;ref name=&amp;quot;Harley&amp;quot; /&amp;gt;.&lt;br /&gt;
===Cathecolamines regulation===&lt;br /&gt;
&lt;br /&gt;
It has been shown that SRY is present in brain regions and activates the Tyrosine-3-Hydroxylase expression. This enzyme catalyses the rate-limiting step of catecholamine synthesis (L-Tyrosine to L-DOPA). Furthermore, SRY also activates the expression of Monoamine Oxidase A which is responsible for the inactivation of catecholamines. Therefore, it regulates both positively and negatively the catecholamines concentration&amp;lt;ref name=&amp;quot;Veitia&amp;quot;&amp;gt;PMID: 24604382&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Other extra-testicular effects===&lt;br /&gt;
&lt;br /&gt;
Some knock-down experiments have shown that SRY may also be a major actor in the dopamine pathway. On the peripheral side, it seems to regulate noradrenaline levels and blood pressure&amp;lt;ref name=&amp;quot;Veitia&amp;quot; /&amp;gt;. A researcher who contributed to discovering these effects says it might explain why &amp;quot;the aggressive fight-or-flight reaction is more dominant in men, while women predominantly adopt a less aggressive tend-and-befriend response&amp;quot;&amp;lt;ref&amp;gt;Cohen, Tamara. The &#039;macho&#039; gene that makes men behave aggressively has been found. The Daily Mail (2012). [http://www.dailymail.co.uk/sciencetech/article-2111668/The-macho-gene-makes-men-aggressive-found.html#ixzz3yZC2BV4k]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
It has been shown that SRY may be involved in the regulation of the renin-angiotensin system in mice. Indeed, sequence mutations of the protein lead to hypertension. Because the human&#039;s SRY organisation is very closed to the mouse&#039;s, it has been proposed that SRY may have the same function in humans but it has not been studied directly&amp;lt;ref&amp;gt;PMID:22315667&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
== Diseases==&lt;br /&gt;
&lt;br /&gt;
=== Swyer syndrome (AKA XY gonadal dysgenis) :===&lt;br /&gt;
&lt;br /&gt;
If the TDF protein is not able to bind its targeted DNA sequences, the genes responsible for the testis development are not expressed. The patient owning this defective protein will then develop female characters, even though he has a XY karyotype. This phenomenon is known as the &amp;quot;Swyer Syndrome&amp;quot;. &lt;br /&gt;
Different causes can explain this &amp;quot;XY gonadal dysgenis&amp;quot;, as it is also called. About thirty mutations (named [http://www.uniprot.org/uniprot/Q05066#sequences &amp;quot;SRXY1&amp;quot;]) in the SRY gene have been shown to drive this phenotype development. It can also be due to crossovers during a meiosis. If a Y chromosome portion carrying the SRY gene is recombined into a X chromosome, a sperm cell will get this abnormal Y chromosome. If it then fecundates, a XY karyotype without any SRY gene will be formed. &lt;br /&gt;
&lt;br /&gt;
=== De La Chapelle syndrome (AKA XX male syndrome) :===&lt;br /&gt;
&lt;br /&gt;
From the meiosis just described would also result an abnormal X chromosome, carrying the SRY gene. If the sperm cell owning this chromosome fecundates an ovule, the resulting newborn will have a XX karyotype but a male phenotype. This is called the &amp;quot;De La Chapelle syndrome&amp;quot;. In this case, the patient can either develop testis or both testis and ovarian tissues. As some epigenetic mechanisms can inactivate the X chromosome carrying SRY, this syndrome keeps most of the patients sterile&amp;lt;ref&amp;gt;PMID: 4622299&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Hepatocellular carcinoma===&lt;br /&gt;
 &lt;br /&gt;
In the case on a hepatocellular carcinoma, it has been proved that high expression levels of SRY help cancer progression and poor patient survival. However, it still seems that hepatocellular carcinoma is not most likely to develop in men&amp;lt;ref&amp;gt;PMID: 25274159&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
== Structural highlights ==&lt;br /&gt;
&lt;br /&gt;
This is a sample scene created with SAT to &amp;lt;scene name=&amp;quot;/12/3456/Sample/1&amp;quot;&amp;gt;color&amp;lt;/scene&amp;gt; by Group, and another to make &amp;lt;scene name=&amp;quot;/12/3456/Sample/2&amp;quot;&amp;gt;a transparent representation&amp;lt;/scene&amp;gt; of the protein. You can make your own scenes on SAT starting from scratch or loading and editing one of these sample scenes.&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_1/3&#039;&amp;gt;Helix 1&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_2/2&#039;&amp;gt;Helix 2&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_3/1&#039;&amp;gt;Helix 3&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Long_arm_28a/1&#039;&amp;gt;Long arm (28A)&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Short_arm_22a/1&#039;&amp;gt;Short arm (22A)&amp;lt;/scene&amp;gt;&lt;br /&gt;
&amp;lt;/StructureSection&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== References ==&lt;br /&gt;
&amp;lt;references/&amp;gt;&lt;/div&gt;</summary>
		<author><name>Fantin Mesny</name></author>
	</entry>
	<entry>
		<id>https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2526311</id>
		<title>Sandbox Reserved 1120</title>
		<link rel="alternate" type="text/html" href="https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2526311"/>
		<updated>2016-01-30T14:43:47Z</updated>

		<summary type="html">&lt;p&gt;Fantin Mesny: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{Sandbox_Reserved_ESBS_2015}}&amp;lt;!-- PLEASE ADD YOUR CONTENT BELOW HERE --&amp;gt;&lt;br /&gt;
=SRY protein (AKA TDF protein)=&lt;br /&gt;
&amp;lt;StructureSection load=&#039;1hry&#039; size=&#039;340&#039; frame=&#039;true&#039; side=&#039;right&#039; caption=&#039;The SRY protein linked to DNA&#039; scene=&#039;71/719861/Base/1&#039;&amp;gt;&lt;br /&gt;
{{SRY protein (AKA TDF protein)}}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td colspan=&#039;2&#039;&amp;gt;The SRY protein is a 204 residues-long monomeric polypeptide. It is encoded by the SRY gene and is involved in the sex determination in mammals by being responsible for the gonadogenesis and so the male sexual development. It is the HMG-box that gives to the protein its ability to bind DNA by its minor groove&amp;lt;ref name =&amp;quot;Tang&amp;quot;&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;.&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr id=&#039;related&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;[[Related_structure|Related:]]&amp;lt;/b&amp;gt;&amp;lt;/td&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;[[1hrz|1hrz]]&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr id=&#039;resources&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Resources:&amp;lt;/b&amp;gt;&amp;lt;/td&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;&amp;lt;span class=&#039;plainlinks&#039;&amp;gt;[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=1hry FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=1hry OCA], [http://pdbe.org/1hry PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=1hry RCSB], [http://www.ebi.ac.uk/pdbsum/1hry PDBsum]&lt;br /&gt;
&amp;lt;tr id=&#039;Gene&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Encoded by&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;The SRY gene codes for the SRY protein&lt;br /&gt;
&amp;lt;tr id=&#039;Length&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Length&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;204 residues&lt;br /&gt;
&amp;lt;tr id=&#039;Molecular weight&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Molecular weight&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;≈23kDa&lt;br /&gt;
&amp;lt;tr id=&#039;DNA target sequence&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;DNA target sequence&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;(5&#039;-dGCACAAAC)&lt;br /&gt;
&amp;lt;tr id=&#039;Regulation&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Regulation&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;[https://en.wikipedia.org/wiki/Steroidogenic_factor_1 Sf1];[https://en.wikipedia.org/wiki/Sp1_transcription_factor Sp1] (binding site in the promoter of SRY : -150),[https://en.wikipedia.org/wiki/WT1 WT1] (binding site in the promoter of SRY : -87)&lt;br /&gt;
&amp;lt;tr id=&#039;Role&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Role&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;Transcription factor&lt;br /&gt;
&amp;lt;tr id=&#039;Genes targeted&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Genes targeted&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;SOX9&lt;br /&gt;
&lt;br /&gt;
&amp;lt;/span&amp;gt;&lt;br /&gt;
&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;/table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==History==&lt;br /&gt;
&lt;br /&gt;
After centuries of unfounded theories mainly based on environmental factors, the first molecular theory concerning the sex determination appeared in 1891. At this time, the german biologist Hermann Henking was studying sperm formation in wasps. As a chromosome which was not present in all the wasps looked different from the others, he suspected it to play a role in sex determination and called it the &amp;quot;X chromosome&amp;quot;.&lt;br /&gt;
Ten years later, Clarence Erwin McClung saw that this chromosome behaved differently during the meiosis and was only present in half the sperm cells of grasshoppers. As the main characteristic that varies in 50/50 proportions among zygotes is the sex, McClung suspected the X chromosome to be implicated in sexual development. &lt;br /&gt;
In 1905, Nettie Stevens discovered the &amp;quot;Y chromosome&amp;quot; (and the female XX and male XY patterns) while she was counting the chromosomes of beetles under the microscope&amp;lt;ref&amp;gt;Sumner, A. T. Sex Chromosomes and Sex Determination. Chromosomes: Organization and Function, 97-108. [http://www.nature.com/scitable/nated/topicpage/Sex-Chromosomes-and-Sex-Determination-44565]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
During the next decades, a few theories were in competition. In 1921, Calvin Bridges&#039;s works on &#039;&#039;Drosophila melanogaster&#039;&#039; seemed to reveal that male characters acquisition is due to a genic balance between the genes contained in the X chromosome and those contained in the autosomes&amp;lt;ref&amp;gt;PMID: 17769897&amp;lt;/ref&amp;gt;.&lt;br /&gt;
In 1930, Ronald Fisher introduced the first Y-based control of sex theory by proposing two different models : either all the genes responsible for the male characters are located on the Y chromosome or there is a Y-located gene which regulates the expression of genes elsewhere in the genome&amp;lt;ref name=&amp;quot;Goodfellow&amp;quot;&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt;.&lt;br /&gt;
As Alfred Jost had shown the testosterone produced by the testis is responsible for the entire male phenotype acquisition&amp;lt;ref&amp;gt;PMID: 4805859&amp;lt;/ref&amp;gt;, Peter Neville Goodfellow proposed in 1988, that there is a gene (&#039;&#039;TDF&#039;&#039; in human, &#039;&#039;Tdy&#039;&#039; in mice)  on the Y chromosome which drives the development of the testis&amp;lt;ref name=&amp;quot;Goodfellow&amp;quot; /&amp;gt;. In 1990, Goodfellow&#039;s hypothesis was validated with the discovery of &#039;&#039;Tdy&#039;&#039;&#039;s localisation. This gene&#039;s product (expressed during the male gonadal development) owns an amino-acid motif which shows homology to other known or putative DNA-binding domains. &#039;&#039;Tdy&#039;&#039; is therefore a transcriptional factor&amp;lt;ref&amp;gt;PMID: 2374589&amp;lt;/ref&amp;gt;. The same year, the human &#039;&#039;SRY&#039;&#039; gene (accepted later as the &#039;&#039;TDF&#039;&#039;) was discovered&amp;lt;ref&amp;gt;PMID: 1695712&amp;lt;/ref&amp;gt;. &lt;br /&gt;
Three dimensional structure of the SRY protein was determined in 1995 using NMR spectroscopy&amp;lt;ref&amp;gt;PMID:7774012&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
==SRY gene==&lt;br /&gt;
&lt;br /&gt;
The SRY gene encodes the SRY protein. The SRY protein is a transcriptional factor that induces the male phenotype in the embryo. The SRY gene is located on the [https://en.wikipedia.org/wiki/Y_chromosome Y chromosome] in the short arm (p) 11.3 &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/gene/6736 NCBI gene]&amp;lt;/ref&amp;gt;. This gene has only one exon that contains the HMG domain (DNA-binding High-Mobility Group box domain). It means that SRY mRNA does not have an alternative splicing, so there is only one isoforme of SRY protein&amp;lt;ref name=&amp;quot;McE&amp;quot;&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;. Moreover, the human genome contains only one copy of the SRY gene, whereas the mouse genome contains 6 copy of this gene&amp;lt;ref&amp;gt; Sekido R, Lovell-Badge R. Genetic control of testis development. Sex Dev Genet Mol Biol Evol Endocrinol Embryol Pathol Sex Determ Differ. 2013;7(1-3):21–32 &amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Sequence of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:90%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
&amp;gt;gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/nuccore NCBI nucleotide]&amp;lt;/ref&amp;gt;&lt;br /&gt;
TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT&lt;br /&gt;
TTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACA&lt;br /&gt;
&amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;ATG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;CAATCATATGCTTCTGCTATGTTAAGCGTATTCAACAGCGATGATTACAGTCCAGCTGTGCAAGAGAAT&lt;br /&gt;
ATTCCCGCTCTCCGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTAAGTATCAGTGTGAAA&lt;br /&gt;
CGGGAGAAAACAGTAAAGGCAACGTCCAGGATAGAGTGAAGCGACCCATGAACGCATTCATCGTGTGGTC&lt;br /&gt;
&#039;&#039;&#039;TCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCAGAGATCAGCAAGCAGCTG&lt;br /&gt;
&#039;&#039;&#039;GGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCATTCTTCCAGGAGGCACAGAAATTACAGG&lt;br /&gt;
&#039;&#039;&#039;CCATGCACAGAGAGAAATACCCGAATTATAAGTATCGA&#039;&#039;&#039;CCTCGTCGGAAGGCGAAGATGCTGCCGAAGAA&lt;br /&gt;
TTGCAGTTTGCTTCCCGCAGATCCCGCTTCGGTACTCTGCAGCGAAGTGCAACTGGACAACAGGTTGTAC&lt;br /&gt;
AGGGATGACTGTACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAACG&lt;br /&gt;
CAGCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTG&amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;TAG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;GACAATCGGGTAACATT&lt;br /&gt;
GGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCACTTTCTTATGTTTAGTTT&lt;br /&gt;
CAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCATTTCA&amp;lt;/small&amp;gt;&lt;br /&gt;
&lt;br /&gt;
(Legend : &amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Initiation codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt; ; &amp;lt;b&amp;gt;HMG sequence&amp;lt;/b&amp;gt; ; &amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Stop codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;)&lt;br /&gt;
&amp;lt;/div&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Regulation of the expression of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
In humans, the SRY promoter is located between −408 and −95 bp. Moreover, the SRY gene has enhancers at -727 pb. The linkage between regulatory proteins and these enhancers has the property to increase the production of SRY proteins. These regulatory proteins could be: SF1 (steroidogenic factor 1), SP1  and WT 1 (Wilms tumor)&amp;lt;ref name=&amp;quot;Harley&amp;quot;&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;SF1&#039;&#039;&#039;: this transcriptional factor belongs to the family of nuclear hormone receptors and contains a zinc finger. The activation of this protein requires a ligand (hormone).&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;SP1&#039;&#039;&#039;: this transcriptional factor is an ubiquitous protein which binds rich GC-sites and is implicated in the transcription of many genes. Moreover, this protein contains a zinc finger.&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;WT1&#039;&#039;&#039; :this transcriptional factor transactivates the SRY gene. It contains a zinc finger&amp;lt;ref&amp;gt;Larney C, Bailey TL, Koopman P. Switching on sex: transcriptional regulation of the testis-determining gene Sry. Dev Camb Engl. 2014 Jun;141(11):2195–205&amp;lt;/ref&amp;gt;. &lt;br /&gt;
&lt;br /&gt;
==Structure==&lt;br /&gt;
&lt;br /&gt;
===The SRY-HMG domain (HMG-Box)===&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;&#039;SRY-HMG&#039;&#039;&#039; stands for &#039;&#039;&#039;S&#039;&#039;&#039;ex determining &#039;&#039;&#039;R&#039;&#039;&#039;egion &#039;&#039;&#039;Y&#039;&#039;&#039; - &#039;&#039;&#039;H&#039;&#039;&#039;igh &#039;&#039;&#039;M&#039;&#039;&#039;obility &#039;&#039;&#039;G&#039;&#039;&#039;roup domain.&lt;br /&gt;
It is approximately 80 residues-long. It mediates the binding of the protein to the minor groove of DNA. It is the most important part of the SRY protein. Not only because it enables  the protein to bind the DNA but also because even a single mutation can cause an inactivation of the protein.&lt;br /&gt;
&lt;br /&gt;
It has a twisted L shape: it has a long (28Å) and a short (22Å) arm. The HMG Box is made of 3 helices. Its N-term and C-term domains are irregular. The overall structure is stabilized by a hydrophobic core especially at the intersection of the 3 helices where 3 aromatics cycles meet, surrounded by aliphatic aminoacids.&lt;br /&gt;
See the different structures:&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_1/3&#039;&amp;gt;Helix 1&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_2/2&#039;&amp;gt;Helix 2&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_3/1&#039;&amp;gt;Helix 3&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Long_arm_28a/1&#039;&amp;gt;Long arm (28Å)&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Short_arm_22a/1&#039;&amp;gt;Short arm (22Å)&amp;lt;/scene&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The interaction between the HMG-Box and DNA is specific and stable.  It is mostly hydrophobic. It permits the DNA to bend of DNA (≈75°). Only one molecule of water interfaces the Box and the DNA. The complex is stabilized by salt bridges between positively charged residues of the HMG domain and negatively charged phosphates&amp;lt;ref name=&amp;quot;Tang&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
[[Image:HHMG-bitmap.png|thumb|alt=Image bitmap|Linear structure of hHMG domain]]&lt;br /&gt;
&lt;br /&gt;
The binding of SRY on DNA is specific. The DNA target site is a DNA octamer :&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:30%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
(5&#039;-dGCACAAAC)&amp;lt;br/&amp;gt;&lt;br /&gt;
(5&#039;-dGTTTGTGC)&lt;br /&gt;
&amp;lt;/small&amp;gt;&amp;lt;/div&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
This sequence is found in the promoters of genes expressed during the testicular development.&lt;br /&gt;
The bend of DNA enables the recruitment of different proteins and the building of massive proteins-DNA complexes that could change the expression of different genes&amp;lt;ref&amp;gt;PMID:11563911&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
Even if the most important function of the HMG box is binding and bending DNA, it is also involved in DNA condensation, recombination and repair.&lt;br /&gt;
&lt;br /&gt;
There are two kinds of proteins that contain a HMG box:&lt;br /&gt;
* &#039;&#039;&#039;HMG1&#039;&#039;&#039; : It is expressed in few cell types. It is found in transcription factors that contain a single HMG box. The binding of a DNA sequence is specific.&lt;br /&gt;
* &#039;&#039;&#039;HMG2&#039;&#039;&#039; : It is found in all cell types and is abundant in chromatin. These proteins can contain two or more HMG boxes that can non-specifically bind DNA. &lt;br /&gt;
&lt;br /&gt;
===General structure of SRY===&lt;br /&gt;
&lt;br /&gt;
The overall structure of SRY is organized around the HMG-box.&lt;br /&gt;
3 domains:&lt;br /&gt;
* N-term domain&lt;br /&gt;
* Central domain : DNA binding (HMG box)&lt;br /&gt;
* C-term domain&lt;br /&gt;
&lt;br /&gt;
== Function ==&lt;br /&gt;
&lt;br /&gt;
===Sex determining===&lt;br /&gt;
&lt;br /&gt;
It acts like a sex determining factor thanks to its transcriptional activity. It inhibits the development of female sex structures in the embryonic individual.&lt;br /&gt;
&lt;br /&gt;
The SRY protein contains nuclear localization signals in N and C terminals. An acetylation of these domains allows the exportation of the SRY protein to the nucleus&amp;lt;ref name=&amp;quot;Harley&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
The SRY protein activates the &#039;&#039;SOX9&#039;&#039; (SRY-box9) gene &amp;lt;ref name=&amp;quot;McE&amp;quot; /&amp;gt;. This gene is found in long arm 24.3 of the chromosome 17&amp;lt;ref&amp;gt; NCBI [http://www.ncbi.nlm.nih.gov/gene/6662 NCBI gene: SOX9 SRY-BOX9 Homo sapiens] &amp;lt;/ref&amp;gt; and is implicated in the stimulation of the differentiation of pre-Sertori into Sertoli cells rather than granulosa cells.&lt;br /&gt;
&lt;br /&gt;
The activation of &#039;&#039;SOX&#039;&#039;9 is done by the SRY protein and another transcriptional factor: SF1 (steroidogenic factor 1). These transcriptional factors are bound on an enhancer called: TESCO (Testis-Specific Enhancer of &#039;&#039;SOX9&#039;&#039; core element). The binding of a transcriptional factor on an enhancer provokes a curvature of the DNA (≈75°), allowing a stabilization of the elongation complex on the &#039;&#039;SOX9&#039;&#039; promoter. The SOX9 protein activates the gene &#039;&#039;AMH&#039;&#039; (Anti-Mullerian Hormone)&amp;lt;ref&amp;gt;[http://www.ebi.ac.uk/interpro/entry/IPR006799?q=AMH EBI-Interpro: Anti-Mullerian-Hormon, N-term] &amp;lt;/ref&amp;gt;. Therefore, it allows the degeneration of the channels of Müller in male&amp;lt;ref name=&amp;quot;Harley&amp;quot; /&amp;gt;.&lt;br /&gt;
===Cathecolamines regulation===&lt;br /&gt;
&lt;br /&gt;
It has been shown that SRY is present in brain regions and activates the Tyrosine-3-Hydroxylase expression. This enzyme catalyses the rate-limiting step of catecholamine synthesis (L-Tyrosine to L-DOPA). Furthermore, SRY also activates the expression of Monoamine Oxidase A which is responsible for the inactivation of catecholamines. Therefore, it regulates both positively and negatively the catecholamines concentration&amp;lt;ref name=&amp;quot;Veitia&amp;quot;&amp;gt;PMID: 24604382&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Other extra-testicular effects===&lt;br /&gt;
&lt;br /&gt;
Some knock-down experiments have shown that SRY may also be a major actor in the dopamine pathway. On the peripheral side, it seems to regulate noradrenaline levels and blood pressure&amp;lt;ref name=&amp;quot;Veitia&amp;quot; /&amp;gt;. A researcher who contributed to discovering these effects says it might explain why &amp;quot;the aggressive fight-or-flight reaction is more dominant in men, while women predominantly adopt a less aggressive tend-and-befriend response&amp;quot;&amp;lt;ref&amp;gt;Cohen, Tamara. The &#039;macho&#039; gene that makes men behave aggressively has been found. The Daily Mail (2012). [http://www.dailymail.co.uk/sciencetech/article-2111668/The-macho-gene-makes-men-aggressive-found.html#ixzz3yZC2BV4k]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
It has been shown that SRY may be involved in the regulation of the renin-angiotensin system in mice. Indeed, sequence mutations of the protein lead to hypertension. Because the human&#039;s SRY organisation is very closed to the mouse&#039;s, it has been proposed that SRY may have the same function in humans but it has not been studied directly&amp;lt;ref&amp;gt;PMID:22315667&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
== Diseases==&lt;br /&gt;
&lt;br /&gt;
=== Swyer syndrome (AKA XY gonadal dysgenis) :===&lt;br /&gt;
&lt;br /&gt;
If the TDF protein is not able to bind its targeted DNA sequences, the genes responsible for the testis development are not expressed. The patient owning this defective protein will then develop female characters, even though he has a XY karyotype. This phenomenon is known as the &amp;quot;Swyer Syndrome&amp;quot;. &lt;br /&gt;
Different causes can explain this &amp;quot;XY gonadal dysgenis&amp;quot;, as it is also called. About thirty mutations (named [http://www.uniprot.org/uniprot/Q05066#sequences &amp;quot;SRXY1&amp;quot;]) in the SRY gene have been shown to drive this phenotype development. It can also be due to crossovers during a meiosis. If a Y chromosome portion carrying the SRY gene is recombined into a X chromosome, a sperm cell will get this abnormal Y chromosome. If it then fecundates, a XY karyotype without any SRY gene will be formed. &lt;br /&gt;
&lt;br /&gt;
=== De La Chapelle syndrome (AKA XX male syndrome) :===&lt;br /&gt;
&lt;br /&gt;
From the meiosis just described would also result an abnormal X chromosome, carrying the SRY gene. If the sperm cell owning this chromosome fecundates an ovule, the resulting newborn will have a XX karyotype but a male phenotype. This is called the &amp;quot;De La Chapelle syndrome&amp;quot;. In this case, the patient can either develop testis or both testis and ovarian tissues. As some epigenetic mechanisms can inactivate the X chromosome carrying SRY, this syndrome keeps most of the patients sterile&amp;lt;ref&amp;gt;PMID: 4622299&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Hepatocellular carcinoma===&lt;br /&gt;
 &lt;br /&gt;
In the case on a hepatocellular carcinoma, it has been proved that high expression levels of SRY help cancer progression and poor patient survival. However, it still seems that hepatocellular carcinoma is not most likely to develop in men&amp;lt;ref&amp;gt;PMID: 25274159&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
== Structural highlights ==&lt;br /&gt;
&lt;br /&gt;
This is a sample scene created with SAT to &amp;lt;scene name=&amp;quot;/12/3456/Sample/1&amp;quot;&amp;gt;color&amp;lt;/scene&amp;gt; by Group, and another to make &amp;lt;scene name=&amp;quot;/12/3456/Sample/2&amp;quot;&amp;gt;a transparent representation&amp;lt;/scene&amp;gt; of the protein. You can make your own scenes on SAT starting from scratch or loading and editing one of these sample scenes.&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_1/3&#039;&amp;gt;Helix 1&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_2/2&#039;&amp;gt;Helix 2&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_3/1&#039;&amp;gt;Helix 3&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Long_arm_28a/1&#039;&amp;gt;Long arm (28A)&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Short_arm_22a/1&#039;&amp;gt;Short arm (22A)&amp;lt;/scene&amp;gt;&lt;br /&gt;
&amp;lt;/StructureSection&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== References ==&lt;br /&gt;
&amp;lt;references/&amp;gt;&lt;/div&gt;</summary>
		<author><name>Fantin Mesny</name></author>
	</entry>
	<entry>
		<id>https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2526308</id>
		<title>Sandbox Reserved 1120</title>
		<link rel="alternate" type="text/html" href="https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2526308"/>
		<updated>2016-01-30T14:43:16Z</updated>

		<summary type="html">&lt;p&gt;Fantin Mesny: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{Sandbox_Reserved_ESBS_2015}}&amp;lt;!-- PLEASE ADD YOUR CONTENT BELOW HERE --&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;StructureSection load=&#039;1hry&#039; size=&#039;340&#039; frame=&#039;true&#039; side=&#039;right&#039; caption=&#039;The SRY protein linked to DNA&#039; scene=&#039;71/719861/Base/1&#039;&amp;gt;&lt;br /&gt;
{{SRY protein (AKA TDF protein)}}&lt;br /&gt;
=SRY protein (AKA TDF protein)=&lt;br /&gt;
&lt;br /&gt;
&amp;lt;table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td colspan=&#039;2&#039;&amp;gt;The SRY protein is a 204 residues-long monomeric polypeptide. It is encoded by the SRY gene and is involved in the sex determination in mammals by being responsible for the gonadogenesis and so the male sexual development. It is the HMG-box that gives to the protein its ability to bind DNA by its minor groove&amp;lt;ref name =&amp;quot;Tang&amp;quot;&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;.&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr id=&#039;related&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;[[Related_structure|Related:]]&amp;lt;/b&amp;gt;&amp;lt;/td&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;[[1hrz|1hrz]]&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr id=&#039;resources&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Resources:&amp;lt;/b&amp;gt;&amp;lt;/td&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;&amp;lt;span class=&#039;plainlinks&#039;&amp;gt;[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=1hry FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=1hry OCA], [http://pdbe.org/1hry PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=1hry RCSB], [http://www.ebi.ac.uk/pdbsum/1hry PDBsum]&lt;br /&gt;
&amp;lt;tr id=&#039;Gene&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Encoded by&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;The SRY gene codes for the SRY protein&lt;br /&gt;
&amp;lt;tr id=&#039;Length&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Length&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;204 residues&lt;br /&gt;
&amp;lt;tr id=&#039;Molecular weight&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Molecular weight&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;≈23kDa&lt;br /&gt;
&amp;lt;tr id=&#039;DNA target sequence&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;DNA target sequence&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;(5&#039;-dGCACAAAC)&lt;br /&gt;
&amp;lt;tr id=&#039;Regulation&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Regulation&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;[https://en.wikipedia.org/wiki/Steroidogenic_factor_1 Sf1];[https://en.wikipedia.org/wiki/Sp1_transcription_factor Sp1] (binding site in the promoter of SRY : -150),[https://en.wikipedia.org/wiki/WT1 WT1] (binding site in the promoter of SRY : -87)&lt;br /&gt;
&amp;lt;tr id=&#039;Role&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Role&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;Transcription factor&lt;br /&gt;
&amp;lt;tr id=&#039;Genes targeted&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Genes targeted&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;SOX9&lt;br /&gt;
&lt;br /&gt;
&amp;lt;/span&amp;gt;&lt;br /&gt;
&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;/table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==History==&lt;br /&gt;
&lt;br /&gt;
After centuries of unfounded theories mainly based on environmental factors, the first molecular theory concerning the sex determination appeared in 1891. At this time, the german biologist Hermann Henking was studying sperm formation in wasps. As a chromosome which was not present in all the wasps looked different from the others, he suspected it to play a role in sex determination and called it the &amp;quot;X chromosome&amp;quot;.&lt;br /&gt;
Ten years later, Clarence Erwin McClung saw that this chromosome behaved differently during the meiosis and was only present in half the sperm cells of grasshoppers. As the main characteristic that varies in 50/50 proportions among zygotes is the sex, McClung suspected the X chromosome to be implicated in sexual development. &lt;br /&gt;
In 1905, Nettie Stevens discovered the &amp;quot;Y chromosome&amp;quot; (and the female XX and male XY patterns) while she was counting the chromosomes of beetles under the microscope&amp;lt;ref&amp;gt;Sumner, A. T. Sex Chromosomes and Sex Determination. Chromosomes: Organization and Function, 97-108. [http://www.nature.com/scitable/nated/topicpage/Sex-Chromosomes-and-Sex-Determination-44565]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
During the next decades, a few theories were in competition. In 1921, Calvin Bridges&#039;s works on &#039;&#039;Drosophila melanogaster&#039;&#039; seemed to reveal that male characters acquisition is due to a genic balance between the genes contained in the X chromosome and those contained in the autosomes&amp;lt;ref&amp;gt;PMID: 17769897&amp;lt;/ref&amp;gt;.&lt;br /&gt;
In 1930, Ronald Fisher introduced the first Y-based control of sex theory by proposing two different models : either all the genes responsible for the male characters are located on the Y chromosome or there is a Y-located gene which regulates the expression of genes elsewhere in the genome&amp;lt;ref name=&amp;quot;Goodfellow&amp;quot;&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt;.&lt;br /&gt;
As Alfred Jost had shown the testosterone produced by the testis is responsible for the entire male phenotype acquisition&amp;lt;ref&amp;gt;PMID: 4805859&amp;lt;/ref&amp;gt;, Peter Neville Goodfellow proposed in 1988, that there is a gene (&#039;&#039;TDF&#039;&#039; in human, &#039;&#039;Tdy&#039;&#039; in mice)  on the Y chromosome which drives the development of the testis&amp;lt;ref name=&amp;quot;Goodfellow&amp;quot; /&amp;gt;. In 1990, Goodfellow&#039;s hypothesis was validated with the discovery of &#039;&#039;Tdy&#039;&#039;&#039;s localisation. This gene&#039;s product (expressed during the male gonadal development) owns an amino-acid motif which shows homology to other known or putative DNA-binding domains. &#039;&#039;Tdy&#039;&#039; is therefore a transcriptional factor&amp;lt;ref&amp;gt;PMID: 2374589&amp;lt;/ref&amp;gt;. The same year, the human &#039;&#039;SRY&#039;&#039; gene (accepted later as the &#039;&#039;TDF&#039;&#039;) was discovered&amp;lt;ref&amp;gt;PMID: 1695712&amp;lt;/ref&amp;gt;. &lt;br /&gt;
Three dimensional structure of the SRY protein was determined in 1995 using NMR spectroscopy&amp;lt;ref&amp;gt;PMID:7774012&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
==SRY gene==&lt;br /&gt;
&lt;br /&gt;
The SRY gene encodes the SRY protein. The SRY protein is a transcriptional factor that induces the male phenotype in the embryo. The SRY gene is located on the [https://en.wikipedia.org/wiki/Y_chromosome Y chromosome] in the short arm (p) 11.3 &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/gene/6736 NCBI gene]&amp;lt;/ref&amp;gt;. This gene has only one exon that contains the HMG domain (DNA-binding High-Mobility Group box domain). It means that SRY mRNA does not have an alternative splicing, so there is only one isoforme of SRY protein&amp;lt;ref name=&amp;quot;McE&amp;quot;&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;. Moreover, the human genome contains only one copy of the SRY gene, whereas the mouse genome contains 6 copy of this gene&amp;lt;ref&amp;gt; Sekido R, Lovell-Badge R. Genetic control of testis development. Sex Dev Genet Mol Biol Evol Endocrinol Embryol Pathol Sex Determ Differ. 2013;7(1-3):21–32 &amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Sequence of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:90%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
&amp;gt;gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/nuccore NCBI nucleotide]&amp;lt;/ref&amp;gt;&lt;br /&gt;
TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT&lt;br /&gt;
TTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACA&lt;br /&gt;
&amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;ATG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;CAATCATATGCTTCTGCTATGTTAAGCGTATTCAACAGCGATGATTACAGTCCAGCTGTGCAAGAGAAT&lt;br /&gt;
ATTCCCGCTCTCCGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTAAGTATCAGTGTGAAA&lt;br /&gt;
CGGGAGAAAACAGTAAAGGCAACGTCCAGGATAGAGTGAAGCGACCCATGAACGCATTCATCGTGTGGTC&lt;br /&gt;
&#039;&#039;&#039;TCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCAGAGATCAGCAAGCAGCTG&lt;br /&gt;
&#039;&#039;&#039;GGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCATTCTTCCAGGAGGCACAGAAATTACAGG&lt;br /&gt;
&#039;&#039;&#039;CCATGCACAGAGAGAAATACCCGAATTATAAGTATCGA&#039;&#039;&#039;CCTCGTCGGAAGGCGAAGATGCTGCCGAAGAA&lt;br /&gt;
TTGCAGTTTGCTTCCCGCAGATCCCGCTTCGGTACTCTGCAGCGAAGTGCAACTGGACAACAGGTTGTAC&lt;br /&gt;
AGGGATGACTGTACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAACG&lt;br /&gt;
CAGCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTG&amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;TAG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;GACAATCGGGTAACATT&lt;br /&gt;
GGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCACTTTCTTATGTTTAGTTT&lt;br /&gt;
CAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCATTTCA&amp;lt;/small&amp;gt;&lt;br /&gt;
&lt;br /&gt;
(Legend : &amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Initiation codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt; ; &amp;lt;b&amp;gt;HMG sequence&amp;lt;/b&amp;gt; ; &amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Stop codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;)&lt;br /&gt;
&amp;lt;/div&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Regulation of the expression of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
In humans, the SRY promoter is located between −408 and −95 bp. Moreover, the SRY gene has enhancers at -727 pb. The linkage between regulatory proteins and these enhancers has the property to increase the production of SRY proteins. These regulatory proteins could be: SF1 (steroidogenic factor 1), SP1  and WT 1 (Wilms tumor)&amp;lt;ref name=&amp;quot;Harley&amp;quot;&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;SF1&#039;&#039;&#039;: this transcriptional factor belongs to the family of nuclear hormone receptors and contains a zinc finger. The activation of this protein requires a ligand (hormone).&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;SP1&#039;&#039;&#039;: this transcriptional factor is an ubiquitous protein which binds rich GC-sites and is implicated in the transcription of many genes. Moreover, this protein contains a zinc finger.&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;WT1&#039;&#039;&#039; :this transcriptional factor transactivates the SRY gene. It contains a zinc finger&amp;lt;ref&amp;gt;Larney C, Bailey TL, Koopman P. Switching on sex: transcriptional regulation of the testis-determining gene Sry. Dev Camb Engl. 2014 Jun;141(11):2195–205&amp;lt;/ref&amp;gt;. &lt;br /&gt;
&lt;br /&gt;
==Structure==&lt;br /&gt;
&lt;br /&gt;
===The SRY-HMG domain (HMG-Box)===&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;&#039;SRY-HMG&#039;&#039;&#039; stands for &#039;&#039;&#039;S&#039;&#039;&#039;ex determining &#039;&#039;&#039;R&#039;&#039;&#039;egion &#039;&#039;&#039;Y&#039;&#039;&#039; - &#039;&#039;&#039;H&#039;&#039;&#039;igh &#039;&#039;&#039;M&#039;&#039;&#039;obility &#039;&#039;&#039;G&#039;&#039;&#039;roup domain.&lt;br /&gt;
It is approximately 80 residues-long. It mediates the binding of the protein to the minor groove of DNA. It is the most important part of the SRY protein. Not only because it enables  the protein to bind the DNA but also because even a single mutation can cause an inactivation of the protein.&lt;br /&gt;
&lt;br /&gt;
It has a twisted L shape: it has a long (28Å) and a short (22Å) arm. The HMG Box is made of 3 helices. Its N-term and C-term domains are irregular. The overall structure is stabilized by a hydrophobic core especially at the intersection of the 3 helices where 3 aromatics cycles meet, surrounded by aliphatic aminoacids.&lt;br /&gt;
See the different structures:&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_1/3&#039;&amp;gt;Helix 1&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_2/2&#039;&amp;gt;Helix 2&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_3/1&#039;&amp;gt;Helix 3&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Long_arm_28a/1&#039;&amp;gt;Long arm (28Å)&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Short_arm_22a/1&#039;&amp;gt;Short arm (22Å)&amp;lt;/scene&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The interaction between the HMG-Box and DNA is specific and stable.  It is mostly hydrophobic. It permits the DNA to bend of DNA (≈75°). Only one molecule of water interfaces the Box and the DNA. The complex is stabilized by salt bridges between positively charged residues of the HMG domain and negatively charged phosphates&amp;lt;ref name=&amp;quot;Tang&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
[[Image:HHMG-bitmap.png|thumb|alt=Image bitmap|Linear structure of hHMG domain]]&lt;br /&gt;
&lt;br /&gt;
The binding of SRY on DNA is specific. The DNA target site is a DNA octamer :&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:30%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
(5&#039;-dGCACAAAC)&amp;lt;br/&amp;gt;&lt;br /&gt;
(5&#039;-dGTTTGTGC)&lt;br /&gt;
&amp;lt;/small&amp;gt;&amp;lt;/div&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
This sequence is found in the promoters of genes expressed during the testicular development.&lt;br /&gt;
The bend of DNA enables the recruitment of different proteins and the building of massive proteins-DNA complexes that could change the expression of different genes&amp;lt;ref&amp;gt;PMID:11563911&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
Even if the most important function of the HMG box is binding and bending DNA, it is also involved in DNA condensation, recombination and repair.&lt;br /&gt;
&lt;br /&gt;
There are two kinds of proteins that contain a HMG box:&lt;br /&gt;
* &#039;&#039;&#039;HMG1&#039;&#039;&#039; : It is expressed in few cell types. It is found in transcription factors that contain a single HMG box. The binding of a DNA sequence is specific.&lt;br /&gt;
* &#039;&#039;&#039;HMG2&#039;&#039;&#039; : It is found in all cell types and is abundant in chromatin. These proteins can contain two or more HMG boxes that can non-specifically bind DNA. &lt;br /&gt;
&lt;br /&gt;
===General structure of SRY===&lt;br /&gt;
&lt;br /&gt;
The overall structure of SRY is organized around the HMG-box.&lt;br /&gt;
3 domains:&lt;br /&gt;
* N-term domain&lt;br /&gt;
* Central domain : DNA binding (HMG box)&lt;br /&gt;
* C-term domain&lt;br /&gt;
&lt;br /&gt;
== Function ==&lt;br /&gt;
&lt;br /&gt;
===Sex determining===&lt;br /&gt;
&lt;br /&gt;
It acts like a sex determining factor thanks to its transcriptional activity. It inhibits the development of female sex structures in the embryonic individual.&lt;br /&gt;
&lt;br /&gt;
The SRY protein contains nuclear localization signals in N and C terminals. An acetylation of these domains allows the exportation of the SRY protein to the nucleus&amp;lt;ref name=&amp;quot;Harley&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
The SRY protein activates the &#039;&#039;SOX9&#039;&#039; (SRY-box9) gene &amp;lt;ref name=&amp;quot;McE&amp;quot; /&amp;gt;. This gene is found in long arm 24.3 of the chromosome 17&amp;lt;ref&amp;gt; NCBI [http://www.ncbi.nlm.nih.gov/gene/6662 NCBI gene: SOX9 SRY-BOX9 Homo sapiens] &amp;lt;/ref&amp;gt; and is implicated in the stimulation of the differentiation of pre-Sertori into Sertoli cells rather than granulosa cells.&lt;br /&gt;
&lt;br /&gt;
The activation of &#039;&#039;SOX&#039;&#039;9 is done by the SRY protein and another transcriptional factor: SF1 (steroidogenic factor 1). These transcriptional factors are bound on an enhancer called: TESCO (Testis-Specific Enhancer of &#039;&#039;SOX9&#039;&#039; core element). The binding of a transcriptional factor on an enhancer provokes a curvature of the DNA (≈75°), allowing a stabilization of the elongation complex on the &#039;&#039;SOX9&#039;&#039; promoter. The SOX9 protein activates the gene &#039;&#039;AMH&#039;&#039; (Anti-Mullerian Hormone)&amp;lt;ref&amp;gt;[http://www.ebi.ac.uk/interpro/entry/IPR006799?q=AMH EBI-Interpro: Anti-Mullerian-Hormon, N-term] &amp;lt;/ref&amp;gt;. Therefore, it allows the degeneration of the channels of Müller in male&amp;lt;ref name=&amp;quot;Harley&amp;quot; /&amp;gt;.&lt;br /&gt;
===Cathecolamines regulation===&lt;br /&gt;
&lt;br /&gt;
It has been shown that SRY is present in brain regions and activates the Tyrosine-3-Hydroxylase expression. This enzyme catalyses the rate-limiting step of catecholamine synthesis (L-Tyrosine to L-DOPA). Furthermore, SRY also activates the expression of Monoamine Oxidase A which is responsible for the inactivation of catecholamines. Therefore, it regulates both positively and negatively the catecholamines concentration&amp;lt;ref name=&amp;quot;Veitia&amp;quot;&amp;gt;PMID: 24604382&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Other extra-testicular effects===&lt;br /&gt;
&lt;br /&gt;
Some knock-down experiments have shown that SRY may also be a major actor in the dopamine pathway. On the peripheral side, it seems to regulate noradrenaline levels and blood pressure&amp;lt;ref name=&amp;quot;Veitia&amp;quot; /&amp;gt;. A researcher who contributed to discovering these effects says it might explain why &amp;quot;the aggressive fight-or-flight reaction is more dominant in men, while women predominantly adopt a less aggressive tend-and-befriend response&amp;quot;&amp;lt;ref&amp;gt;Cohen, Tamara. The &#039;macho&#039; gene that makes men behave aggressively has been found. The Daily Mail (2012). [http://www.dailymail.co.uk/sciencetech/article-2111668/The-macho-gene-makes-men-aggressive-found.html#ixzz3yZC2BV4k]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
It has been shown that SRY may be involved in the regulation of the renin-angiotensin system in mice. Indeed, sequence mutations of the protein lead to hypertension. Because the human&#039;s SRY organisation is very closed to the mouse&#039;s, it has been proposed that SRY may have the same function in humans but it has not been studied directly&amp;lt;ref&amp;gt;PMID:22315667&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
== Diseases==&lt;br /&gt;
&lt;br /&gt;
=== Swyer syndrome (AKA XY gonadal dysgenis) :===&lt;br /&gt;
&lt;br /&gt;
If the TDF protein is not able to bind its targeted DNA sequences, the genes responsible for the testis development are not expressed. The patient owning this defective protein will then develop female characters, even though he has a XY karyotype. This phenomenon is known as the &amp;quot;Swyer Syndrome&amp;quot;. &lt;br /&gt;
Different causes can explain this &amp;quot;XY gonadal dysgenis&amp;quot;, as it is also called. About thirty mutations (named [http://www.uniprot.org/uniprot/Q05066#sequences &amp;quot;SRXY1&amp;quot;]) in the SRY gene have been shown to drive this phenotype development. It can also be due to crossovers during a meiosis. If a Y chromosome portion carrying the SRY gene is recombined into a X chromosome, a sperm cell will get this abnormal Y chromosome. If it then fecundates, a XY karyotype without any SRY gene will be formed. &lt;br /&gt;
&lt;br /&gt;
=== De La Chapelle syndrome (AKA XX male syndrome) :===&lt;br /&gt;
&lt;br /&gt;
From the meiosis just described would also result an abnormal X chromosome, carrying the SRY gene. If the sperm cell owning this chromosome fecundates an ovule, the resulting newborn will have a XX karyotype but a male phenotype. This is called the &amp;quot;De La Chapelle syndrome&amp;quot;. In this case, the patient can either develop testis or both testis and ovarian tissues. As some epigenetic mechanisms can inactivate the X chromosome carrying SRY, this syndrome keeps most of the patients sterile&amp;lt;ref&amp;gt;PMID: 4622299&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Hepatocellular carcinoma===&lt;br /&gt;
 &lt;br /&gt;
In the case on a hepatocellular carcinoma, it has been proved that high expression levels of SRY help cancer progression and poor patient survival. However, it still seems that hepatocellular carcinoma is not most likely to develop in men&amp;lt;ref&amp;gt;PMID: 25274159&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
== Structural highlights ==&lt;br /&gt;
&lt;br /&gt;
This is a sample scene created with SAT to &amp;lt;scene name=&amp;quot;/12/3456/Sample/1&amp;quot;&amp;gt;color&amp;lt;/scene&amp;gt; by Group, and another to make &amp;lt;scene name=&amp;quot;/12/3456/Sample/2&amp;quot;&amp;gt;a transparent representation&amp;lt;/scene&amp;gt; of the protein. You can make your own scenes on SAT starting from scratch or loading and editing one of these sample scenes.&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_1/3&#039;&amp;gt;Helix 1&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_2/2&#039;&amp;gt;Helix 2&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_3/1&#039;&amp;gt;Helix 3&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Long_arm_28a/1&#039;&amp;gt;Long arm (28A)&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Short_arm_22a/1&#039;&amp;gt;Short arm (22A)&amp;lt;/scene&amp;gt;&lt;br /&gt;
&amp;lt;/StructureSection&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== References ==&lt;br /&gt;
&amp;lt;references/&amp;gt;&lt;/div&gt;</summary>
		<author><name>Fantin Mesny</name></author>
	</entry>
	<entry>
		<id>https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2526307</id>
		<title>Sandbox Reserved 1120</title>
		<link rel="alternate" type="text/html" href="https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2526307"/>
		<updated>2016-01-30T14:42:29Z</updated>

		<summary type="html">&lt;p&gt;Fantin Mesny: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;StructureSection load=&#039;1hry&#039; size=&#039;340&#039; frame=&#039;true&#039; side=&#039;right&#039; caption=&#039;The SRY protein linked to DNA&#039; scene=&#039;71/719861/Base/1&#039;&amp;gt;&lt;br /&gt;
{{SRY protein (AKA TDF protein)}}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td colspan=&#039;2&#039;&amp;gt;The SRY protein is a 204 residues-long monomeric polypeptide. It is encoded by the SRY gene and is involved in the sex determination in mammals by being responsible for the gonadogenesis and so the male sexual development. It is the HMG-box that gives to the protein its ability to bind DNA by its minor groove&amp;lt;ref name =&amp;quot;Tang&amp;quot;&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;.&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr id=&#039;related&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;[[Related_structure|Related:]]&amp;lt;/b&amp;gt;&amp;lt;/td&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;[[1hrz|1hrz]]&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr id=&#039;resources&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Resources:&amp;lt;/b&amp;gt;&amp;lt;/td&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;&amp;lt;span class=&#039;plainlinks&#039;&amp;gt;[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=1hry FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=1hry OCA], [http://pdbe.org/1hry PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=1hry RCSB], [http://www.ebi.ac.uk/pdbsum/1hry PDBsum]&lt;br /&gt;
&amp;lt;tr id=&#039;Gene&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Encoded by&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;The SRY gene codes for the SRY protein&lt;br /&gt;
&amp;lt;tr id=&#039;Length&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Length&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;204 residues&lt;br /&gt;
&amp;lt;tr id=&#039;Molecular weight&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Molecular weight&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;≈23kDa&lt;br /&gt;
&amp;lt;tr id=&#039;DNA target sequence&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;DNA target sequence&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;(5&#039;-dGCACAAAC)&lt;br /&gt;
&amp;lt;tr id=&#039;Regulation&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Regulation&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;[https://en.wikipedia.org/wiki/Steroidogenic_factor_1 Sf1];[https://en.wikipedia.org/wiki/Sp1_transcription_factor Sp1] (binding site in the promoter of SRY : -150),[https://en.wikipedia.org/wiki/WT1 WT1] (binding site in the promoter of SRY : -87)&lt;br /&gt;
&amp;lt;tr id=&#039;Role&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Role&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;Transcription factor&lt;br /&gt;
&amp;lt;tr id=&#039;Genes targeted&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Genes targeted&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;SOX9&lt;br /&gt;
&lt;br /&gt;
&amp;lt;/span&amp;gt;&lt;br /&gt;
&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;/table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==History==&lt;br /&gt;
&lt;br /&gt;
After centuries of unfounded theories mainly based on environmental factors, the first molecular theory concerning the sex determination appeared in 1891. At this time, the german biologist Hermann Henking was studying sperm formation in wasps. As a chromosome which was not present in all the wasps looked different from the others, he suspected it to play a role in sex determination and called it the &amp;quot;X chromosome&amp;quot;.&lt;br /&gt;
Ten years later, Clarence Erwin McClung saw that this chromosome behaved differently during the meiosis and was only present in half the sperm cells of grasshoppers. As the main characteristic that varies in 50/50 proportions among zygotes is the sex, McClung suspected the X chromosome to be implicated in sexual development. &lt;br /&gt;
In 1905, Nettie Stevens discovered the &amp;quot;Y chromosome&amp;quot; (and the female XX and male XY patterns) while she was counting the chromosomes of beetles under the microscope&amp;lt;ref&amp;gt;Sumner, A. T. Sex Chromosomes and Sex Determination. Chromosomes: Organization and Function, 97-108. [http://www.nature.com/scitable/nated/topicpage/Sex-Chromosomes-and-Sex-Determination-44565]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
During the next decades, a few theories were in competition. In 1921, Calvin Bridges&#039;s works on &#039;&#039;Drosophila melanogaster&#039;&#039; seemed to reveal that male characters acquisition is due to a genic balance between the genes contained in the X chromosome and those contained in the autosomes&amp;lt;ref&amp;gt;PMID: 17769897&amp;lt;/ref&amp;gt;.&lt;br /&gt;
In 1930, Ronald Fisher introduced the first Y-based control of sex theory by proposing two different models : either all the genes responsible for the male characters are located on the Y chromosome or there is a Y-located gene which regulates the expression of genes elsewhere in the genome&amp;lt;ref name=&amp;quot;Goodfellow&amp;quot;&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt;.&lt;br /&gt;
As Alfred Jost had shown the testosterone produced by the testis is responsible for the entire male phenotype acquisition&amp;lt;ref&amp;gt;PMID: 4805859&amp;lt;/ref&amp;gt;, Peter Neville Goodfellow proposed in 1988, that there is a gene (&#039;&#039;TDF&#039;&#039; in human, &#039;&#039;Tdy&#039;&#039; in mice)  on the Y chromosome which drives the development of the testis&amp;lt;ref name=&amp;quot;Goodfellow&amp;quot; /&amp;gt;. In 1990, Goodfellow&#039;s hypothesis was validated with the discovery of &#039;&#039;Tdy&#039;&#039;&#039;s localisation. This gene&#039;s product (expressed during the male gonadal development) owns an amino-acid motif which shows homology to other known or putative DNA-binding domains. &#039;&#039;Tdy&#039;&#039; is therefore a transcriptional factor&amp;lt;ref&amp;gt;PMID: 2374589&amp;lt;/ref&amp;gt;. The same year, the human &#039;&#039;SRY&#039;&#039; gene (accepted later as the &#039;&#039;TDF&#039;&#039;) was discovered&amp;lt;ref&amp;gt;PMID: 1695712&amp;lt;/ref&amp;gt;. &lt;br /&gt;
Three dimensional structure of the SRY protein was determined in 1995 using NMR spectroscopy&amp;lt;ref&amp;gt;PMID:7774012&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
==SRY gene==&lt;br /&gt;
&lt;br /&gt;
The SRY gene encodes the SRY protein. The SRY protein is a transcriptional factor that induces the male phenotype in the embryo. The SRY gene is located on the [https://en.wikipedia.org/wiki/Y_chromosome Y chromosome] in the short arm (p) 11.3 &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/gene/6736 NCBI gene]&amp;lt;/ref&amp;gt;. This gene has only one exon that contains the HMG domain (DNA-binding High-Mobility Group box domain). It means that SRY mRNA does not have an alternative splicing, so there is only one isoforme of SRY protein&amp;lt;ref name=&amp;quot;McE&amp;quot;&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;. Moreover, the human genome contains only one copy of the SRY gene, whereas the mouse genome contains 6 copy of this gene&amp;lt;ref&amp;gt; Sekido R, Lovell-Badge R. Genetic control of testis development. Sex Dev Genet Mol Biol Evol Endocrinol Embryol Pathol Sex Determ Differ. 2013;7(1-3):21–32 &amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Sequence of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:90%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
&amp;gt;gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/nuccore NCBI nucleotide]&amp;lt;/ref&amp;gt;&lt;br /&gt;
TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT&lt;br /&gt;
TTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACA&lt;br /&gt;
&amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;ATG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;CAATCATATGCTTCTGCTATGTTAAGCGTATTCAACAGCGATGATTACAGTCCAGCTGTGCAAGAGAAT&lt;br /&gt;
ATTCCCGCTCTCCGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTAAGTATCAGTGTGAAA&lt;br /&gt;
CGGGAGAAAACAGTAAAGGCAACGTCCAGGATAGAGTGAAGCGACCCATGAACGCATTCATCGTGTGGTC&lt;br /&gt;
&#039;&#039;&#039;TCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCAGAGATCAGCAAGCAGCTG&lt;br /&gt;
&#039;&#039;&#039;GGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCATTCTTCCAGGAGGCACAGAAATTACAGG&lt;br /&gt;
&#039;&#039;&#039;CCATGCACAGAGAGAAATACCCGAATTATAAGTATCGA&#039;&#039;&#039;CCTCGTCGGAAGGCGAAGATGCTGCCGAAGAA&lt;br /&gt;
TTGCAGTTTGCTTCCCGCAGATCCCGCTTCGGTACTCTGCAGCGAAGTGCAACTGGACAACAGGTTGTAC&lt;br /&gt;
AGGGATGACTGTACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAACG&lt;br /&gt;
CAGCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTG&amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;TAG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;GACAATCGGGTAACATT&lt;br /&gt;
GGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCACTTTCTTATGTTTAGTTT&lt;br /&gt;
CAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCATTTCA&amp;lt;/small&amp;gt;&lt;br /&gt;
&lt;br /&gt;
(Legend : &amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Initiation codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt; ; &amp;lt;b&amp;gt;HMG sequence&amp;lt;/b&amp;gt; ; &amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Stop codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;)&lt;br /&gt;
&amp;lt;/div&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Regulation of the expression of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
In humans, the SRY promoter is located between −408 and −95 bp. Moreover, the SRY gene has enhancers at -727 pb. The linkage between regulatory proteins and these enhancers has the property to increase the production of SRY proteins. These regulatory proteins could be: SF1 (steroidogenic factor 1), SP1  and WT 1 (Wilms tumor)&amp;lt;ref name=&amp;quot;Harley&amp;quot;&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;SF1&#039;&#039;&#039;: this transcriptional factor belongs to the family of nuclear hormone receptors and contains a zinc finger. The activation of this protein requires a ligand (hormone).&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;SP1&#039;&#039;&#039;: this transcriptional factor is an ubiquitous protein which binds rich GC-sites and is implicated in the transcription of many genes. Moreover, this protein contains a zinc finger.&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;WT1&#039;&#039;&#039; :this transcriptional factor transactivates the SRY gene. It contains a zinc finger&amp;lt;ref&amp;gt;Larney C, Bailey TL, Koopman P. Switching on sex: transcriptional regulation of the testis-determining gene Sry. Dev Camb Engl. 2014 Jun;141(11):2195–205&amp;lt;/ref&amp;gt;. &lt;br /&gt;
&lt;br /&gt;
==Structure==&lt;br /&gt;
&lt;br /&gt;
===The SRY-HMG domain (HMG-Box)===&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;&#039;SRY-HMG&#039;&#039;&#039; stands for &#039;&#039;&#039;S&#039;&#039;&#039;ex determining &#039;&#039;&#039;R&#039;&#039;&#039;egion &#039;&#039;&#039;Y&#039;&#039;&#039; - &#039;&#039;&#039;H&#039;&#039;&#039;igh &#039;&#039;&#039;M&#039;&#039;&#039;obility &#039;&#039;&#039;G&#039;&#039;&#039;roup domain.&lt;br /&gt;
It is approximately 80 residues-long. It mediates the binding of the protein to the minor groove of DNA. It is the most important part of the SRY protein. Not only because it enables  the protein to bind the DNA but also because even a single mutation can cause an inactivation of the protein.&lt;br /&gt;
&lt;br /&gt;
It has a twisted L shape: it has a long (28Å) and a short (22Å) arm. The HMG Box is made of 3 helices. Its N-term and C-term domains are irregular. The overall structure is stabilized by a hydrophobic core especially at the intersection of the 3 helices where 3 aromatics cycles meet, surrounded by aliphatic aminoacids.&lt;br /&gt;
See the different structures:&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_1/3&#039;&amp;gt;Helix 1&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_2/2&#039;&amp;gt;Helix 2&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_3/1&#039;&amp;gt;Helix 3&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Long_arm_28a/1&#039;&amp;gt;Long arm (28Å)&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Short_arm_22a/1&#039;&amp;gt;Short arm (22Å)&amp;lt;/scene&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The interaction between the HMG-Box and DNA is specific and stable.  It is mostly hydrophobic. It permits the DNA to bend of DNA (≈75°). Only one molecule of water interfaces the Box and the DNA. The complex is stabilized by salt bridges between positively charged residues of the HMG domain and negatively charged phosphates&amp;lt;ref name=&amp;quot;Tang&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
[[Image:HHMG-bitmap.png|thumb|alt=Image bitmap|Linear structure of hHMG domain]]&lt;br /&gt;
&lt;br /&gt;
The binding of SRY on DNA is specific. The DNA target site is a DNA octamer :&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:30%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
(5&#039;-dGCACAAAC)&amp;lt;br/&amp;gt;&lt;br /&gt;
(5&#039;-dGTTTGTGC)&lt;br /&gt;
&amp;lt;/small&amp;gt;&amp;lt;/div&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
This sequence is found in the promoters of genes expressed during the testicular development.&lt;br /&gt;
The bend of DNA enables the recruitment of different proteins and the building of massive proteins-DNA complexes that could change the expression of different genes&amp;lt;ref&amp;gt;PMID:11563911&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
Even if the most important function of the HMG box is binding and bending DNA, it is also involved in DNA condensation, recombination and repair.&lt;br /&gt;
&lt;br /&gt;
There are two kinds of proteins that contain a HMG box:&lt;br /&gt;
* &#039;&#039;&#039;HMG1&#039;&#039;&#039; : It is expressed in few cell types. It is found in transcription factors that contain a single HMG box. The binding of a DNA sequence is specific.&lt;br /&gt;
* &#039;&#039;&#039;HMG2&#039;&#039;&#039; : It is found in all cell types and is abundant in chromatin. These proteins can contain two or more HMG boxes that can non-specifically bind DNA. &lt;br /&gt;
&lt;br /&gt;
===General structure of SRY===&lt;br /&gt;
&lt;br /&gt;
The overall structure of SRY is organized around the HMG-box.&lt;br /&gt;
3 domains:&lt;br /&gt;
* N-term domain&lt;br /&gt;
* Central domain : DNA binding (HMG box)&lt;br /&gt;
* C-term domain&lt;br /&gt;
&lt;br /&gt;
== Function ==&lt;br /&gt;
&lt;br /&gt;
===Sex determining===&lt;br /&gt;
&lt;br /&gt;
It acts like a sex determining factor thanks to its transcriptional activity. It inhibits the development of female sex structures in the embryonic individual.&lt;br /&gt;
&lt;br /&gt;
The SRY protein contains nuclear localization signals in N and C terminals. An acetylation of these domains allows the exportation of the SRY protein to the nucleus&amp;lt;ref name=&amp;quot;Harley&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
The SRY protein activates the &#039;&#039;SOX9&#039;&#039; (SRY-box9) gene &amp;lt;ref name=&amp;quot;McE&amp;quot; /&amp;gt;. This gene is found in long arm 24.3 of the chromosome 17&amp;lt;ref&amp;gt; NCBI [http://www.ncbi.nlm.nih.gov/gene/6662 NCBI gene: SOX9 SRY-BOX9 Homo sapiens] &amp;lt;/ref&amp;gt; and is implicated in the stimulation of the differentiation of pre-Sertori into Sertoli cells rather than granulosa cells.&lt;br /&gt;
&lt;br /&gt;
The activation of &#039;&#039;SOX&#039;&#039;9 is done by the SRY protein and another transcriptional factor: SF1 (steroidogenic factor 1). These transcriptional factors are bound on an enhancer called: TESCO (Testis-Specific Enhancer of &#039;&#039;SOX9&#039;&#039; core element). The binding of a transcriptional factor on an enhancer provokes a curvature of the DNA (≈75°), allowing a stabilization of the elongation complex on the &#039;&#039;SOX9&#039;&#039; promoter. The SOX9 protein activates the gene &#039;&#039;AMH&#039;&#039; (Anti-Mullerian Hormone)&amp;lt;ref&amp;gt;[http://www.ebi.ac.uk/interpro/entry/IPR006799?q=AMH EBI-Interpro: Anti-Mullerian-Hormon, N-term] &amp;lt;/ref&amp;gt;. Therefore, it allows the degeneration of the channels of Müller in male&amp;lt;ref name=&amp;quot;Harley&amp;quot; /&amp;gt;.&lt;br /&gt;
===Cathecolamines regulation===&lt;br /&gt;
&lt;br /&gt;
It has been shown that SRY is present in brain regions and activates the Tyrosine-3-Hydroxylase expression. This enzyme catalyses the rate-limiting step of catecholamine synthesis (L-Tyrosine to L-DOPA). Furthermore, SRY also activates the expression of Monoamine Oxidase A which is responsible for the inactivation of catecholamines. Therefore, it regulates both positively and negatively the catecholamines concentration&amp;lt;ref name=&amp;quot;Veitia&amp;quot;&amp;gt;PMID: 24604382&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Other extra-testicular effects===&lt;br /&gt;
&lt;br /&gt;
Some knock-down experiments have shown that SRY may also be a major actor in the dopamine pathway. On the peripheral side, it seems to regulate noradrenaline levels and blood pressure&amp;lt;ref name=&amp;quot;Veitia&amp;quot; /&amp;gt;. A researcher who contributed to discovering these effects says it might explain why &amp;quot;the aggressive fight-or-flight reaction is more dominant in men, while women predominantly adopt a less aggressive tend-and-befriend response&amp;quot;&amp;lt;ref&amp;gt;Cohen, Tamara. The &#039;macho&#039; gene that makes men behave aggressively has been found. The Daily Mail (2012). [http://www.dailymail.co.uk/sciencetech/article-2111668/The-macho-gene-makes-men-aggressive-found.html#ixzz3yZC2BV4k]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
It has been shown that SRY may be involved in the regulation of the renin-angiotensin system in mice. Indeed, sequence mutations of the protein lead to hypertension. Because the human&#039;s SRY organisation is very closed to the mouse&#039;s, it has been proposed that SRY may have the same function in humans but it has not been studied directly&amp;lt;ref&amp;gt;PMID:22315667&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
== Diseases==&lt;br /&gt;
&lt;br /&gt;
=== Swyer syndrome (AKA XY gonadal dysgenis) :===&lt;br /&gt;
&lt;br /&gt;
If the TDF protein is not able to bind its targeted DNA sequences, the genes responsible for the testis development are not expressed. The patient owning this defective protein will then develop female characters, even though he has a XY karyotype. This phenomenon is known as the &amp;quot;Swyer Syndrome&amp;quot;. &lt;br /&gt;
Different causes can explain this &amp;quot;XY gonadal dysgenis&amp;quot;, as it is also called. About thirty mutations (named [http://www.uniprot.org/uniprot/Q05066#sequences &amp;quot;SRXY1&amp;quot;]) in the SRY gene have been shown to drive this phenotype development. It can also be due to crossovers during a meiosis. If a Y chromosome portion carrying the SRY gene is recombined into a X chromosome, a sperm cell will get this abnormal Y chromosome. If it then fecundates, a XY karyotype without any SRY gene will be formed. &lt;br /&gt;
&lt;br /&gt;
=== De La Chapelle syndrome (AKA XX male syndrome) :===&lt;br /&gt;
&lt;br /&gt;
From the meiosis just described would also result an abnormal X chromosome, carrying the SRY gene. If the sperm cell owning this chromosome fecundates an ovule, the resulting newborn will have a XX karyotype but a male phenotype. This is called the &amp;quot;De La Chapelle syndrome&amp;quot;. In this case, the patient can either develop testis or both testis and ovarian tissues. As some epigenetic mechanisms can inactivate the X chromosome carrying SRY, this syndrome keeps most of the patients sterile&amp;lt;ref&amp;gt;PMID: 4622299&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Hepatocellular carcinoma===&lt;br /&gt;
 &lt;br /&gt;
In the case on a hepatocellular carcinoma, it has been proved that high expression levels of SRY help cancer progression and poor patient survival. However, it still seems that hepatocellular carcinoma is not most likely to develop in men&amp;lt;ref&amp;gt;PMID: 25274159&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
== Structural highlights ==&lt;br /&gt;
&lt;br /&gt;
This is a sample scene created with SAT to &amp;lt;scene name=&amp;quot;/12/3456/Sample/1&amp;quot;&amp;gt;color&amp;lt;/scene&amp;gt; by Group, and another to make &amp;lt;scene name=&amp;quot;/12/3456/Sample/2&amp;quot;&amp;gt;a transparent representation&amp;lt;/scene&amp;gt; of the protein. You can make your own scenes on SAT starting from scratch or loading and editing one of these sample scenes.&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_1/3&#039;&amp;gt;Helix 1&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_2/2&#039;&amp;gt;Helix 2&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_3/1&#039;&amp;gt;Helix 3&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Long_arm_28a/1&#039;&amp;gt;Long arm (28A)&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Short_arm_22a/1&#039;&amp;gt;Short arm (22A)&amp;lt;/scene&amp;gt;&lt;br /&gt;
&amp;lt;/StructureSection&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== References ==&lt;br /&gt;
&amp;lt;references/&amp;gt;&lt;/div&gt;</summary>
		<author><name>Fantin Mesny</name></author>
	</entry>
	<entry>
		<id>https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2526294</id>
		<title>Sandbox Reserved 1120</title>
		<link rel="alternate" type="text/html" href="https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2526294"/>
		<updated>2016-01-30T14:36:24Z</updated>

		<summary type="html">&lt;p&gt;Fantin Mesny: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{Sandbox_Reserved_ESBS_2015}}&amp;lt;!-- PLEASE ADD YOUR CONTENT BELOW HERE --&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;StructureSection load=&#039;1hry&#039; size=&#039;340&#039; frame=&#039;true&#039; side=&#039;right&#039; caption=&#039;The SRY protein linked to DNA&#039; scene=&#039;71/719861/Base/1&#039;&amp;gt;&lt;br /&gt;
{{SRY protein (AKA TDF protein)}}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td colspan=&#039;2&#039;&amp;gt;The SRY protein is a 204 residues-long monomeric polypeptide. It is encoded by the SRY gene and is involved in the sex determination in mammals by being responsible for the gonadogenesis and so the male sexual development. It is the HMG-box that gives to the protein its ability to bind DNA by its minor groove&amp;lt;ref name =&amp;quot;Tang&amp;quot;&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;.&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr id=&#039;related&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;[[Related_structure|Related:]]&amp;lt;/b&amp;gt;&amp;lt;/td&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;[[1hrz|1hrz]]&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr id=&#039;resources&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Resources:&amp;lt;/b&amp;gt;&amp;lt;/td&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;&amp;lt;span class=&#039;plainlinks&#039;&amp;gt;[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=1hry FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=1hry OCA], [http://pdbe.org/1hry PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=1hry RCSB], [http://www.ebi.ac.uk/pdbsum/1hry PDBsum]&lt;br /&gt;
&amp;lt;tr id=&#039;Gene&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Encoded by&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;The SRY gene codes for the SRY protein&lt;br /&gt;
&amp;lt;tr id=&#039;Length&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Length&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;204 residues&lt;br /&gt;
&amp;lt;tr id=&#039;Molecular weight&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Molecular weight&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;≈23kDa&lt;br /&gt;
&amp;lt;tr id=&#039;DNA target sequence&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;DNA target sequence&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;(5&#039;-dGCACAAAC)&lt;br /&gt;
&amp;lt;tr id=&#039;Regulation&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Regulation&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;[https://en.wikipedia.org/wiki/Steroidogenic_factor_1 Sf1];[https://en.wikipedia.org/wiki/Sp1_transcription_factor Sp1] (binding site in the promoter of SRY : -150),[https://en.wikipedia.org/wiki/WT1 WT1] (binding site in the promoter of SRY : -87)&lt;br /&gt;
&amp;lt;tr id=&#039;Role&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Role&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;Transcription factor&lt;br /&gt;
&amp;lt;tr id=&#039;Genes targeted&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Genes targeted&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;SOX9&lt;br /&gt;
&lt;br /&gt;
&amp;lt;/span&amp;gt;&lt;br /&gt;
&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;/table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==History==&lt;br /&gt;
&lt;br /&gt;
After centuries of unfounded theories mainly based on environmental factors, the first molecular theory concerning the sex determination appeared in 1891. At this time, the german biologist Hermann Henking was studying sperm formation in wasps. As a chromosome which was not present in all the wasps looked different from the others, he suspected it to play a role in sex determination and called it the &amp;quot;X chromosome&amp;quot;.&lt;br /&gt;
Ten years later, Clarence Erwin McClung saw that this chromosome behaved differently during the meiosis and was only present in half the sperm cells of grasshoppers. As the main characteristic that varies in 50/50 proportions among zygotes is the sex, McClung suspected the X chromosome to be implicated in sexual development. &lt;br /&gt;
In 1905, Nettie Stevens discovered the &amp;quot;Y chromosome&amp;quot; (and the female XX and male XY patterns) while she was counting the chromosomes of beetles under the microscope&amp;lt;ref&amp;gt;Sumner, A. T. Sex Chromosomes and Sex Determination. Chromosomes: Organization and Function, 97-108. [http://www.nature.com/scitable/nated/topicpage/Sex-Chromosomes-and-Sex-Determination-44565]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
During the next decades, a few theories were in competition. In 1921, Calvin Bridges&#039;s works on &#039;&#039;Drosophila melanogaster&#039;&#039; seemed to reveal that male characters acquisition is due to a genic balance between the genes contained in the X chromosome and those contained in the autosomes&amp;lt;ref&amp;gt;PMID: 17769897&amp;lt;/ref&amp;gt;.&lt;br /&gt;
In 1930, Ronald Fisher introduced the first Y-based control of sex theory by proposing two different models : either all the genes responsible for the male characters are located on the Y chromosome or there is a Y-located gene which regulates the expression of genes elsewhere in the genome&amp;lt;ref name=&amp;quot;Goodfellow&amp;quot;&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt;.&lt;br /&gt;
As Alfred Jost had shown the testosterone produced by the testis is responsible for the entire male phenotype acquisition&amp;lt;ref&amp;gt;PMID: 4805859&amp;lt;/ref&amp;gt;, Peter Neville Goodfellow proposed in 1988, that there is a gene (&#039;&#039;TDF&#039;&#039; in human, &#039;&#039;Tdy&#039;&#039; in mice)  on the Y chromosome which drives the development of the testis&amp;lt;ref name=&amp;quot;Goodfellow&amp;quot; /&amp;gt;. In 1990, Goodfellow&#039;s hypothesis was validated with the discovery of &#039;&#039;Tdy&#039;&#039;&#039;s localisation. This gene&#039;s product (expressed during the male gonadal development) owns an amino-acid motif which shows homology to other known or putative DNA-binding domains. &#039;&#039;Tdy&#039;&#039; is therefore a transcriptional factor&amp;lt;ref&amp;gt;PMID: 2374589&amp;lt;/ref&amp;gt;. The same year, the human &#039;&#039;SRY&#039;&#039; gene (accepted later as the &#039;&#039;TDF&#039;&#039;) was discovered&amp;lt;ref&amp;gt;PMID: 1695712&amp;lt;/ref&amp;gt;. &lt;br /&gt;
Three dimensional structure of the SRY protein was determined in 1995 using NMR spectroscopy&amp;lt;ref&amp;gt;PMID:7774012&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
==SRY gene==&lt;br /&gt;
&lt;br /&gt;
The SRY gene encodes the SRY protein. The SRY protein is a transcriptional factor that induces the male phenotype in the embryo. The SRY gene is located on the [https://en.wikipedia.org/wiki/Y_chromosome Y chromosome] in the short arm (p) 11.3 &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/gene/6736 NCBI gene]&amp;lt;/ref&amp;gt;. This gene has only one exon that contains the HMG domain (DNA-binding High-Mobility Group box domain). It means that SRY mRNA does not have an alternative splicing, so there is only one isoforme of SRY protein&amp;lt;ref name=&amp;quot;McE&amp;quot;&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;. Moreover, the human genome contains only one copy of the SRY gene, whereas the mouse genome contains 6 copy of this gene&amp;lt;ref&amp;gt; Sekido R, Lovell-Badge R. Genetic control of testis development. Sex Dev Genet Mol Biol Evol Endocrinol Embryol Pathol Sex Determ Differ. 2013;7(1-3):21–32 &amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Sequence of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:90%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
&amp;gt;gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/nuccore NCBI nucleotide]&amp;lt;/ref&amp;gt;&lt;br /&gt;
TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT&lt;br /&gt;
TTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACA&lt;br /&gt;
&amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;ATG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;CAATCATATGCTTCTGCTATGTTAAGCGTATTCAACAGCGATGATTACAGTCCAGCTGTGCAAGAGAAT&lt;br /&gt;
ATTCCCGCTCTCCGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTAAGTATCAGTGTGAAA&lt;br /&gt;
CGGGAGAAAACAGTAAAGGCAACGTCCAGGATAGAGTGAAGCGACCCATGAACGCATTCATCGTGTGGTC&lt;br /&gt;
&#039;&#039;&#039;TCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCAGAGATCAGCAAGCAGCTG&lt;br /&gt;
&#039;&#039;&#039;GGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCATTCTTCCAGGAGGCACAGAAATTACAGG&lt;br /&gt;
&#039;&#039;&#039;CCATGCACAGAGAGAAATACCCGAATTATAAGTATCGA&#039;&#039;&#039;CCTCGTCGGAAGGCGAAGATGCTGCCGAAGAA&lt;br /&gt;
TTGCAGTTTGCTTCCCGCAGATCCCGCTTCGGTACTCTGCAGCGAAGTGCAACTGGACAACAGGTTGTAC&lt;br /&gt;
AGGGATGACTGTACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAACG&lt;br /&gt;
CAGCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTG&amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;TAG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;GACAATCGGGTAACATT&lt;br /&gt;
GGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCACTTTCTTATGTTTAGTTT&lt;br /&gt;
CAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCATTTCA&amp;lt;/small&amp;gt;&lt;br /&gt;
&lt;br /&gt;
(Legend : &amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Initiation codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt; ; &amp;lt;b&amp;gt;HMG sequence&amp;lt;/b&amp;gt; ; &amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Stop codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;)&lt;br /&gt;
&amp;lt;/div&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Regulation of the expression of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
In humans, the SRY promoter is located between −408 and −95 bp. Moreover, the SRY gene has enhancers at -727 pb. The linkage between regulatory proteins and these enhancers has the property to increase the production of SRY proteins. These regulatory proteins could be: SF1 (steroidogenic factor 1), SP1  and WT 1 (Wilms tumor)&amp;lt;ref name=&amp;quot;Harley&amp;quot;&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;SF1&#039;&#039;&#039;: this transcriptional factor belongs to the family of nuclear hormone receptors and contains a zinc finger. The activation of this protein requires a ligand (hormone).&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;SP1&#039;&#039;&#039;: this transcriptional factor is an ubiquitous protein which binds rich GC-sites and is implicated in the transcription of many genes. Moreover, this protein contains a zinc finger.&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;WT1&#039;&#039;&#039; :this transcriptional factor transactivates the SRY gene. It contains a zinc finger&amp;lt;ref&amp;gt;Larney C, Bailey TL, Koopman P. Switching on sex: transcriptional regulation of the testis-determining gene Sry. Dev Camb Engl. 2014 Jun;141(11):2195–205&amp;lt;/ref&amp;gt;. &lt;br /&gt;
&lt;br /&gt;
==Structure==&lt;br /&gt;
&lt;br /&gt;
===The SRY-HMG domain (HMG-Box)===&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;&#039;SRY-HMG&#039;&#039;&#039; stands for &#039;&#039;&#039;S&#039;&#039;&#039;ex determining &#039;&#039;&#039;R&#039;&#039;&#039;egion &#039;&#039;&#039;Y&#039;&#039;&#039; - &#039;&#039;&#039;H&#039;&#039;&#039;igh &#039;&#039;&#039;M&#039;&#039;&#039;obility &#039;&#039;&#039;G&#039;&#039;&#039;roup domain.&lt;br /&gt;
It is approximately 80 residues-long. It mediates the binding of the protein to the minor groove of DNA. It is the most important part of the SRY protein. Not only because it enables  the protein to bind the DNA but also because even a single mutation can cause an inactivation of the protein.&lt;br /&gt;
&lt;br /&gt;
It has a twisted L shape: it has a long (28Å) and a short (22Å) arm. The HMG Box is made of 3 helices. Its N-term and C-term domains are irregular. The overall structure is stabilized by a hydrophobic core especially at the intersection of the 3 helices where 3 aromatics cycles meet, surrounded by aliphatic aminoacids.&lt;br /&gt;
See the different structures:&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_1/3&#039;&amp;gt;Helix 1&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_2/2&#039;&amp;gt;Helix 2&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_3/1&#039;&amp;gt;Helix 3&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Long_arm_28a/1&#039;&amp;gt;Long arm (28Å)&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Short_arm_22a/1&#039;&amp;gt;Short arm (22Å)&amp;lt;/scene&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The interaction between the HMG-Box and DNA is specific and stable.  It is mostly hydrophobic. It permits the DNA to bend of DNA (≈75°). Only one molecule of water interfaces the Box and the DNA. The complex is stabilized by salt bridges between positively charged residues of the HMG domain and negatively charged phosphates&amp;lt;ref name=&amp;quot;Tang&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
[[Image:HHMG-bitmap.png|thumb|alt=Image bitmap|Linear structure of hHMG domain]]&lt;br /&gt;
&lt;br /&gt;
The binding of SRY on DNA is specific. The DNA target site is a DNA octamer :&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:30%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
(5&#039;-dGCACAAAC)&amp;lt;br/&amp;gt;&lt;br /&gt;
(5&#039;-dGTTTGTGC)&lt;br /&gt;
&amp;lt;/small&amp;gt;&amp;lt;/div&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
This sequence is found in the promoters of genes expressed during the testicular development.&lt;br /&gt;
The bend of DNA enables the recruitment of different proteins and the building of massive proteins-DNA complexes that could change the expression of different genes&amp;lt;ref&amp;gt;PMID:11563911&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
Even if the most important function of the HMG box is binding and bending DNA, it is also involved in DNA condensation, recombination and repair.&lt;br /&gt;
&lt;br /&gt;
There are two kinds of proteins that contain a HMG box:&lt;br /&gt;
* &#039;&#039;&#039;HMG1&#039;&#039;&#039; : It is expressed in few cell types. It is found in transcription factors that contain a single HMG box. The binding of a DNA sequence is specific.&lt;br /&gt;
* &#039;&#039;&#039;HMG2&#039;&#039;&#039; : It is found in all cell types and is abundant in chromatin. These proteins can contain two or more HMG boxes that can non-specifically bind DNA. &lt;br /&gt;
&lt;br /&gt;
===General structure of SRY===&lt;br /&gt;
&lt;br /&gt;
The overall structure of SRY is organized around the HMG-box.&lt;br /&gt;
3 domains:&lt;br /&gt;
* N-term domain&lt;br /&gt;
* Central domain : DNA binding (HMG box)&lt;br /&gt;
* C-term domain&lt;br /&gt;
&lt;br /&gt;
== Function ==&lt;br /&gt;
&lt;br /&gt;
===Sex determining===&lt;br /&gt;
&lt;br /&gt;
It acts like a sex determining factor thanks to its transcriptional activity. It inhibits the development of female sex structures in the embryonic individual.&lt;br /&gt;
&lt;br /&gt;
The SRY protein contains nuclear localization signals in N and C terminals. An acetylation of these domains allows the exportation of the SRY protein to the nucleus&amp;lt;ref name=&amp;quot;Harley&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
The SRY protein activates the &#039;&#039;SOX9&#039;&#039; (SRY-box9) gene &amp;lt;ref name=&amp;quot;McE&amp;quot; /&amp;gt;. This gene is found in long arm 24.3 of the chromosome 17&amp;lt;ref&amp;gt; NCBI [http://www.ncbi.nlm.nih.gov/gene/6662 NCBI gene: SOX9 SRY-BOX9 Homo sapiens] &amp;lt;/ref&amp;gt; and is implicated in the stimulation of the differentiation of pre-Sertori into Sertoli cells rather than granulosa cells.&lt;br /&gt;
&lt;br /&gt;
The activation of &#039;&#039;SOX&#039;&#039;9 is done by the SRY protein and another transcriptional factor: SF1 (steroidogenic factor 1). These transcriptional factors are bound on an enhancer called: TESCO (Testis-Specific Enhancer of &#039;&#039;SOX9&#039;&#039; core element). The binding of a transcriptional factor on an enhancer provokes a curvature of the DNA (≈75°), allowing a stabilization of the elongation complex on the &#039;&#039;SOX9&#039;&#039; promoter. The SOX9 protein activates the gene &#039;&#039;AMH&#039;&#039; (Anti-Mullerian Hormone)&amp;lt;ref&amp;gt;[http://www.ebi.ac.uk/interpro/entry/IPR006799?q=AMH EBI-Interpro: Anti-Mullerian-Hormon, N-term] &amp;lt;/ref&amp;gt;. Therefore, it allows the degeneration of the channels of Müller in male&amp;lt;ref name=&amp;quot;Harley&amp;quot; /&amp;gt;.&lt;br /&gt;
===Cathecolamines regulation===&lt;br /&gt;
&lt;br /&gt;
It has been shown that SRY is present in brain regions and activates the Tyrosine-3-Hydroxylase expression. This enzyme catalyses the rate-limiting step of catecholamine synthesis (L-Tyrosine to L-DOPA). Furthermore, SRY also activates the expression of Monoamine Oxidase A which is responsible for the inactivation of catecholamines. Therefore, it regulates both positively and negatively the catecholamines concentration&amp;lt;ref name=&amp;quot;Veitia&amp;quot;&amp;gt;PMID: 24604382&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Other extra-testicular effects===&lt;br /&gt;
&lt;br /&gt;
Some knock-down experiments have shown that SRY may also be a major actor in the dopamine pathway. On the peripheral side, it seems to regulate noradrenaline levels and blood pressure&amp;lt;ref name=&amp;quot;Veitia&amp;quot; /&amp;gt;. A researcher who contributed to discovering these effects says it might explain why &amp;quot;the aggressive fight-or-flight reaction is more dominant in men, while women predominantly adopt a less aggressive tend-and-befriend response&amp;quot;&amp;lt;ref&amp;gt;Cohen, Tamara. The &#039;macho&#039; gene that makes men behave aggressively has been found. The Daily Mail (2012). [http://www.dailymail.co.uk/sciencetech/article-2111668/The-macho-gene-makes-men-aggressive-found.html#ixzz3yZC2BV4k]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
It has been shown that SRY may be involved in the regulation of the renin-angiotensin system in mice. Indeed, sequence mutations of the protein lead to hypertension. Because the human&#039;s SRY organisation is very closed to the mouse&#039;s, it has been proposed that SRY may have the same function in humans but it has not been studied directly&amp;lt;ref&amp;gt;PMID:22315667&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
== Diseases==&lt;br /&gt;
&lt;br /&gt;
=== Swyer syndrome (AKA XY gonadal dysgenis) :===&lt;br /&gt;
&lt;br /&gt;
If the TDF protein is not able to bind its targeted DNA sequences, the genes responsible for the testis development are not expressed. The patient owning this defective protein will then develop female characters, even though he has a XY karyotype. This phenomenon is known as the &amp;quot;Swyer Syndrome&amp;quot;. &lt;br /&gt;
Different causes can explain this &amp;quot;XY gonadal dysgenis&amp;quot;, as it is also called. About thirty mutations (named [http://www.uniprot.org/uniprot/Q05066#sequences &amp;quot;SRXY1&amp;quot;]) in the SRY gene have been shown to drive this phenotype development. It can also be due to crossovers during a meiosis. If a Y chromosome portion carrying the SRY gene is recombined into a X chromosome, a sperm cell will get this abnormal Y chromosome. If it then fecundates, a XY karyotype without any SRY gene will be formed. &lt;br /&gt;
&lt;br /&gt;
=== De La Chapelle syndrome (AKA XX male syndrome) :===&lt;br /&gt;
&lt;br /&gt;
From the meiosis just described would also result an abnormal X chromosome, carrying the SRY gene. If the sperm cell owning this chromosome fecundates an ovule, the resulting newborn will have a XX karyotype but a male phenotype. This is called the &amp;quot;De La Chapelle syndrome&amp;quot;. In this case, the patient can either develop testis or both testis and ovarian tissues. As some epigenetic mechanisms can inactivate the X chromosome carrying SRY, this syndrome keeps most of the patients sterile&amp;lt;ref&amp;gt;PMID: 4622299&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Hepatocellular carcinoma===&lt;br /&gt;
 &lt;br /&gt;
In the case on a hepatocellular carcinoma, it has been proved that high expression levels of SRY help cancer progression and poor patient survival. However, it still seems that hepatocellular carcinoma is not most likely to develop in men&amp;lt;ref&amp;gt;PMID: 25274159&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
== Structural highlights ==&lt;br /&gt;
&lt;br /&gt;
This is a sample scene created with SAT to &amp;lt;scene name=&amp;quot;/12/3456/Sample/1&amp;quot;&amp;gt;color&amp;lt;/scene&amp;gt; by Group, and another to make &amp;lt;scene name=&amp;quot;/12/3456/Sample/2&amp;quot;&amp;gt;a transparent representation&amp;lt;/scene&amp;gt; of the protein. You can make your own scenes on SAT starting from scratch or loading and editing one of these sample scenes.&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_1/3&#039;&amp;gt;Helix 1&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_2/2&#039;&amp;gt;Helix 2&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_3/1&#039;&amp;gt;Helix 3&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Long_arm_28a/1&#039;&amp;gt;Long arm (28A)&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Short_arm_22a/1&#039;&amp;gt;Short arm (22A)&amp;lt;/scene&amp;gt;&lt;br /&gt;
&amp;lt;/StructureSection&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== References ==&lt;br /&gt;
&amp;lt;references/&amp;gt;&lt;/div&gt;</summary>
		<author><name>Fantin Mesny</name></author>
	</entry>
	<entry>
		<id>https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2526256</id>
		<title>Sandbox Reserved 1120</title>
		<link rel="alternate" type="text/html" href="https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2526256"/>
		<updated>2016-01-30T14:01:01Z</updated>

		<summary type="html">&lt;p&gt;Fantin Mesny: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{Sandbox_Reserved_ESBS_2015}}&amp;lt;!-- PLEASE ADD YOUR CONTENT BELOW HERE --&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==SRY protein (AKA TDF protein)==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;StructureSection load=&#039;1hry&#039; size=&#039;340&#039; frame=&#039;true&#039; side=&#039;right&#039; caption=&#039;The SRY protein linked to DNA&#039; scene=&#039;71/719861/Base/1&#039;&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td colspan=&#039;2&#039;&amp;gt;The SRY protein is a 204 residues-long monomeric polypeptide. It is encoded by the SRY gene and is involved in the sex determination in mammals by being responsible for the gonadogenesis and so the male sexual development. It is the HMG-box that gives to the protein its ability to bind DNA by its minor groove&amp;lt;ref name =&amp;quot;Tang&amp;quot;&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;.&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr id=&#039;related&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;[[Related_structure|Related:]]&amp;lt;/b&amp;gt;&amp;lt;/td&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;[[1hrz|1hrz]]&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr id=&#039;resources&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Resources:&amp;lt;/b&amp;gt;&amp;lt;/td&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;&amp;lt;span class=&#039;plainlinks&#039;&amp;gt;[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=1hry FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=1hry OCA], [http://pdbe.org/1hry PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=1hry RCSB], [http://www.ebi.ac.uk/pdbsum/1hry PDBsum]&lt;br /&gt;
&amp;lt;tr id=&#039;Gene&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Encoded by&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;The SRY gene codes for the SRY protein&lt;br /&gt;
&amp;lt;tr id=&#039;Length&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Length&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;204 residues&lt;br /&gt;
&amp;lt;tr id=&#039;Molecular weight&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Molecular weight&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;≈23kDa&lt;br /&gt;
&amp;lt;tr id=&#039;DNA target sequence&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;DNA target sequence&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;(5&#039;-dGCACAAAC)&lt;br /&gt;
&amp;lt;tr id=&#039;Regulation&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Regulation&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;[https://en.wikipedia.org/wiki/Steroidogenic_factor_1 Sf1];[https://en.wikipedia.org/wiki/Sp1_transcription_factor Sp1] (binding site in the promoter of SRY : -150),[https://en.wikipedia.org/wiki/WT1 WT1] (binding site in the promoter of SRY : -87)&lt;br /&gt;
&amp;lt;tr id=&#039;Role&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Role&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;Transcription factor&lt;br /&gt;
&amp;lt;tr id=&#039;Genes targeted&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Genes targeted&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;SOX9&lt;br /&gt;
&lt;br /&gt;
&amp;lt;/span&amp;gt;&lt;br /&gt;
&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;/table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==History==&lt;br /&gt;
&lt;br /&gt;
After centuries of unfounded theories mainly based on environmental factors, the first molecular theory concerning the sex determination appeared in 1891. At this time, the german biologist Hermann Henking was studying sperm formation in wasps. As a chromosome which was not present in all the wasps looked different from the others, he suspected it to play a role in sex determination and called it the &amp;quot;X chromosome&amp;quot;.&lt;br /&gt;
Ten years later, Clarence Erwin McClung saw that this chromosome behaved differently during the meiosis and was only present in half the sperm cells of grasshoppers. As the main characteristic that varies in 50/50 proportions among zygotes is the sex, McClung suspected the X chromosome to be implicated in sexual development. &lt;br /&gt;
In 1905, Nettie Stevens discovered the &amp;quot;Y chromosome&amp;quot; (and the female XX and male XY patterns) while she was counting the chromosomes of beetles under the microscope&amp;lt;ref&amp;gt;Sumner, A. T. Sex Chromosomes and Sex Determination. Chromosomes: Organization and Function, 97-108. [http://www.nature.com/scitable/nated/topicpage/Sex-Chromosomes-and-Sex-Determination-44565]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
During the next decades, a few theories were in competition. In 1921, Calvin Bridges&#039;s works on &#039;&#039;Drosophila melanogaster&#039;&#039; seemed to reveal that male characters acquisition is due to a genic balance between the genes contained in the X chromosome and those contained in the autosomes&amp;lt;ref&amp;gt;PMID: 17769897&amp;lt;/ref&amp;gt;.&lt;br /&gt;
In 1930, Ronald Fisher introduced the first Y-based control of sex theory by proposing two different models : either all the genes responsible for the male characters are located on the Y chromosome or there is a Y-located gene which regulates the expression of genes elsewhere in the genome&amp;lt;ref name=&amp;quot;Goodfellow&amp;quot;&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt;.&lt;br /&gt;
As Alfred Jost had shown the testosterone produced by the testis is responsible for the entire male phenotype acquisition&amp;lt;ref&amp;gt;PMID: 4805859&amp;lt;/ref&amp;gt;, Peter Neville Goodfellow proposed in 1988, that there is a gene (&#039;&#039;TDF&#039;&#039; in human, &#039;&#039;Tdy&#039;&#039; in mice)  on the Y chromosome which drives the development of the testis&amp;lt;ref name=&amp;quot;Goodfellow&amp;quot; /&amp;gt;. In 1990, Goodfellow&#039;s hypothesis was validated with the discovery of &#039;&#039;Tdy&#039;&#039;&#039;s localisation. This gene&#039;s product (expressed during the male gonadal development) owns an amino-acid motif which shows homology to other known or putative DNA-binding domains. &#039;&#039;Tdy&#039;&#039; is therefore a transcriptional factor&amp;lt;ref&amp;gt;PMID: 2374589&amp;lt;/ref&amp;gt;. The same year, the human &#039;&#039;SRY&#039;&#039; gene (accepted later as the &#039;&#039;TDF&#039;&#039;) was discovered&amp;lt;ref&amp;gt;PMID: 1695712&amp;lt;/ref&amp;gt;. &lt;br /&gt;
Three dimensional structure of the SRY protein was determined in 1995 using NMR spectroscopy&amp;lt;ref&amp;gt;PMID:7774012&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
==SRY gene==&lt;br /&gt;
&lt;br /&gt;
The SRY gene encodes the SRY protein. The SRY protein is a transcriptional factor that induces the male phenotype in the embryo. The SRY gene is located on the [https://en.wikipedia.org/wiki/Y_chromosome Y chromosome] in the short arm (p) 11.3 &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/gene/6736 NCBI gene]&amp;lt;/ref&amp;gt;. This gene has only one exon that contains the HMG domain (DNA-binding High-Mobility Group box domain). It means that SRY mRNA does not have an alternative splicing, so there is only one isoforme of SRY protein&amp;lt;ref name=&amp;quot;McE&amp;quot;&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;. Moreover, the human genome contains only one copy of the SRY gene, whereas the mouse genome contains 6 copy of this gene&amp;lt;ref&amp;gt; Sekido R, Lovell-Badge R. Genetic control of testis development. Sex Dev Genet Mol Biol Evol Endocrinol Embryol Pathol Sex Determ Differ. 2013;7(1-3):21–32 &amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Sequence of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:90%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
&amp;gt;gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/nuccore NCBI nucleotide]&amp;lt;/ref&amp;gt;&lt;br /&gt;
TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT&lt;br /&gt;
TTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACA&lt;br /&gt;
&amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;ATG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;CAATCATATGCTTCTGCTATGTTAAGCGTATTCAACAGCGATGATTACAGTCCAGCTGTGCAAGAGAAT&lt;br /&gt;
ATTCCCGCTCTCCGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTAAGTATCAGTGTGAAA&lt;br /&gt;
CGGGAGAAAACAGTAAAGGCAACGTCCAGGATAGAGTGAAGCGACCCATGAACGCATTCATCGTGTGGTC&lt;br /&gt;
&#039;&#039;&#039;TCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCAGAGATCAGCAAGCAGCTG&lt;br /&gt;
&#039;&#039;&#039;GGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCATTCTTCCAGGAGGCACAGAAATTACAGG&lt;br /&gt;
&#039;&#039;&#039;CCATGCACAGAGAGAAATACCCGAATTATAAGTATCGA&#039;&#039;&#039;CCTCGTCGGAAGGCGAAGATGCTGCCGAAGAA&lt;br /&gt;
TTGCAGTTTGCTTCCCGCAGATCCCGCTTCGGTACTCTGCAGCGAAGTGCAACTGGACAACAGGTTGTAC&lt;br /&gt;
AGGGATGACTGTACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAACG&lt;br /&gt;
CAGCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTG&amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;TAG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;GACAATCGGGTAACATT&lt;br /&gt;
GGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCACTTTCTTATGTTTAGTTT&lt;br /&gt;
CAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCATTTCA&amp;lt;/small&amp;gt;&lt;br /&gt;
&lt;br /&gt;
(Legend : &amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Initiation codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt; ; &amp;lt;b&amp;gt;HMG sequence&amp;lt;/b&amp;gt; ; &amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Stop codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;)&lt;br /&gt;
&amp;lt;/div&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Regulation of the expression of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
In humans, the SRY promoter is located between −408 and −95 bp. Moreover, the SRY gene has enhancers at -727 pb. The linkage between regulatory proteins and these enhancers has the property to increase the production of SRY proteins. These regulatory proteins could be: SF1 (steroidogenic factor 1), SP1  and WT 1 (Wilms tumor)&amp;lt;ref name=&amp;quot;Harley&amp;quot;&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;SF1&#039;&#039;&#039;: this transcriptional factor belongs to the family of nuclear hormone receptors and contains a zinc finger. The activation of this protein requires a ligand (hormone).&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;SP1&#039;&#039;&#039;: this transcriptional factor is an ubiquitous protein which binds rich GC-sites and is implicated in the transcription of many genes. Moreover, this protein contains a zinc finger.&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;WT1&#039;&#039;&#039; :this transcriptional factor transactivates the SRY gene. It contains a zinc finger&amp;lt;ref&amp;gt;Larney C, Bailey TL, Koopman P. Switching on sex: transcriptional regulation of the testis-determining gene Sry. Dev Camb Engl. 2014 Jun;141(11):2195–205&amp;lt;/ref&amp;gt;. &lt;br /&gt;
&lt;br /&gt;
==Structure==&lt;br /&gt;
&lt;br /&gt;
===The SRY-HMG domain (HMG-Box)===&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;&#039;SRY-HMG&#039;&#039;&#039; stands for &#039;&#039;&#039;S&#039;&#039;&#039;ex determining &#039;&#039;&#039;R&#039;&#039;&#039;egion &#039;&#039;&#039;Y&#039;&#039;&#039; - &#039;&#039;&#039;H&#039;&#039;&#039;igh &#039;&#039;&#039;M&#039;&#039;&#039;obility &#039;&#039;&#039;G&#039;&#039;&#039;roup domain.&lt;br /&gt;
It is approximately 80 residues-long. It mediates the binding of the protein to the minor groove of DNA. It is the most important part of the SRY protein. Not only because it enables  the protein to bind the DNA but also because even a single mutation can cause an inactivation of the protein.&lt;br /&gt;
&lt;br /&gt;
It has a twisted L shape: it has a long (28Å) and a short (22Å) arm. The HMG Box is made of 3 helices. Its N-term and C-term domains are irregular. The overall structure is stabilized by a hydrophobic core especially at the intersection of the 3 helices where 3 aromatics cycles meet, surrounded by aliphatic aminoacids.&lt;br /&gt;
See the different structures:&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_1/3&#039;&amp;gt;Helix 1&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_2/2&#039;&amp;gt;Helix 2&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_3/1&#039;&amp;gt;Helix 3&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Long_arm_28a/1&#039;&amp;gt;Long arm (28Å)&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Short_arm_22a/1&#039;&amp;gt;Short arm (22Å)&amp;lt;/scene&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The interaction between the HMG-Box and DNA is specific and stable.  It is mostly hydrophobic. It permits the DNA to bend of DNA (≈75°). Only one molecule of water interfaces the Box and the DNA. The complex is stabilized by salt bridges between positively charged residues of the HMG domain and negatively charged phosphates&amp;lt;ref name=&amp;quot;Tang&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
[[Image:HHMG-bitmap.png|thumb|alt=Image bitmap|Linear structure of hHMG domain]]&lt;br /&gt;
&lt;br /&gt;
The binding of SRY on DNA is specific. The DNA target site is a DNA octamer :&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:30%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
(5&#039;-dGCACAAAC)&amp;lt;br/&amp;gt;&lt;br /&gt;
(5&#039;-dGTTTGTGC)&lt;br /&gt;
&amp;lt;/small&amp;gt;&amp;lt;/div&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
This sequence is found in the promoters of genes expressed during the testicular development.&lt;br /&gt;
The bend of DNA enables the recruitment of different proteins and the building of massive proteins-DNA complexes that could change the expression of different genes&amp;lt;ref&amp;gt;PMID:11563911&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
Even if the most important function of the HMG box is binding and bending DNA, it is also involved in DNA condensation, recombination and repair.&lt;br /&gt;
&lt;br /&gt;
There are two kinds of proteins that contain a HMG box:&lt;br /&gt;
* &#039;&#039;&#039;HMG1&#039;&#039;&#039; : It is expressed in few cell types. It is found in transcription factors that contain a single HMG box. The binding of a DNA sequence is specific.&lt;br /&gt;
* &#039;&#039;&#039;HMG2&#039;&#039;&#039; : It is found in all cell types and is abundant in chromatin. These proteins can contain two or more HMG boxes that can non-specifically bind DNA. &lt;br /&gt;
&lt;br /&gt;
===General structure of SRY===&lt;br /&gt;
&lt;br /&gt;
The overall structure of SRY is organized around the HMG-box.&lt;br /&gt;
3 domains:&lt;br /&gt;
* N-term domain&lt;br /&gt;
* Central domain : DNA binding (HMG box)&lt;br /&gt;
* C-term domain&lt;br /&gt;
&lt;br /&gt;
== Function ==&lt;br /&gt;
&lt;br /&gt;
===Sex determining===&lt;br /&gt;
&lt;br /&gt;
It acts like a sex determining factor thanks to its transcriptional activity. It inhibits the development of female sex structures in the embryonic individual.&lt;br /&gt;
&lt;br /&gt;
The SRY protein contains nuclear localization signals in N and C terminals. An acetylation of these domains allows the exportation of the SRY protein to the nucleus&amp;lt;ref name=&amp;quot;Harley&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
The SRY protein activates the &#039;&#039;SOX9&#039;&#039; (SRY-box9) gene &amp;lt;ref name=&amp;quot;McE&amp;quot; /&amp;gt;. This gene is found in long arm 24.3 of the chromosome 17&amp;lt;ref&amp;gt; NCBI [http://www.ncbi.nlm.nih.gov/gene/6662 NCBI gene: SOX9 SRY-BOX9 Homo sapiens] &amp;lt;/ref&amp;gt; and is implicated in the stimulation of the differentiation of pre-Sertori into Sertoli cells rather than granulosa cells.&lt;br /&gt;
&lt;br /&gt;
The activation of &#039;&#039;SOX&#039;&#039;9 is done by the SRY protein and another transcriptional factor: SF1 (steroidogenic factor 1). These transcriptional factors are bound on an enhancer called: TESCO (Testis-Specific Enhancer of &#039;&#039;SOX9&#039;&#039; core element). The binding of a transcriptional factor on an enhancer provokes a curvature of the DNA (≈75°), allowing a stabilization of the elongation complex on the &#039;&#039;SOX9&#039;&#039; promoter. The SOX9 protein activates the gene &#039;&#039;AMH&#039;&#039; (Anti-Mullerian Hormone)&amp;lt;ref&amp;gt;[http://www.ebi.ac.uk/interpro/entry/IPR006799?q=AMH EBI-Interpro: Anti-Mullerian-Hormon, N-term] &amp;lt;/ref&amp;gt;. Therefore, it allows the degeneration of the channels of Müller in male&amp;lt;ref name=&amp;quot;Harley&amp;quot; /&amp;gt;.&lt;br /&gt;
===Cathecolamines regulation===&lt;br /&gt;
&lt;br /&gt;
It has been shown that SRY is present in brain regions and activates the Tyrosine-3-Hydroxylase expression. This enzyme catalyses the rate-limiting step of catecholamine synthesis (L-Tyrosine to L-DOPA). Furthermore, SRY also activates the expression of Monoamine Oxidase A which is responsible for the inactivation of catecholamines. Therefore, it regulates both positively and negatively the catecholamines concentration&amp;lt;ref name=&amp;quot;Veitia&amp;quot;&amp;gt;PMID: 24604382&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Other extra-testicular effects===&lt;br /&gt;
&lt;br /&gt;
Some knock-down experiments have shown that SRY may also be a major actor in the dopamine pathway. On the peripheral side, it seems to regulate noradrenaline levels and blood pressure&amp;lt;ref name=&amp;quot;Veitia&amp;quot; /&amp;gt;. A researcher who contributed to discovering these effects says it might explain why &amp;quot;the aggressive fight-or-flight reaction is more dominant in men, while women predominantly adopt a less aggressive tend-and-befriend response&amp;quot;&amp;lt;ref&amp;gt;Cohen, Tamara. The &#039;macho&#039; gene that makes men behave aggressively has been found. The Daily Mail (2012). [http://www.dailymail.co.uk/sciencetech/article-2111668/The-macho-gene-makes-men-aggressive-found.html#ixzz3yZC2BV4k]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
It has been shown that SRY may be involved in the regulation of the renin-angiotensin system in mice. Indeed, sequence mutations of the protein lead to hypertension. Because the human&#039;s SRY organisation is very closed to the mouse&#039;s, it has been proposed that SRY may have the same function in humans but it has not been studied directly&amp;lt;ref&amp;gt;PMID:22315667&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
== Diseases==&lt;br /&gt;
&lt;br /&gt;
=== Swyer syndrome (AKA XY gonadal dysgenis) :===&lt;br /&gt;
&lt;br /&gt;
If the TDF protein is not able to bind its targeted DNA sequences, the genes responsible for the testis development are not expressed. The patient owning this defective protein will then develop female characters, even though he has a XY karyotype. This phenomenon is known as the &amp;quot;Swyer Syndrome&amp;quot;. &lt;br /&gt;
Different causes can explain this &amp;quot;XY gonadal dysgenis&amp;quot;, as it is also called. About thirty mutations (named [http://www.uniprot.org/uniprot/Q05066#sequences &amp;quot;SRXY1&amp;quot;]) in the SRY gene have been shown to drive this phenotype development. It can also be due to crossovers during a meiosis. If a Y chromosome portion carrying the SRY gene is recombined into a X chromosome, a sperm cell will get this abnormal Y chromosome. If it then fecundates, a XY karyotype without any SRY gene will be formed. &lt;br /&gt;
&lt;br /&gt;
=== De La Chapelle syndrome (AKA XX male syndrome) :===&lt;br /&gt;
&lt;br /&gt;
From the meiosis just described would also result an abnormal X chromosome, carrying the SRY gene. If the sperm cell owning this chromosome fecundates an ovule, the resulting newborn will have a XX karyotype but a male phenotype. This is called the &amp;quot;De La Chapelle syndrome&amp;quot;. In this case, the patient can either develop testis or both testis and ovarian tissues. As some epigenetic mechanisms can inactivate the X chromosome carrying SRY, this syndrome keeps most of the patients sterile&amp;lt;ref&amp;gt;PMID: 4622299&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Hepatocellular carcinoma===&lt;br /&gt;
 &lt;br /&gt;
In the case on a hepatocellular carcinoma, it has been proved that high expression levels of SRY help cancer progression and poor patient survival. However, it still seems that hepatocellular carcinoma is not most likely to develop in men&amp;lt;ref&amp;gt;PMID: 25274159&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
== Structural highlights ==&lt;br /&gt;
&lt;br /&gt;
This is a sample scene created with SAT to &amp;lt;scene name=&amp;quot;/12/3456/Sample/1&amp;quot;&amp;gt;color&amp;lt;/scene&amp;gt; by Group, and another to make &amp;lt;scene name=&amp;quot;/12/3456/Sample/2&amp;quot;&amp;gt;a transparent representation&amp;lt;/scene&amp;gt; of the protein. You can make your own scenes on SAT starting from scratch or loading and editing one of these sample scenes.&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_1/3&#039;&amp;gt;Helix 1&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_2/2&#039;&amp;gt;Helix 2&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_3/1&#039;&amp;gt;Helix 3&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Long_arm_28a/1&#039;&amp;gt;Long arm (28A)&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Short_arm_22a/1&#039;&amp;gt;Short arm (22A)&amp;lt;/scene&amp;gt;&lt;br /&gt;
&amp;lt;/StructureSection&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== References ==&lt;br /&gt;
&amp;lt;references/&amp;gt;&lt;/div&gt;</summary>
		<author><name>Fantin Mesny</name></author>
	</entry>
	<entry>
		<id>https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2526253</id>
		<title>Sandbox Reserved 1120</title>
		<link rel="alternate" type="text/html" href="https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2526253"/>
		<updated>2016-01-30T13:58:28Z</updated>

		<summary type="html">&lt;p&gt;Fantin Mesny: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{Sandbox_Reserved_ESBS_2015}}&amp;lt;!-- PLEASE ADD YOUR CONTENT BELOW HERE --&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==SRY protein (AKA TDF protein)==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;StructureSection load=&#039;1hry&#039; size=&#039;340&#039; frame=&#039;true&#039; side=&#039;right&#039; caption=&#039;The SRY protein linked to DNA&#039; scene=&#039;71/719861/Base/1&#039;&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td colspan=&#039;2&#039;&amp;gt;The SRY protein is a 204 residues-long monomeric polypeptide. It is encoded by the SRY gene and is involved in the sex determination in mammals by being responsible for the gonadogenesis and so the male sexual development. It is the HMG-box that gives to the protein its ability to bind DNA by its minor groove&amp;lt;ref name =&amp;quot;Tang&amp;quot;&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;.&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr id=&#039;related&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;[[Related_structure|Related:]]&amp;lt;/b&amp;gt;&amp;lt;/td&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;[[1hrz|1hrz]]&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr id=&#039;resources&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Resources:&amp;lt;/b&amp;gt;&amp;lt;/td&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;&amp;lt;span class=&#039;plainlinks&#039;&amp;gt;[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=1hry FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=1hry OCA], [http://pdbe.org/1hry PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=1hry RCSB], [http://www.ebi.ac.uk/pdbsum/1hry PDBsum]&lt;br /&gt;
&amp;lt;tr id=&#039;Gene&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Encoded by&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;The SRY gene codes for the SRY protein&lt;br /&gt;
&amp;lt;tr id=&#039;Length&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Length&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;204 residues&lt;br /&gt;
&amp;lt;tr id=&#039;Molecular weight&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Molecular weight&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;≈23kDa&lt;br /&gt;
&amp;lt;tr id=&#039;DNA target sequence&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;DNA target sequence&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;(5&#039;-dGCACAAAC)&lt;br /&gt;
&amp;lt;tr id=&#039;Regulation&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Regulation&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;[https://en.wikipedia.org/wiki/Steroidogenic_factor_1 Sf1];[https://en.wikipedia.org/wiki/Sp1_transcription_factor Sp1] (binding site in the promoter of SRY : -150),[https://en.wikipedia.org/wiki/WT1 WT1] (binding site in the promoter of SRY : -87)&lt;br /&gt;
&amp;lt;tr id=&#039;Role&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Role&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;Transcription factor&lt;br /&gt;
&amp;lt;tr id=&#039;Genes targeted&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Genes targeted&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;SOX9&lt;br /&gt;
&lt;br /&gt;
&amp;lt;/span&amp;gt;&lt;br /&gt;
&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;/table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==History==&lt;br /&gt;
&lt;br /&gt;
After centuries of unfounded theories mainly based on environmental factors, the first molecular theory concerning the sex determination appeared in 1891. At this time, the german biologist Hermann Henking was studying sperm formation in wasps. As a chromosome which was not present in all the wasps looked different from the others, he suspected it to play a role in sex determination and called it the &amp;quot;X chromosome&amp;quot;.&lt;br /&gt;
Ten years later, Clarence Erwin McClung saw that this chromosome behaved differently during the meiosis and was only present in half the sperm cells of grasshoppers. As the main characteristic that varies in 50/50 proportions among zygotes is the sex, McClung suspected the X chromosome to be implicated in sexual development. &lt;br /&gt;
In 1905, Nettie Stevens discovered the &amp;quot;Y chromosome&amp;quot; (and the female XX and male XY patterns) while she was counting the chromosomes of beetles under the microscope&amp;lt;ref&amp;gt;Sumner, A. T. Sex Chromosomes and Sex Determination. Chromosomes: Organization and Function, 97-108. [http://www.nature.com/scitable/nated/topicpage/Sex-Chromosomes-and-Sex-Determination-44565]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
During the next decades, a few theories were in competition. In 1921, Calvin Bridges&#039;s works on &#039;&#039;Drosophila melanogaster&#039;&#039; seemed to reveal that male characters acquisition is due to a genic balance between the genes contained in the X chromosome and those contained in the autosomes&amp;lt;ref&amp;gt;PMID: 17769897&amp;lt;/ref&amp;gt;.&lt;br /&gt;
In 1930, Ronald Fisher introduced the first Y-based control of sex theory by proposing two different models : either all the genes responsible for the male characters are located on the Y chromosome or there is a Y-located gene which regulates the expression of genes elsewhere in the genome&amp;lt;ref name=&amp;quot;Goodfellow&amp;quot;&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt;.&lt;br /&gt;
As Alfred Jost had shown the testosterone produced by the testis is responsible for the entire male phenotype acquisition&amp;lt;ref&amp;gt;PMID: 4805859&amp;lt;/ref&amp;gt;, Peter Neville Goodfellow proposed in 1988, that there is a gene (&#039;&#039;TDF&#039;&#039; in human, &#039;&#039;Tdy&#039;&#039; in mice)  on the Y chromosome which drives the development of the testis&amp;lt;ref name=&amp;quot;Goodfellow&amp;quot; /&amp;gt;. In 1990, Goodfellow&#039;s hypothesis was validated with the discovery of &#039;&#039;Tdy&#039;&#039;&#039;s localisation. This gene&#039;s product (expressed during the male gonadal development) owns an amino-acid motif which shows homology to other known or putative DNA-binding domains. &#039;&#039;Tdy&#039;&#039; is therefore a transcriptional factor&amp;lt;ref&amp;gt;PMID: 2374589&amp;lt;/ref&amp;gt;. The same year, the human &#039;&#039;SRY&#039;&#039; gene (accepted later as the &#039;&#039;TDF&#039;&#039;) was discovered&amp;lt;ref&amp;gt;PMID: 1695712&amp;lt;/ref&amp;gt;. &lt;br /&gt;
Three dimensional structure of the SRY protein was determined in 1995 using NMR spectroscopy&amp;lt;ref&amp;gt;PMID:7774012&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
==SRY gene==&lt;br /&gt;
&lt;br /&gt;
The SRY gene encodes the SRY protein. The SRY protein is a transcriptional factor that induces the male phenotype in the embryo. The SRY gene is located on the [https://en.wikipedia.org/wiki/Y_chromosome Y chromosome] in the short arm (p) 11.3 &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/gene/6736 NCBI gene]&amp;lt;/ref&amp;gt;. This gene has only one exon that contains the HMG domain (DNA-binding High-Mobility Group box domain). It means that SRY mRNA does not have an alternative splicing, so there is only one isoforme of SRY protein&amp;lt;ref name=&amp;quot;McE&amp;quot;&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;. Moreover, the human genome contains only one copy of the SRY gene, whereas the mouse genome contains 6 copy of this gene&amp;lt;ref&amp;gt; Sekido R, Lovell-Badge R. Genetic control of testis development. Sex Dev Genet Mol Biol Evol Endocrinol Embryol Pathol Sex Determ Differ. 2013;7(1-3):21–32 &amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Sequence of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:90%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
&amp;gt;gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/nuccore NCBI nucleotide]&amp;lt;/ref&amp;gt;&lt;br /&gt;
TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT&lt;br /&gt;
TTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACA&lt;br /&gt;
&amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;ATG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;CAATCATATGCTTCTGCTATGTTAAGCGTATTCAACAGCGATGATTACAGTCCAGCTGTGCAAGAGAAT&lt;br /&gt;
ATTCCCGCTCTCCGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTAAGTATCAGTGTGAAA&lt;br /&gt;
CGGGAGAAAACAGTAAAGGCAACGTCCAGGATAGAGTGAAGCGACCCATGAACGCATTCATCGTGTGGTC&lt;br /&gt;
&#039;&#039;&#039;TCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCAGAGATCAGCAAGCAGCTG&lt;br /&gt;
&#039;&#039;&#039;GGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCATTCTTCCAGGAGGCACAGAAATTACAGG&lt;br /&gt;
&#039;&#039;&#039;CCATGCACAGAGAGAAATACCCGAATTATAAGTATCGA&#039;&#039;&#039;CCTCGTCGGAAGGCGAAGATGCTGCCGAAGAA&lt;br /&gt;
TTGCAGTTTGCTTCCCGCAGATCCCGCTTCGGTACTCTGCAGCGAAGTGCAACTGGACAACAGGTTGTAC&lt;br /&gt;
AGGGATGACTGTACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAACG&lt;br /&gt;
CAGCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTG&amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;TAG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;GACAATCGGGTAACATT&lt;br /&gt;
GGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCACTTTCTTATGTTTAGTTT&lt;br /&gt;
CAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCATTTCA&amp;lt;/small&amp;gt;&lt;br /&gt;
&lt;br /&gt;
(Legend : &amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Initiation codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt; ; &amp;lt;b&amp;gt;HMG sequence&amp;lt;/b&amp;gt; ; &amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Stop codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;)&lt;br /&gt;
&amp;lt;/div&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Regulation of the expression of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
In humans, the SRY promoter is located between −408 and −95 bp. Moreover, the SRY gene has enhancers at -727 pb. The linkage between regulatory proteins and these enhancers has the property to increase the production of SRY proteins. These regulatory proteins could be: SF1 (steroidogenic factor 1), SP1  and WT 1 (Wilms tumor)&amp;lt;ref name=&amp;quot;Harley&amp;quot;&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;SF1&#039;&#039;&#039;: this transcriptional factor belongs to the family of nuclear hormone receptors and contains a zinc finger. The activation of this protein requires a ligand (hormone).&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;SP1&#039;&#039;&#039;: this transcriptional factor is an ubiquitous protein which binds rich GC-sites and is implicated in the transcription of many genes. Moreover, this protein contains a zinc finger.&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;WT1&#039;&#039;&#039; :this transcriptional factor transactivates the SRY gene. It contains a zinc finger&amp;lt;ref&amp;gt;Larney C, Bailey TL, Koopman P. Switching on sex: transcriptional regulation of the testis-determining gene Sry. Dev Camb Engl. 2014 Jun;141(11):2195–205&amp;lt;/ref&amp;gt;. &lt;br /&gt;
&lt;br /&gt;
==Structure==&lt;br /&gt;
&lt;br /&gt;
===The SRY-HMG domain (HMG-Box)===&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;&#039;SRY-HMG&#039;&#039;&#039; stands for &#039;&#039;&#039;S&#039;&#039;&#039;ex determining &#039;&#039;&#039;R&#039;&#039;&#039;egion &#039;&#039;&#039;Y&#039;&#039;&#039; - &#039;&#039;&#039;H&#039;&#039;&#039;igh &#039;&#039;&#039;M&#039;&#039;&#039;obility &#039;&#039;&#039;G&#039;&#039;&#039;roup domain.&lt;br /&gt;
It is approximately 80 residues-long. It mediates the binding of the protein to the minor groove of DNA. It is the most important part of the SRY protein. Not only because it enables  the protein to bind the DNA but also because even a single mutation can cause an inactivation of the protein.&lt;br /&gt;
&lt;br /&gt;
It has a twisted L shape: it has a long (28Å) and a short (22Å) arm. The HMG Box is made of 3 helices. Its N-term and C-term domains are irregular. The overall structure is stabilized by a hydrophobic core especially at the intersection of the 3 helices where 3 aromatics cycles meet, surrounded by aliphatic aminoacids.&lt;br /&gt;
See the different structures:&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_1/3&#039;&amp;gt;Helix 1&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_2/2&#039;&amp;gt;Helix 2&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_3/1&#039;&amp;gt;Helix 3&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Long_arm_28a/1&#039;&amp;gt;Long arm (28Å)&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Short_arm_22a/1&#039;&amp;gt;Short arm (22Å)&amp;lt;/scene&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The interaction between the HMG-Box and DNA is specific and stable.  It is mostly hydrophobic. It permits the DNA to bend of DNA (≈75°). Only one molecule of water interfaces the Box and the DNA. The complex is stabilized by salt bridges between positively charged residues of the HMG domain and negatively charged phosphates&amp;lt;ref name=&amp;quot;Tang&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
[[Image:HHMG-bitmap.png|thumb|alt=Image bitmap|Linear structure of hHMG domain]]&lt;br /&gt;
&lt;br /&gt;
The binding of SRY on DNA is specific. The DNA target site is a DNA octamer :&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:30%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
(5&#039;-dGCACAAAC)&amp;lt;br/&amp;gt;&lt;br /&gt;
(5&#039;-dGTTTGTGC)&lt;br /&gt;
&amp;lt;/small&amp;gt;&amp;lt;/div&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
This sequence is found in the promoters of genes expressed during the testicular development.&lt;br /&gt;
The bend of DNA enables the recruitment of different proteins and the building of massive proteins-DNA complexes that could change the expression of different genes&amp;lt;ref&amp;gt;PMID:11563911&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
Even if the most important function of the HMG box is binding and bending DNA, it is also involved in DNA condensation, recombination and repair.&lt;br /&gt;
&lt;br /&gt;
There are two kinds of proteins that contain a HMG box:&lt;br /&gt;
* &#039;&#039;&#039;HMG1&#039;&#039;&#039; : It is expressed in few cell types. It is found in transcription factors that contain a single HMG box. The binding of a DNA sequence is specific.&lt;br /&gt;
* &#039;&#039;&#039;HMG2&#039;&#039;&#039; : It is found in all cell types and is abundant in chromatin. These proteins can contain two or more HMG boxes that can non-specifically bind DNA. &lt;br /&gt;
&lt;br /&gt;
===General structure of SRY===&lt;br /&gt;
&lt;br /&gt;
The overall structure of SRY is organized around the HMG-box.&lt;br /&gt;
3 domains:&lt;br /&gt;
* N-term domain&lt;br /&gt;
* Central domain : DNA binding (HMG box)&lt;br /&gt;
* C-term domain&lt;br /&gt;
&lt;br /&gt;
== Function ==&lt;br /&gt;
&lt;br /&gt;
===Sex determining===&lt;br /&gt;
&lt;br /&gt;
It acts like a sex determining factor thanks to its transcriptional activity. It inhibits the development of female sex structures in the embryonic individual.&lt;br /&gt;
&lt;br /&gt;
The SRY protein contains nuclear localization signals in N and C terminals. An acetylation of these domains allows the exportation of the SRY protein to the nucleus&amp;lt;ref name=&amp;quot;Harley&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
The SRY protein activates the &#039;&#039;SOX9&#039;&#039; (SRY-box9) gene &amp;lt;ref name=&amp;quot;McE&amp;quot; /&amp;gt;. This gene is found in long arm 24.3 of the chromosome 17&amp;lt;ref&amp;gt; NCBI [http://www.ncbi.nlm.nih.gov/gene/6662 NCBI gene: SOX9 SRY-BOX9 Homo sapiens] &amp;lt;/ref&amp;gt; and is implicated in the stimulation of the differentiation of pre-Sertori into Sertoli cells rather than granulosa cells.&lt;br /&gt;
&lt;br /&gt;
The activation of &#039;&#039;SOX&#039;&#039;9 is done by the SRY protein and another transcriptional factor: SF1 (steroidogenic factor 1). These transcriptional factors are bound on an enhancer called: TESCO (Testis-Specific Enhancer of &#039;&#039;SOX9&#039;&#039; core element). The binding of a transcriptional factor on an enhancer provokes a curvature of the DNA (≈75°), allowing a stabilization of the elongation complex on the &#039;&#039;SOX9&#039;&#039; promoter. The SOX9 protein activates the gene &#039;&#039;AMH&#039;&#039; (Anti-Mullerian Hormone)&amp;lt;ref&amp;gt;[http://www.ebi.ac.uk/interpro/entry/IPR006799?q=AMH EBI-Interpro: Anti-Mullerian-Hormon, N-term] &amp;lt;/ref&amp;gt;. Therefore, it allows the degeneration of the channels of Müller in male&amp;lt;ref name=&amp;quot;Harley&amp;quot; /&amp;gt;.&lt;br /&gt;
===Cathecolamines regulation===&lt;br /&gt;
&lt;br /&gt;
It has been shown that SRY is present in brain regions and activates the Tyrosine-3-Hydroxylase expression. This enzyme catalyses the rate-limiting step of catecholamine synthesis (L-Tyrosine to L-DOPA). Furthermore, SRY also activates the expression of Monoamine Oxidase A which is responsible for the inactivation of catecholamines. Therefore, it regulates both positively and negatively the catecholamines concentration&amp;lt;ref name=&amp;quot;Veitia&amp;quot;&amp;gt;PMID: 24604382&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Other extra-testicular effects===&lt;br /&gt;
&lt;br /&gt;
Some knock-down experiments have shown that SRY may also be a major actor in the dopamine pathway. On the peripheral side, it seems to regulate noradrenaline levels and blood pressure&amp;lt;ref name=&amp;quot;Veitia&amp;quot; /&amp;gt;. A researcher who contributed to discovering these effects says it might explain why &amp;quot;the aggressive fight-or-flight reaction is more dominant in men, while women predominantly adopt a less aggressive tend-and-befriend response&amp;quot;&amp;lt;ref&amp;gt;Cohen, Tamara. The &#039;macho&#039; gene that makes men behave aggressively has been found. The Daily Mail (2012). [http://www.dailymail.co.uk/sciencetech/article-2111668/The-macho-gene-makes-men-aggressive-found.html#ixzz3yZC2BV4k]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
It has been shown that SRY may be involved in the regulation of the renin-angiotensin system in mice. Indeed, sequence mutations of the protein lead to hypertension. Because the human&#039;s SRY organisation is very closed to the mouse&#039;s, it has been proposed that SRY may have the same function in humans but it has not been studied directly&amp;lt;ref&amp;gt;PMID:22315667&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
== Diseases==&lt;br /&gt;
&lt;br /&gt;
=== Swyer syndrome (AKA XY gonadal dysgenis) :===&lt;br /&gt;
&lt;br /&gt;
If the TDF protein is not able to bind its targeted DNA sequences, the genes responsible for the testis development are not expressed. The patient owning this defective protein will then develop female characters, even though he has a XY karyotype. This phenomenon is known as the &amp;quot;Swyer Syndrome&amp;quot;. &lt;br /&gt;
Different causes can explain this &amp;quot;XY gonadal dysgenis&amp;quot;, as it is also called. About thirty mutations (named [http://www.uniprot.org/uniprot/Q05066#sequences &amp;quot;SRXY1&amp;quot;]) in the SRY gene have been shown to drive this phenotype development. It can also be due to crossovers during a meiosis. If a Y chromosome portion carrying the SRY gene is recombined into a X chromosome, a sperm cell will get this abnormal Y chromosome. If it then fecundates, a XY karyotype without any SRY gene will be formed. &lt;br /&gt;
&lt;br /&gt;
=== De La Chapelle syndrome (AKA XX male syndrome) :===&lt;br /&gt;
&lt;br /&gt;
From the meiosis just described would also result an abnormal X chromosome, carrying the SRY gene. If the sperm cell owning this chromosome fecundates an ovule, the resulting newborn will have a XX karyotype but a male phenotype. This is called the &amp;quot;De La Chapelle syndrome&amp;quot;. In this case, the patient can either develop testis or both testis and ovarian tissues. As some epigenetic mechanisms can inactivate the X chromosome carrying SRY, this syndrome keeps most of the patients sterile&amp;lt;ref&amp;gt;PMID: 4622299&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Hepatocellular carcinoma===&lt;br /&gt;
 &lt;br /&gt;
In the case on a hepatocellular carcinoma, it has been proved that high expression levels of SRY help cancer progression and poor patient survival. However, it still seems that hepatocellular carcinoma is not most likely to develop in men.&amp;lt;ref&amp;gt;PMID: 25274159&amp;lt;/ref&amp;gt; &lt;br /&gt;
&lt;br /&gt;
== Structural highlights ==&lt;br /&gt;
&lt;br /&gt;
This is a sample scene created with SAT to &amp;lt;scene name=&amp;quot;/12/3456/Sample/1&amp;quot;&amp;gt;color&amp;lt;/scene&amp;gt; by Group, and another to make &amp;lt;scene name=&amp;quot;/12/3456/Sample/2&amp;quot;&amp;gt;a transparent representation&amp;lt;/scene&amp;gt; of the protein. You can make your own scenes on SAT starting from scratch or loading and editing one of these sample scenes.&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_1/3&#039;&amp;gt;Helix 1&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_2/2&#039;&amp;gt;Helix 2&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_3/1&#039;&amp;gt;Helix 3&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Long_arm_28a/1&#039;&amp;gt;Long arm (28A)&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Short_arm_22a/1&#039;&amp;gt;Short arm (22A)&amp;lt;/scene&amp;gt;&lt;br /&gt;
&amp;lt;/StructureSection&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== References ==&lt;br /&gt;
&amp;lt;references/&amp;gt;&lt;/div&gt;</summary>
		<author><name>Fantin Mesny</name></author>
	</entry>
	<entry>
		<id>https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2526249</id>
		<title>Sandbox Reserved 1120</title>
		<link rel="alternate" type="text/html" href="https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2526249"/>
		<updated>2016-01-30T13:55:25Z</updated>

		<summary type="html">&lt;p&gt;Fantin Mesny: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{Sandbox_Reserved_ESBS_2015}}&amp;lt;!-- PLEASE ADD YOUR CONTENT BELOW HERE --&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==SRY protein (AKA TDF protein)==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;StructureSection load=&#039;1hry&#039; size=&#039;340&#039; frame=&#039;true&#039; side=&#039;right&#039; caption=&#039;The SRY protein linked to DNA&#039; scene=&#039;71/719861/Base/1&#039;&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td colspan=&#039;2&#039;&amp;gt;The SRY protein is a 204 residues-long monomeric polypeptide. It is encoded by the SRY gene and is involved in the sex determination in mammals by being responsible for the gonadogenesis and so the male sexual development. It is the HMG-box that gives to the protein its ability to bind DNA by its minor groove. &amp;lt;ref name =&amp;quot;Tang&amp;quot;&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr id=&#039;related&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;[[Related_structure|Related:]]&amp;lt;/b&amp;gt;&amp;lt;/td&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;[[1hrz|1hrz]]&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr id=&#039;resources&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Resources:&amp;lt;/b&amp;gt;&amp;lt;/td&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;&amp;lt;span class=&#039;plainlinks&#039;&amp;gt;[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=1hry FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=1hry OCA], [http://pdbe.org/1hry PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=1hry RCSB], [http://www.ebi.ac.uk/pdbsum/1hry PDBsum]&lt;br /&gt;
&amp;lt;tr id=&#039;Gene&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Encoded by&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;The SRY gene codes for the SRY protein&lt;br /&gt;
&amp;lt;tr id=&#039;Length&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Length&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;204 residues&lt;br /&gt;
&amp;lt;tr id=&#039;Molecular weight&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Molecular weight&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;≈23kDa&lt;br /&gt;
&amp;lt;tr id=&#039;DNA target sequence&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;DNA target sequence&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;(5&#039;-dGCACAAAC)&lt;br /&gt;
&amp;lt;tr id=&#039;Regulation&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Regulation&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;[https://en.wikipedia.org/wiki/Steroidogenic_factor_1 Sf1];[https://en.wikipedia.org/wiki/Sp1_transcription_factor Sp1] (binding site in the promoter of SRY : -150),[https://en.wikipedia.org/wiki/WT1 WT1] (binding site in the promoter of SRY : -87)&lt;br /&gt;
&amp;lt;tr id=&#039;Role&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Role&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;Transcription factor&lt;br /&gt;
&amp;lt;tr id=&#039;Genes targeted&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Genes targeted&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;SOX9&lt;br /&gt;
&lt;br /&gt;
&amp;lt;/span&amp;gt;&lt;br /&gt;
&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;/table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==History==&lt;br /&gt;
&lt;br /&gt;
After centuries of unfounded theories mainly based on environmental factors, the first molecular theory concerning the sex determination appeared in 1891. At this time, the german biologist Hermann Henking was studying sperm formation in wasps. As a chromosome which was not present in all the wasps looked different from the others, he suspected it to play a role in sex determination and called it the &amp;quot;X chromosome&amp;quot;.&lt;br /&gt;
Ten years later, Clarence Erwin McClung saw that this chromosome behaved differently during the meiosis and was only present in half the sperm cells of grasshoppers. As the main characteristic that varies in 50/50 proportions among zygotes is the sex, McClung suspected the X chromosome to be implicated in sexual development. &lt;br /&gt;
In 1905, Nettie Stevens discovered the &amp;quot;Y chromosome&amp;quot; (and the female XX and male XY patterns) while she was counting the chromosomes of beetles under the microscope&amp;lt;ref&amp;gt;Sumner, A. T. Sex Chromosomes and Sex Determination. Chromosomes: Organization and Function, 97-108. [http://www.nature.com/scitable/nated/topicpage/Sex-Chromosomes-and-Sex-Determination-44565]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
During the next decades, a few theories were in competition. In 1921, Calvin Bridges&#039;s works on &#039;&#039;Drosophila melanogaster&#039;&#039; seemed to reveal that male characters acquisition is due to a genic balance between the genes contained in the X chromosome and those contained in the autosomes&amp;lt;ref&amp;gt;PMID: 17769897&amp;lt;/ref&amp;gt;.&lt;br /&gt;
In 1930, Ronald Fisher introduced the first Y-based control of sex theory by proposing two different models : either all the genes responsible for the male characters are located on the Y chromosome or there is a Y-located gene which regulates the expression of genes elsewhere in the genome&amp;lt;ref name=&amp;quot;Goodfellow&amp;quot;&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt;.&lt;br /&gt;
As Alfred Jost had shown the testosterone produced by the testis is responsible for the entire male phenotype acquisition&amp;lt;ref&amp;gt;PMID: 4805859&amp;lt;/ref&amp;gt;, Peter Neville Goodfellow proposed in 1988, that there is a gene (&#039;&#039;TDF&#039;&#039; in human, &#039;&#039;Tdy&#039;&#039; in mice)  on the Y chromosome which drives the development of the testis&amp;lt;ref name=&amp;quot;Goodfellow&amp;quot; /&amp;gt;. In 1990, Goodfellow&#039;s hypothesis was validated with the discovery of &#039;&#039;Tdy&#039;&#039;&#039;s localisation. This gene&#039;s product (expressed during the male gonadal development) owns an amino-acid motif which shows homology to other known or putative DNA-binding domains. &#039;&#039;Tdy&#039;&#039; is therefore a transcriptional factor&amp;lt;ref&amp;gt;PMID: 2374589&amp;lt;/ref&amp;gt;. The same year, the human &#039;&#039;SRY&#039;&#039; gene (accepted later as the &#039;&#039;TDF&#039;&#039;) was discovered&amp;lt;ref&amp;gt;PMID: 1695712&amp;lt;/ref&amp;gt;. &lt;br /&gt;
Three dimensional structure of the SRY protein was determined in 1995 using NMR spectroscopy&amp;lt;ref&amp;gt;PMID:7774012&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
==SRY gene==&lt;br /&gt;
&lt;br /&gt;
The SRY gene encodes the SRY protein. The SRY protein is a transcriptional factor that induces the male phenotype in the embryo. The SRY gene is located on the [https://en.wikipedia.org/wiki/Y_chromosome Y chromosome] in the short arm (p) 11.3 &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/gene/6736 NCBI gene]&amp;lt;/ref&amp;gt;. This gene has only one exon that contains the HMG domain (DNA-binding High-Mobility Group box domain). It means that SRY mRNA does not have an alternative splicing, so there is only one isoforme of SRY protein&amp;lt;ref name=&amp;quot;McE&amp;quot;&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;. Moreover, the human genome contains only one copy of the SRY gene, whereas the mouse genome contains 6 copy of this gene&amp;lt;ref&amp;gt; Sekido R, Lovell-Badge R. Genetic control of testis development. Sex Dev Genet Mol Biol Evol Endocrinol Embryol Pathol Sex Determ Differ. 2013;7(1-3):21–32 &amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Sequence of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:90%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
&amp;gt;gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/nuccore NCBI nucleotide]&amp;lt;/ref&amp;gt;&lt;br /&gt;
TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT&lt;br /&gt;
TTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACA&lt;br /&gt;
&amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;ATG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;CAATCATATGCTTCTGCTATGTTAAGCGTATTCAACAGCGATGATTACAGTCCAGCTGTGCAAGAGAAT&lt;br /&gt;
ATTCCCGCTCTCCGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTAAGTATCAGTGTGAAA&lt;br /&gt;
CGGGAGAAAACAGTAAAGGCAACGTCCAGGATAGAGTGAAGCGACCCATGAACGCATTCATCGTGTGGTC&lt;br /&gt;
&#039;&#039;&#039;TCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCAGAGATCAGCAAGCAGCTG&lt;br /&gt;
&#039;&#039;&#039;GGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCATTCTTCCAGGAGGCACAGAAATTACAGG&lt;br /&gt;
&#039;&#039;&#039;CCATGCACAGAGAGAAATACCCGAATTATAAGTATCGA&#039;&#039;&#039;CCTCGTCGGAAGGCGAAGATGCTGCCGAAGAA&lt;br /&gt;
TTGCAGTTTGCTTCCCGCAGATCCCGCTTCGGTACTCTGCAGCGAAGTGCAACTGGACAACAGGTTGTAC&lt;br /&gt;
AGGGATGACTGTACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAACG&lt;br /&gt;
CAGCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTG&amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;TAG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;GACAATCGGGTAACATT&lt;br /&gt;
GGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCACTTTCTTATGTTTAGTTT&lt;br /&gt;
CAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCATTTCA&amp;lt;/small&amp;gt;&lt;br /&gt;
&lt;br /&gt;
(Legend : &amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Initiation codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt; ; &amp;lt;b&amp;gt;HMG sequence&amp;lt;/b&amp;gt; ; &amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Stop codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;)&lt;br /&gt;
&amp;lt;/div&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Regulation of the expression of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
In humans, the SRY promoter is located between −408 and −95 bp. Moreover, the SRY gene has enhancers at -727 pb. The linkage between regulatory proteins and these enhancers has the property to increase the production of SRY proteins. These regulatory proteins could be: SF1 (steroidogenic factor 1), SP1  and WT 1 (Wilms tumor). &amp;lt;ref name=&amp;quot;Harley&amp;quot;&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;SF1&#039;&#039;&#039;: this transcriptional factor belongs to the family of nuclear hormone receptors and contains a zinc finger. The activation of this protein requires a ligand (hormone).&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;SP1&#039;&#039;&#039;: this transcriptional factor is an ubiquitous protein which binds rich GC-sites and is implicated in the transcription of many genes. Moreover, this protein contains a zinc finger.&lt;br /&gt;
&lt;br /&gt;
*&#039;&#039;&#039;WT1&#039;&#039;&#039; :this transcriptional factor transactivates the SRY gene. It contains a zinc finger. &amp;lt;ref&amp;gt;Larney C, Bailey TL, Koopman P. Switching on sex: transcriptional regulation of the testis-determining gene Sry. Dev Camb Engl. 2014 Jun;141(11):2195–205&amp;lt;/ref&amp;gt;. &lt;br /&gt;
&lt;br /&gt;
==Structure==&lt;br /&gt;
&lt;br /&gt;
===The SRY-HMG domain (HMG-Box)===&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;&#039;SRY-HMG&#039;&#039;&#039; stands for &#039;&#039;&#039;S&#039;&#039;&#039;ex determining &#039;&#039;&#039;R&#039;&#039;&#039;egion &#039;&#039;&#039;Y&#039;&#039;&#039; - &#039;&#039;&#039;H&#039;&#039;&#039;igh &#039;&#039;&#039;M&#039;&#039;&#039;obility &#039;&#039;&#039;G&#039;&#039;&#039;roup domain.&lt;br /&gt;
It is approximately 80 residues-long. It mediates the binding of the protein to the minor groove of DNA. It is the most important part of the SRY protein. Not only because it enables  the protein to bind the DNA but also because even a single mutation can cause an inactivation of the protein.&lt;br /&gt;
&lt;br /&gt;
It has a twisted L shape: it has a long (28Å) and a short (22Å) arm. The HMG Box is made of 3 helices. Its N-term and C-term domains are irregular. The overall structure is stabilized by a hydrophobic core especially at the intersection of the 3 helices where 3 aromatics cycles meet, surrounded by aliphatic aminoacids.&lt;br /&gt;
See the different structures:&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_1/3&#039;&amp;gt;Helix 1&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_2/2&#039;&amp;gt;Helix 2&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_3/1&#039;&amp;gt;Helix 3&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Long_arm_28a/1&#039;&amp;gt;Long arm (28Å)&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Short_arm_22a/1&#039;&amp;gt;Short arm (22Å)&amp;lt;/scene&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The interaction between the HMG-Box and DNA is specific and stable.  It is mostly hydrophobic. It permits the DNA to bend of DNA (≈75°). Only one molecule of water interfaces the Box and the DNA. The complex is stabilized by salt bridges between positively charged residues of the HMG domain and negatively charged phosphates&amp;lt;ref name=&amp;quot;Tang&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
[[Image:HHMG-bitmap.png|thumb|alt=Image bitmap|Linear structure of hHMG domain]]&lt;br /&gt;
&lt;br /&gt;
The binding of SRY on DNA is specific. The DNA target site is a DNA octamer :&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:30%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
(5&#039;-dGCACAAAC)&amp;lt;br/&amp;gt;&lt;br /&gt;
(5&#039;-dGTTTGTGC)&lt;br /&gt;
&amp;lt;/small&amp;gt;&amp;lt;/div&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
This sequence is found in the promoters of genes expressed during the testicular development.&lt;br /&gt;
The bend of DNA enables the recruitment of different proteins and the building of massive proteins-DNA complexes that could change the expression of different genes&amp;lt;ref&amp;gt;PMID:11563911&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
Even if the most important function of the HMG box is binding and bending DNA, it is also involved in DNA condensation, recombination and repair.&lt;br /&gt;
&lt;br /&gt;
There are two kinds of proteins that contain a HMG box:&lt;br /&gt;
* &#039;&#039;&#039;HMG1&#039;&#039;&#039; : It is expressed in few cell types. It is found in transcription factors that contain a single HMG box. The binding of a DNA sequence is specific.&lt;br /&gt;
* &#039;&#039;&#039;HMG2&#039;&#039;&#039; : It is found in all cell types and is abundant in chromatin. These proteins can contain two or more HMG boxes that can non-specifically bind DNA. &lt;br /&gt;
&lt;br /&gt;
===General structure of SRY===&lt;br /&gt;
&lt;br /&gt;
The overall structure of SRY is organized around the HMG-box.&lt;br /&gt;
3 domains:&lt;br /&gt;
* N-term domain&lt;br /&gt;
* Central domain : DNA binding (HMG box)&lt;br /&gt;
* C-term domain&lt;br /&gt;
&lt;br /&gt;
== Function ==&lt;br /&gt;
&lt;br /&gt;
===Sex determining===&lt;br /&gt;
&lt;br /&gt;
It acts like a sex determining factor thanks to its transcriptional activity. It inhibits the development of female sex structures in the embryonic individual.&lt;br /&gt;
&lt;br /&gt;
The SRY protein contains nuclear localization signals in N and C terminals. An acetylation of these domains allows the exportation of the SRY protein to the nucleus&amp;lt;ref name=&amp;quot;Harley&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
The SRY protein activates the &#039;&#039;SOX9&#039;&#039; (SRY-box9) gene &amp;lt;ref name=&amp;quot;McE&amp;quot; /&amp;gt;. This gene is found in long arm 24.3 of the chromosome 17&amp;lt;ref&amp;gt; NCBI [http://www.ncbi.nlm.nih.gov/gene/6662 NCBI gene: SOX9 SRY-BOX9 Homo sapiens] &amp;lt;/ref&amp;gt; and is implicated in the stimulation of the differentiation of pre-Sertori into Sertoli cells rather than granulosa cells.&lt;br /&gt;
&lt;br /&gt;
The activation of &#039;&#039;SOX&#039;&#039;9 is done by the SRY protein and another transcriptional factor: SF1 (steroidogenic factor 1). These transcriptional factors are bound on an enhancer called: TESCO (Testis-Specific Enhancer of &#039;&#039;SOX9&#039;&#039; core element). The binding of a transcriptional factor on an enhancer provokes a curvature of the DNA (≈75°), allowing a stabilization of the elongation complex on the &#039;&#039;SOX9&#039;&#039; promoter. The SOX9 protein activates the gene &#039;&#039;AMH&#039;&#039; (Anti-Mullerian Hormone)&amp;lt;ref&amp;gt;[http://www.ebi.ac.uk/interpro/entry/IPR006799?q=AMH EBI-Interpro: Anti-Mullerian-Hormon, N-term] &amp;lt;/ref&amp;gt;. Therefore, it allows the degeneration of the channels of Müller in male&amp;lt;ref name=&amp;quot;Harley&amp;quot; /&amp;gt;.&lt;br /&gt;
===Cathecolamines regulation===&lt;br /&gt;
&lt;br /&gt;
It has been shown that SRY is present in brain regions and activates the Tyrosine-3-Hydroxylase expression. This enzyme catalyses the rate-limiting step of catecholamine synthesis (L-Tyrosine to L-DOPA). Furthermore, SRY also activates the expression of Monoamine Oxidase A which is responsible for the inactivation of catecholamines. Therefore, it regulates both positively and negatively the catecholamines concentration&amp;lt;ref name=&amp;quot;Veitia&amp;quot;&amp;gt;PMID: 24604382&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Other extra-testicular effects===&lt;br /&gt;
&lt;br /&gt;
Some knock-down experiments have shown that SRY may also be a major actor in the dopamine pathway. On the peripheral side, it seems to regulate noradrenaline levels and blood pressure&amp;lt;ref name=&amp;quot;Veitia&amp;quot; /&amp;gt;. A researcher who contributed to discovering these effects says it might explain why &amp;quot;the aggressive fight-or-flight reaction is more dominant in men, while women predominantly adopt a less aggressive tend-and-befriend response&amp;quot;&amp;lt;ref&amp;gt;Cohen, Tamara. The &#039;macho&#039; gene that makes men behave aggressively has been found. The Daily Mail (2012). [http://www.dailymail.co.uk/sciencetech/article-2111668/The-macho-gene-makes-men-aggressive-found.html#ixzz3yZC2BV4k]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
It has been shown that SRY may be involved in the regulation of the renin-angiotensin system in mice. Indeed, sequence mutations of the protein lead to hypertension. Because the human&#039;s SRY organisation is very closed to the mouse&#039;s, it has been proposed that SRY may have the same function in humans but it has not been studied directly&amp;lt;ref&amp;gt;PMID:22315667&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
== Diseases==&lt;br /&gt;
&lt;br /&gt;
=== Swyer syndrome (AKA XY gonadal dysgenis) :===&lt;br /&gt;
&lt;br /&gt;
If the TDF protein is not able to bind its targeted DNA sequences, the genes responsible for the testis development are not expressed. The patient owning this defective protein will then develop female characters, even though he has a XY karyotype. This phenomenon is known as the &amp;quot;Swyer Syndrome&amp;quot;. &lt;br /&gt;
Different causes can explain this &amp;quot;XY gonadal dysgenis&amp;quot;, as it is also called. About thirty mutations (named [http://www.uniprot.org/uniprot/Q05066#sequences &amp;quot;SRXY1&amp;quot;]) in the SRY gene have been shown to drive this phenotype development. It can also be due to crossovers during a meiosis. If a Y chromosome portion carrying the SRY gene is recombined into a X chromosome, a sperm cell will get this abnormal Y chromosome. If it then fecundates, a XY karyotype without any SRY gene will be formed. &lt;br /&gt;
&lt;br /&gt;
=== De La Chapelle syndrome (AKA XX male syndrome) :===&lt;br /&gt;
&lt;br /&gt;
From the meiosis just described would also result an abnormal X chromosome, carrying the SRY gene. If the sperm cell owning this chromosome fecundates an ovule, the resulting newborn will have a XX karyotype but a male phenotype. This is called the &amp;quot;De La Chapelle syndrome&amp;quot;. In this case, the patient can either develop testis or both testis and ovarian tissues. As some epigenetic mechanisms can inactivate the X chromosome carrying SRY, this syndrome keeps most of the patients sterile&amp;lt;ref&amp;gt;PMID: 4622299&amp;lt;/ref&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Hepatocellular carcinoma===&lt;br /&gt;
 &lt;br /&gt;
In the case on a hepatocellular carcinoma, it has been proved that high expression levels of SRY help cancer progression and poor patient survival. However, it still seems that hepatocellular carcinoma is not most likely to develop in men.&amp;lt;ref&amp;gt;PMID: 25274159&amp;lt;/ref&amp;gt; &lt;br /&gt;
&lt;br /&gt;
== Structural highlights ==&lt;br /&gt;
&lt;br /&gt;
This is a sample scene created with SAT to &amp;lt;scene name=&amp;quot;/12/3456/Sample/1&amp;quot;&amp;gt;color&amp;lt;/scene&amp;gt; by Group, and another to make &amp;lt;scene name=&amp;quot;/12/3456/Sample/2&amp;quot;&amp;gt;a transparent representation&amp;lt;/scene&amp;gt; of the protein. You can make your own scenes on SAT starting from scratch or loading and editing one of these sample scenes.&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_1/3&#039;&amp;gt;Helix 1&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_2/2&#039;&amp;gt;Helix 2&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_3/1&#039;&amp;gt;Helix 3&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Long_arm_28a/1&#039;&amp;gt;Long arm (28A)&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Short_arm_22a/1&#039;&amp;gt;Short arm (22A)&amp;lt;/scene&amp;gt;&lt;br /&gt;
&amp;lt;/StructureSection&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== References ==&lt;br /&gt;
&amp;lt;references/&amp;gt;&lt;/div&gt;</summary>
		<author><name>Fantin Mesny</name></author>
	</entry>
	<entry>
		<id>https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2525748</id>
		<title>Sandbox Reserved 1120</title>
		<link rel="alternate" type="text/html" href="https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2525748"/>
		<updated>2016-01-28T21:22:14Z</updated>

		<summary type="html">&lt;p&gt;Fantin Mesny: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{Sandbox_Reserved_ESBS_2015}}&amp;lt;!-- PLEASE ADD YOUR CONTENT BELOW HERE --&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==SRY protein (AKA TDF protein)==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;StructureSection load=&#039;1hry&#039; size=&#039;340&#039; side=&#039;right&#039; caption=&#039;The SRY protein linked to DNA&#039; scene=&#039;71/719861/Base/1&#039;&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td colspan=&#039;2&#039;&amp;gt;The SRY protein is a 204 residues long monomeric polypeptide. It is encoded by the [https://en.wikipedia.org/wiki/Testis_determining_factor testis-determining sex gene] and is involved in the sex determination in mammels by being responsible for the gonadogenesis thus the male sexual developement. It is the HMG-box that gives to the protein its ability to bind DNA by its minor groove. &amp;lt;ref&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr id=&#039;related&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;[[Related_structure|Related:]]&amp;lt;/b&amp;gt;&amp;lt;/td&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;[[1hrz|1hrz]]&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr id=&#039;resources&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Resources:&amp;lt;/b&amp;gt;&amp;lt;/td&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;&amp;lt;span class=&#039;plainlinks&#039;&amp;gt;[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=1hry FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=1hry OCA], [http://pdbe.org/1hry PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=1hry RCSB], [http://www.ebi.ac.uk/pdbsum/1hry PDBsum]&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr id=&#039;Molecular weight&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Molecular weight&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;≈23kDa&lt;br /&gt;
&amp;lt;tr id=&#039;Gene&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Gene&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;XXXX kDa&lt;br /&gt;
&amp;lt;tr id=&#039;Length&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Length&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;XXXX kDa&lt;br /&gt;
&amp;lt;tr id=&#039;Regulation&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Regulation&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;[https://en.wikipedia.org/wiki/Steroidogenic_factor_1 Sf1];[https://en.wikipedia.org/wiki/Sp1_transcription_factor Sp1] (2 binding site in the promoter of SRY : -150 and -13),[https://en.wikipedia.org/wiki/WT1 WT1] (2 binding sites in the promoter of SRY : -78 and -87)&lt;br /&gt;
&amp;lt;tr id=&#039;DNA target sequence&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;DNA target sequence&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;XXXX kDa&lt;br /&gt;
&amp;lt;tr id=&#039;Genes targeted&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Genes targeted&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;XXXX kDa&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;/span&amp;gt;&lt;br /&gt;
&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;/table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==History==&lt;br /&gt;
&lt;br /&gt;
After centuries of unfounded theories mainly based on environmental factors, the first molecular theory concerning the sex determination appeared in 1891. At this time, the german biologist Hermann Henking was studying sperm formation in wasps. As a chromosome which was not present in all the wasps looked different from the others, he suspected it to play a role in sex determination and called it the &amp;quot;X chromosome&amp;quot;.&lt;br /&gt;
Ten years later, Clarence Erwin McClung saw that this chromosome behaved differently during the meiosis and was only present in half the sperm cells of grasshoppers. As the main characteristic that varies in 50/50 proportions among zygotes is the sex, McClung suspected the X chromosome to be implicated in sexual development. &lt;br /&gt;
In 1905, Nettie Stevens discovered the &amp;quot;Y chromosome&amp;quot; (and the female XX and male XY patterns) while she was counting the chromosomes of beetles under the microscope&amp;lt;ref&amp;gt;Sumner, A. T. Sex Chromosomes and Sex Determination. Chromosomes: Organization and Function, 97-108. [http://www.nature.com/scitable/nated/topicpage/Sex-Chromosomes-and-Sex-Determination-44565]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
During the next decades, a few theories were in competition. In 1921, Calvin Bridges&#039;s works on &#039;&#039;Drosophila melanogaster&#039;&#039; seemed to reveal that male characters acquisition is due to a genic balance between the genes contained in the X chromosome and those contained in the autosomes&amp;lt;ref&amp;gt;PMID: 17769897&amp;lt;/ref&amp;gt;.&lt;br /&gt;
In 1930, Ronald Fisher introduced the first Y-based control of sex theory by proposing two different models : either all the genes responsible for the male characters are located on the Y chromosome or there is a Y-located gene which regulates the expression of genes elsewhere in the genome&amp;lt;ref&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt;.&lt;br /&gt;
As Alfred Jost had shown the testosterone produced by the testis is responsible for the entire male phenotype acquisition&amp;lt;ref&amp;gt;PMID: 4805859&amp;lt;/ref&amp;gt;, in 1988, Peter Neville Goodfellow proposed that there is a gene (&#039;&#039;TDF&#039;&#039; in human, &#039;&#039;Tdy&#039;&#039; in mice)  on the Y chromosome which drives the development of the testis.&amp;lt;ref&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt; In 1990, Goodfellow&#039;s hypothesis was validated with the discovery of &#039;&#039;Tdy&#039;&#039;&#039;s localisation. This gene&#039;s product (expressed during the male gonadal development) owns an amino-acid motif showing homology to other known or putative DNA-binding domains. &#039;&#039;Tdy&#039;&#039; is therefore a transcriptional factor&amp;lt;ref&amp;gt;PMID: 2374589&amp;lt;/ref&amp;gt;. The same year, the human &#039;&#039;SRY&#039;&#039; gene (accepted later as the &#039;&#039;TDF&#039;&#039;) was discovered&amp;lt;ref&amp;gt;PMID: 1695712&amp;lt;/ref&amp;gt;. &lt;br /&gt;
Three dimensional structure of the SRY protein was determined in 1995 using NMR spectroscopy&amp;lt;ref&amp;gt;PMID: 7774012&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==SRY gene==&lt;br /&gt;
&lt;br /&gt;
===Generality===&lt;br /&gt;
&lt;br /&gt;
The SRY gene encodes the SRY protein. The SRY protein is a transcriptional factor inducing the male phenotype in embryo. The SRY gene is located on the [https://en.wikipedia.org/wiki/Y_chromosome Y chromosom] in the short arm (p) 11.3 &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/gene/6736]&amp;lt;/ref&amp;gt;. This gene has only one exon containing the HMG domain (DNA-binding high-mobility group box domain). That&#039;s means that SRY mRNA does not have a alternative splicing, so there is one isoform of SRY protein.&amp;lt;ref&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;. Moreover,the human genome contains one copy of the SRY gene, whereas the mouse genome contains 6 copy of this gene. &amp;lt;ref&amp;gt; Sekido R, Lovell-Badge R. Genetic control of testis development. Sex Dev Genet Mol Biol Evol Endocrinol Embryol Pathol Sex Determ Differ. 2013;7(1-3):21–32 &amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Sequence of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:90%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
&amp;gt;gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/nuccore]&amp;lt;/ref&amp;gt;&lt;br /&gt;
TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT&lt;br /&gt;
TTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACA&lt;br /&gt;
&amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;ATG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;CAATCATATGCTTCTGCTATGTTAAGCGTATTCAACAGCGATGATTACAGTCCAGCTGTGCAAGAGAAT&lt;br /&gt;
ATTCCCGCTCTCCGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTAAGTATCAGTGTGAAA&lt;br /&gt;
CGGGAGAAAACAGTAAAGGCAACGTCCAGGATAGAGTGAAGCGACCCATGAACGCATTCATCGTGTGGTC&lt;br /&gt;
&#039;&#039;&#039;TCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCAGAGATCAGCAAGCAGCTG&lt;br /&gt;
&#039;&#039;&#039;GGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCATTCTTCCAGGAGGCACAGAAATTACAGG&lt;br /&gt;
&#039;&#039;&#039;CCATGCACAGAGAGAAATACCCGAATTATAAGTATCGA&#039;&#039;&#039;CCTCGTCGGAAGGCGAAGATGCTGCCGAAGAA&lt;br /&gt;
TTGCAGTTTGCTTCCCGCAGATCCCGCTTCGGTACTCTGCAGCGAAGTGCAACTGGACAACAGGTTGTAC&lt;br /&gt;
AGGGATGACTGTACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAACG&lt;br /&gt;
CAGCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTG&amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;TAG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;GACAATCGGGTAACATT&lt;br /&gt;
GGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCACTTTCTTATGTTTAGTTT&lt;br /&gt;
CAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCATTTCA&amp;lt;/small&amp;gt;&lt;br /&gt;
&lt;br /&gt;
(Legend : &amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Initiation codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt; ; &amp;lt;b&amp;gt;HMG sequence&amp;lt;/b&amp;gt; ; &amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Stop codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;)&lt;br /&gt;
&amp;lt;/div&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Regulation of the expression of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
In humans, the SRY promoter is found at −408 bp to −95 bp upstream of the ATG initiation codon. Moreover, the SRY gene has enhancers at -727 pb upstream of the ATG initiation codon. The linkage between regulatory proteins and this enhancers have the property to increase the production of SRY protein. These regulatory proteins could be: SF1 (steroidogenic factor 1), SP1  and WT 1 (Wilms tumor). &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
*SF1: this transcriptional factor belong to the family of nuclear hormone receptor and contains a zinc finger. The activation of this protein requires a ligand (hormone).&lt;br /&gt;
&lt;br /&gt;
*SP1: this transciprional factor is a ubiquitous protein binding in site containing rich-GC sequences and implicated in the transcription of many genes. Moreover, this protein contains a zinc finger.&lt;br /&gt;
&lt;br /&gt;
*WT1:this transcriptional factor transactives SRY gene, it contains a zinc finger. &amp;lt;ref&amp;gt;Larney C, Bailey TL, Koopman P. Switching on sex: transcriptional regulation of the testis-determining gene Sry. Dev Camb Engl. 2014 Jun;141(11):2195–205. &amp;lt;/ref&amp;gt; &lt;br /&gt;
&lt;br /&gt;
==Structure==&lt;br /&gt;
&lt;br /&gt;
===The SRY-HMG domain (HMG-Box)===&lt;br /&gt;
&#039;&#039;&#039;SRY-HMG&#039;&#039;&#039; stands for &#039;&#039;&#039;S&#039;&#039;&#039;ex determining &#039;&#039;&#039;R&#039;&#039;&#039;egion &#039;&#039;&#039;Y&#039;&#039;&#039; - &#039;&#039;&#039;H&#039;&#039;&#039;igh &#039;&#039;&#039;M&#039;&#039;&#039;obility &#039;&#039;&#039;G&#039;&#039;&#039;roup domain.&lt;br /&gt;
It is approximately 80 residues long. It mediates the binding of the protein to the minor groove of DNA. It is the most important part of the SRY protein. Not only because it enable  the protein to bind the DNA but because even a little mutation can cause an inactivation of the protein.&lt;br /&gt;
&lt;br /&gt;
It has a Twisted L shape meaning that it has a long (28Å) and a short (22Å) arm. The HMG Box is made of 3 helices, its N-term and C-term are irregular. The overall structure is stabilized by a hydrophobic core especially at the intersection of the 3 helices where 3 aromatics cycles meet, surrounnded by aliphatic aminoacids.&lt;br /&gt;
See the different structure:&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_1/3&#039;&amp;gt;Helix 1&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_2/2&#039;&amp;gt;Helix 2&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Helix_3/1&#039;&amp;gt;Helix 3&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Long_arm_28a/1&#039;&amp;gt;Long arm (28A)&amp;lt;/scene&amp;gt;&lt;br /&gt;
*&amp;lt;scene name=&#039;71/719861/Short_arm_22a/1&#039;&amp;gt;Short arm (22A)&amp;lt;/scene&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The interaction between the HMG-Box and DNA is specific and stable. It permits the bend of DNA (?75°). It is mostly hydrophobic interaction. Only one molecule of water interface the Box and the DNA. the complex is stabilized by salt bridges between positive charged residues of the HMG domain and negative charged phosphates.&amp;lt;ref&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[Image:HHMG-bitmap.png|thumb|alt=Image bitmap|Linear structure of hHMG domain]]&lt;br /&gt;
&lt;br /&gt;
The binding of SRY to DNA is specific. The DNA target site is a DNA octamer :&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:90%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
(5&#039;-dGCACAAAC)&lt;br /&gt;
(5&#039;-dGTTTGTGC)&lt;br /&gt;
&amp;lt;/small&amp;gt;&amp;lt;/div&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
This sequenece is found in the promoters of genes expressed during the testicular development&lt;br /&gt;
The bend of DNA permits the recruitment of different proteins and the build of massives proteins-DNA complexes that could change the expression of different genes. It is the role of a transcription factor.&amp;lt;ref&amp;gt;PMID:11563911&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
Even if the most important function of the HMG box is its capacity of binding and bending DNA, it is also involved in DNA condensation, recombination and DNA repair.&lt;br /&gt;
&lt;br /&gt;
There are 2 kinds of protein that contain a HMG box&lt;br /&gt;
* HMG1 : It is expressed in few cell types. It is found in transcription factors that contain a single HMG box. The bind to a DNA sequence is specific.&lt;br /&gt;
* HMG2 : Are found in all cell types and are abundant in chromatin. This proteins can contain two or more HMG boxes that can nonspecifically bind DNA. &lt;br /&gt;
&lt;br /&gt;
===General structure of SRY===&lt;br /&gt;
The overall structure of SRY is organized aroud the HMG-box.&lt;br /&gt;
3 domains:&lt;br /&gt;
* N-term domain&lt;br /&gt;
* Central domain : DNA binding (HMG box)&lt;br /&gt;
* C-term domain&lt;br /&gt;
&lt;br /&gt;
== Function ==&lt;br /&gt;
&lt;br /&gt;
===Sex determining===&lt;br /&gt;
&lt;br /&gt;
:It acts like a sex determinator thanks to it transcriptionnal activity. It inhibits the developpement of female sex structure in th embryonnic individual.&lt;br /&gt;
&lt;br /&gt;
The SRY protein is a transcription factor, which contains nuclear localization domains in N terminal and C terminal. An acetylation on these domains allows to export the protein SRY in the nucleus.  &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The SRY protein activates the SOX9 (SRY-box9) gene &amp;lt;ref&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;., this gene is found in the 17 chromosom in the long arm 24.3 &amp;lt;ref&amp;gt; NCBI [http://www.ncbi.nlm.nih.gov/gene/6662] &amp;lt;/ref&amp;gt; and is implicated in the stimulation of the differentiation of sertori cells. The activation of sox 9 are done with protein SRY and another transcriptional factor: SF1 (steroidogenic factor 1). These transcriptional factors are bind in an enhancers called: TESCO (testis-specific enhancer of Sox9 core element). The fixation of transcriptional factor in enhancer provokes a curvature of DNA (90°C) allowing a stabilisation of the elongation complex on the SOX9 promoter. The SOX 9 protein activates the gene AMH (anti-mullerian hormone)&amp;lt;ref&amp;gt;[http://www.ebi.ac.uk/interpro/entry/IPR006799?q=AMH] &amp;lt;/ref&amp;gt; allows the reduction of the channels of Müller in male. &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
:It has been shown that SRY would be involved in the regulation of the renin-angiotensin system in mice. Indeed, sequence mutations of the protein lead to hypertension.&lt;br /&gt;
Because the human&#039;s SRY organisation is very closed to he mouse&#039;s, it has been proposed that SRY would have the same function in human but it has not been studied directly.&amp;lt;ref&amp;gt;PMID:22315667&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Cathecolamines regulation===&lt;br /&gt;
&lt;br /&gt;
It has been shown SRY is present in brain regions and activate the Tyrosine-3-Hydroxylase expression. This enzyme catalyses the rate-limiting step of catecholamine synthesis (L-Tyrosine to L-DOPA). Furthermore, SRY also activate the expression of Monoamine Oxidase A which is responsible for the inactivation of catecholamines. Therefore, it regulates both positively and negatively the catecholamines concentration. &amp;lt;ref&amp;gt;PMID: 24604382&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Other extra-testicular effects===&lt;br /&gt;
&lt;br /&gt;
Some knock-down experiments have shown that SRY may also be a major actor in the dopamine pathway. On the peripheral side, it even regulates noradrenaline levels and blood pressure.&amp;lt;ref&amp;gt;PMID: 24604382&amp;lt;/ref&amp;gt; A researcher who contributed to discovering this effects says it might explain why &amp;quot;the aggressive fight-or-flight reaction is more dominant in men, while women predominantly adopt a less aggressive tend-and-befriend response&amp;quot;.&amp;lt;ref&amp;gt;Cohen, Tamara. The &#039;macho&#039; gene that makes men behave aggressively has been found. The Daily Mail (2012). [http://www.dailymail.co.uk/sciencetech/article-2111668/The-macho-gene-makes-men-aggressive-found.html#ixzz3yZC2BV4k]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
== Diseases==&lt;br /&gt;
&lt;br /&gt;
=== Swyer syndrome (AKA XY gonadal dysgenis) :===&lt;br /&gt;
&lt;br /&gt;
	If the TDF protein is not able to bind its targeted DNA sequences, the genes responsible for the testis development are not expressed. The patient owning this defective protein will then develop female characters, even though he has a XY karyotype. This phenomenon is known as the « Swyer Syndrome ». &lt;br /&gt;
Different causes can explain this « XY gonadal dysgenis », as it is also called. About thirty mutations (named [http://www.uniprot.org/uniprot/Q05066#sequences &amp;quot;SRXY1&amp;quot;]) in the SRY gene have been shown to drive this phenotype development. It can also be due to crossovers during a meiosis. If a Y chromosome portion carrying the SRY gene is recombined into a X chromosome, a sperm cell will get this abnormal Y chromosome. If it then fecundates, a XY karyotype without any SRY gene will be formed. &lt;br /&gt;
&lt;br /&gt;
=== De La Chapelle syndrome (AKA XX male syndrome) :===&lt;br /&gt;
&lt;br /&gt;
From the meiosis just described would also result an abnormal X chromosome, carrying the SRY gene. If the sperm cell owning this chromosome fecundates an ovule, the resulting newborn will have a XX karyotype but a male phenotype. This is called the « De La Chapelle syndrome ». In this case, the patient can either develop testis or both testis and ovarian tissues. As some epigenetic mechanisms can inactivate the X chromosome carrying SRY, this syndrome keeps most of the patients sterile.&amp;lt;ref&amp;gt;PMID: 4622299&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Hepatocellular carcinoma===&lt;br /&gt;
 &lt;br /&gt;
In the case on a hepatocellular carcinoma, it has been proven high expression levels of SRY helps cancer progression and poor patient survival. However, it still seems hepatocellular carcinoma is not most likely to develop in men.&amp;lt;ref&amp;gt;PMID: 25274159&amp;lt;/ref&amp;gt; &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
== Relevance ==&lt;br /&gt;
&lt;br /&gt;
== Structural highlights ==&lt;br /&gt;
&lt;br /&gt;
This is a sample scene created with SAT to &amp;lt;scene name=&amp;quot;/12/3456/Sample/1&amp;quot;&amp;gt;color&amp;lt;/scene&amp;gt; by Group, and another to make &amp;lt;scene name=&amp;quot;/12/3456/Sample/2&amp;quot;&amp;gt;a transparent representation&amp;lt;/scene&amp;gt; of the protein. You can make your own scenes on SAT starting from scratch or loading and editing one of these sample scenes.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;/StructureSection&amp;gt;&lt;br /&gt;
== References ==&lt;br /&gt;
[http://ghr.nlm.nih.gov/gene/SRY Genetic Home reference]&lt;br /&gt;
&amp;lt;references/&amp;gt;&lt;/div&gt;</summary>
		<author><name>Fantin Mesny</name></author>
	</entry>
	<entry>
		<id>https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2525715</id>
		<title>Sandbox Reserved 1120</title>
		<link rel="alternate" type="text/html" href="https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2525715"/>
		<updated>2016-01-28T18:54:03Z</updated>

		<summary type="html">&lt;p&gt;Fantin Mesny: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{Sandbox_Reserved_ESBS_2015}}&amp;lt;!-- PLEASE ADD YOUR CONTENT BELOW HERE --&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==SRY protein (AKA TDF protein)==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;StructureSection load=&#039;1hry&#039; size=&#039;340&#039; side=&#039;right&#039; caption=&#039;The SRY protein linked to DNA&#039; scene=&#039;&#039;&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td colspan=&#039;2&#039;&amp;gt;The SRY protein is a 204 residues long monomeric polypeptide. It is encoded by the [https://en.wikipedia.org/wiki/Testis_determining_factor testis-determining sex gene] and is involved in the sex determination in mammels by being responsible for the gonadogenesis thus the male sexual developement. It is the HMG-box that gives to the protein its ability to bind DNA by its minor groove. &amp;lt;ref&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr id=&#039;related&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;[[Related_structure|Related:]]&amp;lt;/b&amp;gt;&amp;lt;/td&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;[[1hrz|1hrz]]&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr id=&#039;resources&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Resources:&amp;lt;/b&amp;gt;&amp;lt;/td&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;&amp;lt;span class=&#039;plainlinks&#039;&amp;gt;[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=1hry FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=1hry OCA], [http://pdbe.org/1hry PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=1hry RCSB], [http://www.ebi.ac.uk/pdbsum/1hry PDBsum]&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr id=&#039;Molecular weight&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Molecular weight&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;≈23kDa&lt;br /&gt;
&amp;lt;tr id=&#039;Gene&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Gene&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;XXXX kDa&lt;br /&gt;
&amp;lt;tr id=&#039;Length&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Length&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;XXXX kDa&lt;br /&gt;
&amp;lt;tr id=&#039;Regulation&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Regulation&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;[https://en.wikipedia.org/wiki/Steroidogenic_factor_1 Sf1];[https://en.wikipedia.org/wiki/Sp1_transcription_factor Sp1] (2 binding site in the promoter of SRY : -150 and -13),[https://en.wikipedia.org/wiki/WT1 WT1] (2 binding sites in the promoter of SRY : -78 and -87)&lt;br /&gt;
&amp;lt;tr id=&#039;DNA target sequence&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;DNA target sequence&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;XXXX kDa&lt;br /&gt;
&amp;lt;tr id=&#039;Genes targeted&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Genes targeted&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;XXXX kDa&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;/span&amp;gt;&lt;br /&gt;
&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;/table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
===Properties===&lt;br /&gt;
&lt;br /&gt;
&amp;lt;table style=&amp;quot;width:100%&amp;quot;;border: 1px solid #A0A0A0&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Molecular weight&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Gene&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Length&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;DNA target sequence&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Genes targeted&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Inhibitors&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;/table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==History==&lt;br /&gt;
&lt;br /&gt;
After centuries of unfounded theories mainly based on environmental factors, the first molecular theory concerning the sex determination appeared in 1891. At this time, the german biologist Hermann Henking was studying sperm formation in wasps. As a chromosome which was not present in all the wasps looked different from the others, he suspected it to play a role in sex determination and called it the &amp;quot;X chromosome&amp;quot;.&lt;br /&gt;
Ten years later, Clarence Erwin McClung saw that this chromosome behaved differently during the meiosis and was only present in half the sperm cells of grasshoppers. As the main characteristic that varies in 50/50 proportions among zygotes is the sex, McClung suspected the X chromosome to be implicated in sexual development. &lt;br /&gt;
In 1905, Nettie Stevens discovered the &amp;quot;Y chromosome&amp;quot; (and the female XX and male XY patterns) while she was counting the chromosomes of beetles under the microscope&amp;lt;ref&amp;gt;Sumner, A. T. Sex Chromosomes and Sex Determination. Chromosomes: Organization and Function, 97-108. [http://www.nature.com/scitable/nated/topicpage/Sex-Chromosomes-and-Sex-Determination-44565]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
During the next decades, a few theories were in competition. In 1921, Calvin Bridges&#039;s works on &#039;&#039;Drosophila melanogaster&#039;&#039; seemed to reveal that male characters acquisition is due to a genic balance between the genes contained in the X chromosome and those contained in the autosomes&amp;lt;ref&amp;gt;PMID: 17769897&amp;lt;/ref&amp;gt;.&lt;br /&gt;
In 1930, Ronald Fisher introduced the first Y-based control of sex theory by proposing two different models : either all the genes responsible for the male characters are located on the Y chromosome or there is a Y-located gene which regulates the expression of genes elsewhere in the genome&amp;lt;ref&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt;.&lt;br /&gt;
As Alfred Jost had shown the testosterone produced by the testis is responsible for the entire male phenotype acquisition&amp;lt;ref&amp;gt;PMID: 4805859&amp;lt;/ref&amp;gt;, in 1988, Peter Neville Goodfellow proposed that there is a gene (&#039;&#039;TDF&#039;&#039; in human, &#039;&#039;Tdy&#039;&#039; in mice)  on the Y chromosome which drives the development of the testis.&amp;lt;ref&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt; In 1990, Goodfellow&#039;s hypothesis was validated with the discovery of &#039;&#039;Tdy&#039;&#039;&#039;s localisation. This gene&#039;s product (expressed during the male gonadal development) owns an amino-acid motif showing homology to other known or putative DNA-binding domains. &#039;&#039;Tdy&#039;&#039; is therefore a transcriptional factor&amp;lt;ref&amp;gt;PMID: 2374589&amp;lt;/ref&amp;gt;. The same year, the human &#039;&#039;SRY&#039;&#039; gene (accepted later as the &#039;&#039;TDF&#039;&#039;) was discovered&amp;lt;ref&amp;gt;PMID: 1695712&amp;lt;/ref&amp;gt;. &lt;br /&gt;
Three dimensional structure of the SRY protein was determined in 1995 using NMR spectroscopy&amp;lt;ref&amp;gt;PMID: 7774012&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==SRY gene==&lt;br /&gt;
&lt;br /&gt;
===Generality===&lt;br /&gt;
&lt;br /&gt;
The SRY gene encodes the SRY protein. The SRY protein is a transcriptional factor inducing the male phenotype in embryo. The SRY gene is located on the [https://en.wikipedia.org/wiki/Y_chromosome Y chromosom] in the short arm (p) 11.3 &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/gene/6736]&amp;lt;/ref&amp;gt;. This gene has only one exon containing the HMG domain (DNA-binding high-mobility group box domain). That&#039;s means that SRY mRNA does not have a alternative splicing, so there is one isoform of SRY protein.&amp;lt;ref&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;. Moreover,the human genome contains one copy of the SRY gene, whereas the mouse genome contains 6 copy of this gene. &amp;lt;ref&amp;gt; Sekido R, Lovell-Badge R. Genetic control of testis development. Sex Dev Genet Mol Biol Evol Endocrinol Embryol Pathol Sex Determ Differ. 2013;7(1-3):21–32 &amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Sequence of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:90%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
&amp;gt;gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/nuccore]&amp;lt;/ref&amp;gt;&lt;br /&gt;
TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT&lt;br /&gt;
TTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACA&lt;br /&gt;
&amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;ATG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;CAATCATATGCTTCTGCTATGTTAAGCGTATTCAACAGCGATGATTACAGTCCAGCTGTGCAAGAGAAT&lt;br /&gt;
ATTCCCGCTCTCCGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTAAGTATCAGTGTGAAA&lt;br /&gt;
CGGGAGAAAACAGTAAAGGCAACGTCCAGGATAGAGTGAAGCGACCCATGAACGCATTCATCGTGTGGTC&lt;br /&gt;
&#039;&#039;&#039;TCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCAGAGATCAGCAAGCAGCTG&lt;br /&gt;
&#039;&#039;&#039;GGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCATTCTTCCAGGAGGCACAGAAATTACAGG&lt;br /&gt;
&#039;&#039;&#039;CCATGCACAGAGAGAAATACCCGAATTATAAGTATCGA&#039;&#039;&#039;CCTCGTCGGAAGGCGAAGATGCTGCCGAAGAA&lt;br /&gt;
TTGCAGTTTGCTTCCCGCAGATCCCGCTTCGGTACTCTGCAGCGAAGTGCAACTGGACAACAGGTTGTAC&lt;br /&gt;
AGGGATGACTGTACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAACG&lt;br /&gt;
CAGCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTG&amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;TAG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;GACAATCGGGTAACATT&lt;br /&gt;
GGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCACTTTCTTATGTTTAGTTT&lt;br /&gt;
CAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCATTTCA&amp;lt;/small&amp;gt;&lt;br /&gt;
&lt;br /&gt;
(Legend : &amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Initiation codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt; ; &amp;lt;b&amp;gt;HMG sequence&amp;lt;/b&amp;gt; ; &amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Stop codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;)&lt;br /&gt;
&amp;lt;/div&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Regulation of the expression of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
In humans, the SRY promoter is found at −408 bp to −95 bp upstream of the ATG initiation codon. Moreover, the SRY gene has enhancers at -727 pb upstream of the ATG initiation codon. The linkage between regulatory proteins and this enhancers have the property to increase the production of SRY protein. These regulatory proteins could be: SF1 (steroidogenic factor 1), SP1  and WT 1 (Wilms tumor). &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
*SF1: this transcriptional factor belong to the family of nuclear hormone receptor and contains a zinc finger. The activation of this protein requires a ligand (hormone).&lt;br /&gt;
&lt;br /&gt;
*SP1: this transciprional factor is a ubiquitous protein binding in site containing rich-GC sequences and implicated in the transcription of many genes. Moreover, this protein contains a zinc finger.&lt;br /&gt;
&lt;br /&gt;
*WT1:this transcriptional factor transactives SRY gene, it contains a zinc finger. &amp;lt;ref&amp;gt;Larney C, Bailey TL, Koopman P. Switching on sex: transcriptional regulation of the testis-determining gene Sry. Dev Camb Engl. 2014 Jun;141(11):2195–205. &amp;lt;/ref&amp;gt; &lt;br /&gt;
&lt;br /&gt;
==Structure==&lt;br /&gt;
&lt;br /&gt;
===The SRY-HMG domain (HMG-Box)===&lt;br /&gt;
&#039;&#039;&#039;SRY-HMG&#039;&#039;&#039; stands for &#039;&#039;&#039;S&#039;&#039;&#039;ex determining &#039;&#039;&#039;R&#039;&#039;&#039;egion &#039;&#039;&#039;Y&#039;&#039;&#039; - &#039;&#039;&#039;H&#039;&#039;&#039;igh &#039;&#039;&#039;M&#039;&#039;&#039;obility &#039;&#039;&#039;G&#039;&#039;&#039;roup domain.&lt;br /&gt;
It is approximately 80 residues long. It mediates the binding of the protein to the minor groove of DNA. It is the most important part of the SRY protein. Not only because it enable  the protein to bind the DNA but because even a little mutation can cause an inactivation of the protein.&lt;br /&gt;
&lt;br /&gt;
It has a Twisted L shape meaning that it has a long (28Å) and a short (22Å) arm. The HMG Box is made of 3 helices, its N-term and C-term are irregular. The overall structure is stabilized by a hydrophobic core especially at the intersection of the 3 helices where 3 aromatics cycles meet, surrounnded by aliphatic aminoacids.&lt;br /&gt;
&lt;br /&gt;
The interaction between the HMG-Box and DNA is specific and stable. It permits the bend of DNA (?75°). It is mostly hydrophobic interaction. Only one molecule of water interface the Box and the DNA. the complex is stabilized by salt bridges between positive charged residues of the HMG domain and negative charged phosphates.&amp;lt;ref&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[Image:HHMG-bitmap.png|thumb|alt=Image bitmap|Linear structure of hHMG domain]]&lt;br /&gt;
&lt;br /&gt;
The binding of SRY to DNA is specific. The DNA target site is a DNA octamer :&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:90%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
(5&#039;-dGCACAAAC)&lt;br /&gt;
(5&#039;-dGTTTGTGC)&lt;br /&gt;
&amp;lt;/small&amp;gt;&amp;lt;/div&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
This sequenece is found in the promoters of genes expressed during the testicular development&lt;br /&gt;
The bend of DNA permits the recruitment of different proteins and the build of massives proteins-DNA complexes that could change the expression of different genes. It is the role of a transcription factor.&amp;lt;ref&amp;gt;PMID:11563911&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
Even if the most important function of the HMG box is its capacity of binding and bending DNA, it is also involved in DNA condensation, recombination and DNA repair.&lt;br /&gt;
&lt;br /&gt;
There are 2 kinds of protein that contain a HMG box&lt;br /&gt;
* HMG1 : It is expressed in few cell types. It is found in transcription factors that contain a single HMG box. The bind to a DNA sequence is specific.&lt;br /&gt;
* HMG2 : Are found in all cell types and are abundant in chromatin. This proteins can contain two or more HMG boxes that can nonspecifically bind DNA. &lt;br /&gt;
&lt;br /&gt;
===General structure of SRY===&lt;br /&gt;
The overall structure of SRY is organized aroud the HMG-box.&lt;br /&gt;
3 domains:&lt;br /&gt;
* N-term domain&lt;br /&gt;
* Central domain : DNA binding (HMG box)&lt;br /&gt;
* C-term domain&lt;br /&gt;
&lt;br /&gt;
== Function ==&lt;br /&gt;
&lt;br /&gt;
===Sex determining===&lt;br /&gt;
&lt;br /&gt;
:It acts like a sex determinator thanks to it transcriptionnal activity. It inhibits the developpement of female sex structure in th embryonnic individual.&lt;br /&gt;
&lt;br /&gt;
The SRY protein is a transcription factor, which contains nuclear localization domains in N terminal and C terminal. An acetylation on these domains allows to export the protein SRY in the nucleus.  &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The SRY protein activates the SOX9 (SRY-box9) gene &amp;lt;ref&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;., this gene is found in the 17 chromosom in the long arm 24.3 &amp;lt;ref&amp;gt; NCBI [http://www.ncbi.nlm.nih.gov/gene/6662] &amp;lt;/ref&amp;gt; and is implicated in the stimulation of the differentiation of sertori cells. The activation of sox 9 are done with protein SRY and another transcriptional factor: SF1 (steroidogenic factor 1). These transcriptional factors are bind in an enhancers called: TESCO (testis-specific enhancer of Sox9 core element). The fixation of transcriptional factor in enhancer provokes a curvature of DNA (90°C) allowing a stabilisation of the elongation complex on the SOX9 promoter. The SOX 9 protein activates the gene AMH (anti-mullerian hormone)&amp;lt;ref&amp;gt;[http://www.ebi.ac.uk/interpro/entry/IPR006799?q=AMH] &amp;lt;/ref&amp;gt; allows the reduction of the channels of Müller in male. &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
:It has been shown that SRY would be involved in the regulation of the renin-angiotensin system in mice. Indeed, sequence mutations of the protein lead to hypertension.&lt;br /&gt;
Because the human&#039;s SRY organisation is very closed to he mouse&#039;s, it has been proposed that SRY would have the same function in human but it has not been studied directly.&amp;lt;ref&amp;gt;PMID:22315667&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Cathecolamines regulation===&lt;br /&gt;
&lt;br /&gt;
It has been shown SRY is present in brain regions and activate the Tyrosine-3-Hydroxylase expression. This enzyme catalyses the rate-limiting step of catecholamine synthesis (L-Tyrosine to L-DOPA). Furthermore, SRY also activate the expression of Monoamine Oxidase A which is responsible for the inactivation of catecholamines. Therefore, it regulates both positively and negatively the catecholamines concentration. &amp;lt;ref&amp;gt;PMID: 24604382&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Other extra-testicular effects===&lt;br /&gt;
&lt;br /&gt;
Some knock-down experiments have shown that SRY may also be a major actor in the dopamine pathway. On the peripheral side, it even regulates noradrenaline levels and blood pressure.&amp;lt;ref&amp;gt;PMID: 24604382&amp;lt;/ref&amp;gt; A researcher who contributed to discovering this effects says it might explain why &amp;quot;the aggressive fight-or-flight reaction is more dominant in men, while women predominantly adopt a less aggressive tend-and-befriend response&amp;quot;.&amp;lt;ref&amp;gt;Cohen, Tamara. The &#039;macho&#039; gene that makes men behave aggressively has been found. The Daily Mail (2012). [http://www.dailymail.co.uk/sciencetech/article-2111668/The-macho-gene-makes-men-aggressive-found.html#ixzz3yZC2BV4k]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
== Disease ==&lt;br /&gt;
&lt;br /&gt;
=== Swyer syndrome (AKA XY gonadal dysgenis) :===&lt;br /&gt;
&lt;br /&gt;
	If the TDF protein is not able to bind its targeted DNA sequences, the genes responsible for the testis development are not expressed. The patient owning this defective protein will then develop female characters, even though he has a XY karyotype. This phenomenon is known as the « Swyer Syndrome ». &lt;br /&gt;
Different causes can explain this « XY gonadal dysgenis », as it is also called. About thirty mutations (named [http://www.uniprot.org/uniprot/Q05066#sequences &amp;quot;SRXY1&amp;quot;]) in the SRY gene have been shown to drive this phenotype development. It can also be due to crossovers during a meiosis. If a Y chromosome portion carrying the SRY gene is recombined into a X chromosome, a sperm cell will get this abnormal Y chromosome. If it then fecundates, a XY karyotype without any SRY gene will be formed. &lt;br /&gt;
&lt;br /&gt;
=== De La Chapelle syndrome (AKA XX male syndrome) :===&lt;br /&gt;
&lt;br /&gt;
From the meiosis just described would also result an abnormal X chromosome, carrying the SRY gene. If the sperm cell owning this chromosome fecundates an ovule, the resulting newborn will have a XX karyotype but a male phenotype. This is called the « De La Chapelle syndrome ». In this case, the patient can either develop testis or both testis and ovarian tissues. As some epigenetic mechanisms can inactivate the X chromosome carrying SRY, this syndrome keeps most of the patients sterile.&amp;lt;ref&amp;gt;PMID: 4622299&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
== Relevance ==&lt;br /&gt;
&lt;br /&gt;
== Structural highlights ==&lt;br /&gt;
&lt;br /&gt;
This is a sample scene created with SAT to &amp;lt;scene name=&amp;quot;/12/3456/Sample/1&amp;quot;&amp;gt;color&amp;lt;/scene&amp;gt; by Group, and another to make &amp;lt;scene name=&amp;quot;/12/3456/Sample/2&amp;quot;&amp;gt;a transparent representation&amp;lt;/scene&amp;gt; of the protein. You can make your own scenes on SAT starting from scratch or loading and editing one of these sample scenes.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;/StructureSection&amp;gt;&lt;br /&gt;
== References ==&lt;br /&gt;
[http://ghr.nlm.nih.gov/gene/SRY Genetic Home reference]&lt;br /&gt;
&amp;lt;references/&amp;gt;&lt;/div&gt;</summary>
		<author><name>Fantin Mesny</name></author>
	</entry>
	<entry>
		<id>https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2525711</id>
		<title>Sandbox Reserved 1120</title>
		<link rel="alternate" type="text/html" href="https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2525711"/>
		<updated>2016-01-28T18:31:00Z</updated>

		<summary type="html">&lt;p&gt;Fantin Mesny: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{Sandbox_Reserved_ESBS_2015}}&amp;lt;!-- PLEASE ADD YOUR CONTENT BELOW HERE --&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==SRY protein (AKA TDF protein)==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;StructureSection load=&#039;1hry&#039; size=&#039;340&#039; side=&#039;right&#039; caption=&#039;The SRY protein linked to DNA&#039; scene=&#039;&#039;&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td colspan=&#039;2&#039;&amp;gt;The SRY protein is a 204 residues long monomeric polypeptide. It is encoded by the [https://en.wikipedia.org/wiki/Testis_determining_factor testis-determining sex gene] and is involved in the sex determination in mammels by being responsible for the gonadogenesis thus the male sexual developement. It is the HMG-box that gives to the protein its ability to bind DNA by its minor groove. &amp;lt;ref&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr id=&#039;related&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;[[Related_structure|Related:]]&amp;lt;/b&amp;gt;&amp;lt;/td&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;[[1hrz|1hrz]]&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr id=&#039;resources&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Resources:&amp;lt;/b&amp;gt;&amp;lt;/td&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;&amp;lt;span class=&#039;plainlinks&#039;&amp;gt;[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=1hry FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=1hry OCA], [http://pdbe.org/1hry PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=1hry RCSB], [http://www.ebi.ac.uk/pdbsum/1hry PDBsum]&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr id=&#039;Molecular weight&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Molecular weight&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;≈23kDa&lt;br /&gt;
&amp;lt;tr id=&#039;Gene&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Gene&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;XXXX kDa&lt;br /&gt;
&amp;lt;tr id=&#039;Length&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Length&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;XXXX kDa&lt;br /&gt;
&amp;lt;tr id=&#039;Regulation&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Regulation&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;[https://en.wikipedia.org/wiki/Steroidogenic_factor_1 Sf1];[https://en.wikipedia.org/wiki/Sp1_transcription_factor Sp1] (2 binding site in the promoter of SRY : -150 and -13),[https://en.wikipedia.org/wiki/WT1 WT1] (2 binding sites in the promoter of SRY : -78 and -87)&lt;br /&gt;
&amp;lt;tr id=&#039;DNA target sequence&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;DNA target sequence&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;XXXX kDa&lt;br /&gt;
&amp;lt;tr id=&#039;Genes targeted&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Genes targeted&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;XXXX kDa&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;/span&amp;gt;&lt;br /&gt;
&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;/table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
===Properties===&lt;br /&gt;
&lt;br /&gt;
&amp;lt;table style=&amp;quot;width:100%&amp;quot;;border: 1px solid #A0A0A0&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Molecular weight&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Gene&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Length&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;DNA target sequence&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Genes targeted&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Inhibitors&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;/table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==History==&lt;br /&gt;
&lt;br /&gt;
After centuries of unfounded theories mainly based on environmental factors, the first molecular theory concerning the sex determination appeared in 1891. At this time, the german biologist Hermann Henking was studying sperm formation in wasps. As a chromosome which was not present in all the wasps looked different from the others, he suspected it to play a role in sex determination and called it the &amp;quot;X chromosome&amp;quot;.&lt;br /&gt;
Ten years later, Clarence Erwin McClung saw that this chromosome behaved differently during the meiosis and was only present in half the sperm cells of grasshoppers. As the main characteristic that varies in 50/50 proportions among zygotes is the sex, McClung suspected the X chromosome to be implicated in sexual development. &lt;br /&gt;
In 1905, Nettie Stevens discovered the &amp;quot;Y chromosome&amp;quot; (and the female XX and male XY patterns) while she was counting the chromosomes of beetles under the microscope&amp;lt;ref&amp;gt;Sumner, A. T. Sex Chromosomes and Sex Determination. Chromosomes: Organization and Function, 97-108. [http://www.nature.com/scitable/nated/topicpage/Sex-Chromosomes-and-Sex-Determination-44565]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
During the next decades, a few theories were in competition. In 1921, Calvin Bridges&#039;s works on &#039;&#039;Drosophila melanogaster&#039;&#039; seemed to reveal that male characters acquisition is due to a genic balance between the genes contained in the X chromosome and those contained in the autosomes&amp;lt;ref&amp;gt;PMID: 17769897&amp;lt;/ref&amp;gt;.&lt;br /&gt;
In 1930, Ronald Fisher introduced the first Y-based control of sex theory by proposing two different models : either all the genes responsible for the male characters are located on the Y chromosome or there is a Y-located gene which regulates the expression of genes elsewhere in the genome&amp;lt;ref&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt;.&lt;br /&gt;
As Alfred Jost had shown the testosterone produced by the testis is responsible for the entire male phenotype acquisition&amp;lt;ref&amp;gt;PMID: 4805859&amp;lt;/ref&amp;gt;, in 1988, Peter Neville Goodfellow proposed that there is a gene (&#039;&#039;TDF&#039;&#039; in human, &#039;&#039;Tdy&#039;&#039; in mice)  on the Y chromosome which drives the development of the testis.&amp;lt;ref&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt; In 1990, Goodfellow&#039;s hypothesis was validated with the discovery of &#039;&#039;Tdy&#039;&#039;&#039;s localisation. This gene&#039;s product (expressed during the male gonadal development) owns an amino-acid motif showing homology to other known or putative DNA-binding domains. &#039;&#039;Tdy&#039;&#039; is therefore a transcriptional factor&amp;lt;ref&amp;gt;PMID: 2374589&amp;lt;/ref&amp;gt;. The same year, the human &#039;&#039;SRY&#039;&#039; gene (accepted later as the &#039;&#039;TDF&#039;&#039;) was discovered&amp;lt;ref&amp;gt;PMID: 1695712&amp;lt;/ref&amp;gt;. &lt;br /&gt;
Three dimensional structure of the SRY protein was determined in 1995 using NMR spectroscopy&amp;lt;ref&amp;gt;PMID: 7774012&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==SRY gene==&lt;br /&gt;
&lt;br /&gt;
===Generality===&lt;br /&gt;
&lt;br /&gt;
The SRY gene encodes the SRY protein. The SRY protein is a transcriptional factor inducing the male phenotype in embryo. The SRY gene is located on the [https://en.wikipedia.org/wiki/Y_chromosome Y chromosom] in the short arm (p) 11.3 &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/gene/6736]&amp;lt;/ref&amp;gt;. This gene has only one exon containing the HMG domain (DNA-binding high-mobility group box domain). That&#039;s means that SRY mRNA does not have a alternative splicing, so there is one isoform of SRY protein.&amp;lt;ref&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;. Moreover,the human genome contains one copy of the SRY gene, whereas the mouse genome contains 6 copy of this gene. &amp;lt;ref&amp;gt; Sekido R, Lovell-Badge R. Genetic control of testis development. Sex Dev Genet Mol Biol Evol Endocrinol Embryol Pathol Sex Determ Differ. 2013;7(1-3):21–32 &amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Sequence of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:90%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
&amp;gt;gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/nuccore]&amp;lt;/ref&amp;gt;&lt;br /&gt;
TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT&lt;br /&gt;
TTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACA&lt;br /&gt;
&amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;ATG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;CAATCATATGCTTCTGCTATGTTAAGCGTATTCAACAGCGATGATTACAGTCCAGCTGTGCAAGAGAAT&lt;br /&gt;
ATTCCCGCTCTCCGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTAAGTATCAGTGTGAAA&lt;br /&gt;
CGGGAGAAAACAGTAAAGGCAACGTCCAGGATAGAGTGAAGCGACCCATGAACGCATTCATCGTGTGGTC&lt;br /&gt;
&#039;&#039;&#039;TCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCAGAGATCAGCAAGCAGCTG&lt;br /&gt;
&#039;&#039;&#039;GGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCATTCTTCCAGGAGGCACAGAAATTACAGG&lt;br /&gt;
&#039;&#039;&#039;CCATGCACAGAGAGAAATACCCGAATTATAAGTATCGA&#039;&#039;&#039;CCTCGTCGGAAGGCGAAGATGCTGCCGAAGAA&lt;br /&gt;
TTGCAGTTTGCTTCCCGCAGATCCCGCTTCGGTACTCTGCAGCGAAGTGCAACTGGACAACAGGTTGTAC&lt;br /&gt;
AGGGATGACTGTACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAACG&lt;br /&gt;
CAGCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTG&amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;TAG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;GACAATCGGGTAACATT&lt;br /&gt;
GGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCACTTTCTTATGTTTAGTTT&lt;br /&gt;
CAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCATTTCA&amp;lt;/small&amp;gt;&lt;br /&gt;
&lt;br /&gt;
(Legend : &amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Initiation codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt; ; &amp;lt;b&amp;gt;HMG sequence&amp;lt;/b&amp;gt; ; &amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Stop codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;)&lt;br /&gt;
&amp;lt;/div&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Regulation of the expression of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
In humans, the SRY promoter is found at −408 bp to −95 bp upstream of the ATG initiation codon. Moreover, the SRY gene has enhancers at -727 pb upstream of the ATG initiation codon. The linkage between regulatory proteins and this enhancers have the property to increase the production of SRY protein. These regulatory proteins could be: SF1 (steroidogenic factor 1), SP1  and WT 1 (Wilms tumor). &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
*SF1: this transcriptional factor belong to the family of nuclear hormone receptor and contains a zinc finger. The activation of this protein requires a ligand (hormone).&lt;br /&gt;
&lt;br /&gt;
*SP1: this transciprional factor is a ubiquitous protein binding in site containing rich-GC sequences and implicated in the transcription of many genes. Moreover, this protein contains a zinc finger.&lt;br /&gt;
&lt;br /&gt;
*WT1:this transcriptional factor transactives SRY gene, it contains a zinc finger. &amp;lt;ref&amp;gt;Larney C, Bailey TL, Koopman P. Switching on sex: transcriptional regulation of the testis-determining gene Sry. Dev Camb Engl. 2014 Jun;141(11):2195–205. &amp;lt;/ref&amp;gt; &lt;br /&gt;
&lt;br /&gt;
==Structure==&lt;br /&gt;
&lt;br /&gt;
===The SRY-HMG domain (HMG-Box)===&lt;br /&gt;
&#039;&#039;&#039;SRY-HMG&#039;&#039;&#039; stands for &#039;&#039;&#039;S&#039;&#039;&#039;ex determining &#039;&#039;&#039;R&#039;&#039;&#039;egion &#039;&#039;&#039;Y&#039;&#039;&#039; - &#039;&#039;&#039;H&#039;&#039;&#039;igh &#039;&#039;&#039;M&#039;&#039;&#039;obility &#039;&#039;&#039;G&#039;&#039;&#039;roup domain.&lt;br /&gt;
It is approximately 80 residues long. It mediates the binding of the protein to the minor groove of DNA. It is the most important part of the SRY protein. Not only because it enable  the protein to bind the DNA but because even a little mutation can cause an inactivation of the protein.&lt;br /&gt;
&lt;br /&gt;
It has a Twisted L shape meaning that it has a long (28Å) and a short (22Å) arm. The HMG Box is made of 3 helices, its N-term and C-term are irregular. The overall structure is stabilized by a hydrophobic core especially at the intersection of the 3 helices where 3 aromatics cycles meet, surrounnded by aliphatic aminoacids.&lt;br /&gt;
&lt;br /&gt;
The interaction between the HMG-Box and DNA is specific and stable. It permits the bend of DNA (?75°). It is mostly hydrophobic interaction. Only one molecule of water interface the Box and the DNA. the complex is stabilized by salt bridges between positive charged residues of the HMG domain and negative charged phosphates.&amp;lt;ref&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[Image:HHMG-bitmap.png|thumb|alt=Image bitmap|Linear structure of hHMG domain]]&lt;br /&gt;
&lt;br /&gt;
The binding of SRY to DNA is specific. The DNA target site is a DNA octamer :&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:90%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
(5&#039;-dGCACAAAC)&lt;br /&gt;
(5&#039;-dGTTTGTGC)&lt;br /&gt;
&amp;lt;/small&amp;gt;&amp;lt;/div&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
This sequenece is found in the promoters of genes expressed during the testicular development&lt;br /&gt;
The bend of DNA permits the recruitment of different proteins and the build of massives proteins-DNA complexes that could change the expression of different genes. It is the role of a transcription factor.&amp;lt;ref&amp;gt;PMID:11563911&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
Even if the most important function of the HMG box is its capacity of binding and bending DNA, it is also involved in DNA condensation, recombination and DNA repair.&lt;br /&gt;
&lt;br /&gt;
There are 2 kinds of protein that contain a HMG box&lt;br /&gt;
* HMG1 : It is expressed in few cell types. It is found in transcription factors that contain a single HMG box. The bind to a DNA sequence is specific.&lt;br /&gt;
* HMG2 : Are found in all cell types and are abundant in chromatin. This proteins can contain two or more HMG boxes that can nonspecifically bind DNA. &lt;br /&gt;
&lt;br /&gt;
===General structure of SRY===&lt;br /&gt;
The overall structure of SRY is organized aroud the HMG-box.&lt;br /&gt;
3 domains:&lt;br /&gt;
* N-term domain&lt;br /&gt;
* Central domain : DNA binding (HMG box)&lt;br /&gt;
* C-term domain&lt;br /&gt;
&lt;br /&gt;
== Function ==&lt;br /&gt;
&lt;br /&gt;
===Sex determining===&lt;br /&gt;
&lt;br /&gt;
:It acts like a sex determinator thanks to it transcriptionnal activity. It inhibits the developpement of female sex structure in th embryonnic individual.&lt;br /&gt;
&lt;br /&gt;
The SRY protein is a transcription factor, which contains nuclear localization domains in N terminal and C terminal. An acetylation on these domains allows to export the protein SRY in the nucleus.  &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The SRY protein activates the SOX9 (SRY-box9) gene &amp;lt;ref&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;., this gene is found in the 17 chromosom in the long arm 24.3 &amp;lt;ref&amp;gt; NCBI [http://www.ncbi.nlm.nih.gov/gene/6662] &amp;lt;/ref&amp;gt; and is implicated in the stimulation of the differentiation of sertori cells. The activation of sox 9 are done with protein SRY and another transcriptional factor: SF1 (steroidogenic factor 1). These transcriptional factors are bind in an enhancers called: TESCO (testis-specific enhancer of Sox9 core element). The fixation of transcriptional factor in enhancer provokes a curvature of DNA (90°C) allowing a stabilisation of the elongation complex on the SOX9 promoter. The SOX 9 protein activates the gene AMH (anti-mullerian hormone)&amp;lt;ref&amp;gt;[http://www.ebi.ac.uk/interpro/entry/IPR006799?q=AMH] &amp;lt;/ref&amp;gt; allows the reduction of the channels of Müller in male. &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
:It has been shown that SRY would be involved in the regulation of the renin-angiotensin system in mice. Indeed, sequence mutations of the protein lead to hypertension.&lt;br /&gt;
Because the human&#039;s SRY organisation is very closed to he mouse&#039;s, it has been proposed that SRY would have the same function in human but it has not been studied directly.&amp;lt;ref&amp;gt;PMID:22315667&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Cathecolamines regulation===&lt;br /&gt;
&lt;br /&gt;
It has been shown SRY is present in brain regions and activate the Tyrosine-3-Hydroxylase expression. This enzyme catalyses the rate-limiting step of catecholamine synthesis (L-Tyrosine to L-DOPA). Furthermore, SRY also activate the expression of Monoamine Oxidase A which is responsible for the inactivation of catecholamines. Therefore, it regulates both positively and negatively the catecholamines concentration. &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
== Disease ==&lt;br /&gt;
&lt;br /&gt;
=== Swyer syndrome (AKA XY gonadal dysgenis) :===&lt;br /&gt;
&lt;br /&gt;
	If the TDF protein is not able to bind its targeted DNA sequences, the genes responsible for the testis development are not expressed. The patient owning this defective protein will then develop female characters, even though he has a XY karyotype. This phenomenon is known as the « Swyer Syndrome ». &lt;br /&gt;
Different causes can explain this « XY gonadal dysgenis », as it is also called. About thirty mutations (named [http://www.uniprot.org/uniprot/Q05066#sequences &amp;quot;SRXY1&amp;quot;]) in the SRY gene have been shown to drive this phenotype development. It can also be due to crossovers during a meiosis. If a Y chromosome portion carrying the SRY gene is recombined into a X chromosome, a sperm cell will get this abnormal Y chromosome. If it then fecundates, a XY karyotype without any SRY gene will be formed. &lt;br /&gt;
&lt;br /&gt;
=== De La Chapelle syndrome (AKA XX male syndrome) :===&lt;br /&gt;
&lt;br /&gt;
From the meiosis just described would also result an abnormal X chromosome, carrying the SRY gene. If the sperm cell owning this chromosome fecundates an ovule, the resulting newborn will have a XX karyotype but a male phenotype. This is called the « De La Chapelle syndrome ». In this case, the patient can either develop testis or both testis and ovarian tissues. As some epigenetic mechanisms can inactivate the X chromosome carrying SRY, this syndrome keeps most of the patients sterile.&amp;lt;ref&amp;gt;PMID: 4622299&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
== Relevance ==&lt;br /&gt;
&lt;br /&gt;
== Structural highlights ==&lt;br /&gt;
&lt;br /&gt;
This is a sample scene created with SAT to &amp;lt;scene name=&amp;quot;/12/3456/Sample/1&amp;quot;&amp;gt;color&amp;lt;/scene&amp;gt; by Group, and another to make &amp;lt;scene name=&amp;quot;/12/3456/Sample/2&amp;quot;&amp;gt;a transparent representation&amp;lt;/scene&amp;gt; of the protein. You can make your own scenes on SAT starting from scratch or loading and editing one of these sample scenes.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;/StructureSection&amp;gt;&lt;br /&gt;
== References ==&lt;br /&gt;
[http://ghr.nlm.nih.gov/gene/SRY Genetic Home reference]&lt;br /&gt;
&amp;lt;references/&amp;gt;&lt;/div&gt;</summary>
		<author><name>Fantin Mesny</name></author>
	</entry>
	<entry>
		<id>https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2525698</id>
		<title>Sandbox Reserved 1120</title>
		<link rel="alternate" type="text/html" href="https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2525698"/>
		<updated>2016-01-28T18:08:39Z</updated>

		<summary type="html">&lt;p&gt;Fantin Mesny: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{Sandbox_Reserved_ESBS_2015}}&amp;lt;!-- PLEASE ADD YOUR CONTENT BELOW HERE --&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==SRY protein (AKA TDF protein)==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;StructureSection load=&#039;1hry&#039; size=&#039;340&#039; side=&#039;right&#039; caption=&#039;The SRY protein linked to DNA&#039; scene=&#039;&#039;&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td colspan=&#039;2&#039;&amp;gt;The SRY protein is a 204 residues long monomeric polypeptide. It is encoded by the [https://en.wikipedia.org/wiki/Testis_determining_factor testis-determining sex gene] and is involved in the sex determination in mammels by being responsible for the gonadogenesis thus the male sexual developement. It is the HMG-box that gives to the protein its ability to bind DNA by its minor groove. &amp;lt;ref&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr id=&#039;related&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;[[Related_structure|Related:]]&amp;lt;/b&amp;gt;&amp;lt;/td&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;[[1hrz|1hrz]]&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr id=&#039;resources&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Resources:&amp;lt;/b&amp;gt;&amp;lt;/td&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;&amp;lt;span class=&#039;plainlinks&#039;&amp;gt;[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=1hry FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=1hry OCA], [http://pdbe.org/1hry PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=1hry RCSB], [http://www.ebi.ac.uk/pdbsum/1hry PDBsum]&lt;br /&gt;
&lt;br /&gt;
&amp;lt;tr id=&#039;Molecular weight&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Molecular weight&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;≈23kDa&lt;br /&gt;
&amp;lt;tr id=&#039;Gene&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Gene&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;XXXX kDa&lt;br /&gt;
&amp;lt;tr id=&#039;Length&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Length&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;XXXX kDa&lt;br /&gt;
&amp;lt;tr id=&#039;Regulation&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Regulation&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;[https://en.wikipedia.org/wiki/Steroidogenic_factor_1 Sf1];[https://en.wikipedia.org/wiki/Sp1_transcription_factor Sp1] (2 binding site in the promoter of SRY : -150 and -13),[https://en.wikipedia.org/wiki/WT1 WT1] (2 binding sites in the promoter of SRY : -78 and -87)&lt;br /&gt;
&amp;lt;tr id=&#039;DNA target sequence&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;DNA target sequence&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;XXXX kDa&lt;br /&gt;
&amp;lt;tr id=&#039;Genes targeted&#039;&amp;gt;&amp;lt;td class=&amp;quot;sblockLbl&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Genes targeted&amp;lt;/b&amp;gt;&amp;lt;td class=&amp;quot;sblockDat&amp;quot;&amp;gt;XXXX kDa&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;/span&amp;gt;&lt;br /&gt;
&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;/table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
===Properties===&lt;br /&gt;
&lt;br /&gt;
&amp;lt;table style=&amp;quot;width:100%&amp;quot;;border: 1px solid #A0A0A0&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Molecular weight&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Gene&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Length&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;DNA target sequence&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Genes targeted&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Inhibitors&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;/table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==History==&lt;br /&gt;
&lt;br /&gt;
After centuries of unfounded theories mainly based on environmental factors, the first molecular theory concerning the sex determination appeared in 1891. At this time, the german biologist Hermann Henking was studying sperm formation in wasps. As a chromosome which was not present in all the wasps looked different from the others, he suspected it to play a role in sex determination and called it the &amp;quot;X chromosome&amp;quot;.&lt;br /&gt;
Ten years later, Clarence Erwin McClung saw that this chromosome behaved differently during the meiosis and was only present in half the sperm cells of grasshoppers. As the main characteristic that varies in 50/50 proportions among zygotes is the sex, McClung suspected the X chromosome to be implicated in sexual development. &lt;br /&gt;
In 1905, Nettie Stevens discovered the &amp;quot;Y chromosome&amp;quot; (and the female XX and male XY patterns) while she was counting the chromosomes of beetles under the microscope&amp;lt;ref&amp;gt;Sumner, A. T. Sex Chromosomes and Sex Determination. Chromosomes: Organization and Function, 97-108. [http://www.nature.com/scitable/nated/topicpage/Sex-Chromosomes-and-Sex-Determination-44565]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
During the next decades, a few theories were in competition. In 1921, Calvin Bridges&#039;s works on &#039;&#039;Drosophila melanogaster&#039;&#039; seemed to reveal that male characters acquisition is due to a genic balance between the genes contained in the X chromosome and those contained in the autosomes&amp;lt;ref&amp;gt;PMID: 17769897&amp;lt;/ref&amp;gt;.&lt;br /&gt;
In 1930, Ronald Fisher introduced the first Y-based control of sex theory by proposing two different models : either all the genes responsible for the male characters are located on the Y chromosome or there is a Y-located gene which regulates the expression of genes elsewhere in the genome&amp;lt;ref&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt;.&lt;br /&gt;
As Alfred Jost had shown the testosterone produced by the testis is responsible for the entire male phenotype acquisition&amp;lt;ref&amp;gt;PMID: 4805859&amp;lt;/ref&amp;gt;, in 1988, Peter Neville Goodfellow proposed that there is a gene (&#039;&#039;TDF&#039;&#039; in human, &#039;&#039;Tdy&#039;&#039; in mice)  on the Y chromosome which drives the development of the testis.&amp;lt;ref&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt; In 1990, Goodfellow&#039;s hypothesis was validated with the discovery of &#039;&#039;Tdy&#039;&#039;&#039;s localisation. This gene&#039;s product (expressed during the male gonadal development) owns an amino-acid motif showing homology to other known or putative DNA-binding domains. &#039;&#039;Tdy&#039;&#039; is therefore a transcriptional factor&amp;lt;ref&amp;gt;PMID: 2374589&amp;lt;/ref&amp;gt;. The same year, the human &#039;&#039;SRY&#039;&#039; gene (accepted later as the &#039;&#039;TDF&#039;&#039;) was discovered&amp;lt;ref&amp;gt;PMID: 1695712&amp;lt;/ref&amp;gt;. &lt;br /&gt;
Three dimensional structure of the SRY protein was determined in 1995 using NMR spectroscopy&amp;lt;ref&amp;gt;PMID: 7774012&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==SRY gene==&lt;br /&gt;
&lt;br /&gt;
===Generality===&lt;br /&gt;
&lt;br /&gt;
The SRY gene encodes the SRY protein. The SRY protein is a transcriptional factor inducing the male phenotype in embryo. The SRY gene is located on the [https://en.wikipedia.org/wiki/Y_chromosome Y chromosom] in the short arm (p) 11.3 &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/gene/6736]&amp;lt;/ref&amp;gt;. This gene has only one exon containing the HMG domain (DNA-binding high-mobility group box domain). That&#039;s means that SRY mRNA does not have a alternative splicing, so there is one isoform of SRY protein.&amp;lt;ref&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;. Moreover,the human genome contains one copy of the SRY gene, whereas the mouse genome contains 6 copy of this gene. &amp;lt;ref&amp;gt; Sekido R, Lovell-Badge R. Genetic control of testis development. Sex Dev Genet Mol Biol Evol Endocrinol Embryol Pathol Sex Determ Differ. 2013;7(1-3):21–32 &amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Sequence of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:90%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
&amp;gt;gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/nuccore]&amp;lt;/ref&amp;gt;&lt;br /&gt;
TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT&lt;br /&gt;
TTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACA&lt;br /&gt;
&amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;ATG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;CAATCATATGCTTCTGCTATGTTAAGCGTATTCAACAGCGATGATTACAGTCCAGCTGTGCAAGAGAAT&lt;br /&gt;
ATTCCCGCTCTCCGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTAAGTATCAGTGTGAAA&lt;br /&gt;
CGGGAGAAAACAGTAAAGGCAACGTCCAGGATAGAGTGAAGCGACCCATGAACGCATTCATCGTGTGGTC&lt;br /&gt;
&#039;&#039;&#039;TCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCAGAGATCAGCAAGCAGCTG&lt;br /&gt;
&#039;&#039;&#039;GGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCATTCTTCCAGGAGGCACAGAAATTACAGG&lt;br /&gt;
&#039;&#039;&#039;CCATGCACAGAGAGAAATACCCGAATTATAAGTATCGA&#039;&#039;&#039;CCTCGTCGGAAGGCGAAGATGCTGCCGAAGAA&lt;br /&gt;
TTGCAGTTTGCTTCCCGCAGATCCCGCTTCGGTACTCTGCAGCGAAGTGCAACTGGACAACAGGTTGTAC&lt;br /&gt;
AGGGATGACTGTACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAACG&lt;br /&gt;
CAGCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTG&amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;TAG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;GACAATCGGGTAACATT&lt;br /&gt;
GGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCACTTTCTTATGTTTAGTTT&lt;br /&gt;
CAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCATTTCA&amp;lt;/small&amp;gt;&lt;br /&gt;
&lt;br /&gt;
(Legend : &amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Initiation codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt; ; &amp;lt;b&amp;gt;HMG sequence&amp;lt;/b&amp;gt; ; &amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Stop codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;)&lt;br /&gt;
&amp;lt;/div&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Regulation of the expression of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
In humans, the SRY promoter is found at −408 bp to −95 bp upstream of the ATG initiation codon. Moreover, the SRY gene has enhancers at -727 pb upstream of the ATG initiation codon. The linkage between regulatory proteins and this enhancers have the property to increase the production of SRY protein. These regulatory proteins could be: SF1 (steroidogenic factor 1), SP1  and WT 1 (Wilms tumor). &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
*SF1: this transcriptional factor belong to the family of nuclear hormone receptor and contains a zinc finger. The activation of this protein requires a ligand (hormone).&lt;br /&gt;
&lt;br /&gt;
*SP1: this transciprional factor is a ubiquitous protein binding in site containing rich-GC sequences and implicated in the transcription of many genes. Moreover, this protein contains a zinc finger.&lt;br /&gt;
&lt;br /&gt;
*WT1:this transcriptional factor transactives SRY gene, it contains a zinc finger. &amp;lt;ref&amp;gt;Larney C, Bailey TL, Koopman P. Switching on sex: transcriptional regulation of the testis-determining gene Sry. Dev Camb Engl. 2014 Jun;141(11):2195–205. &amp;lt;/ref&amp;gt; &lt;br /&gt;
&lt;br /&gt;
==Structure==&lt;br /&gt;
&lt;br /&gt;
===The SRY-HMG domain (HMG-Box)===&lt;br /&gt;
&#039;&#039;&#039;SRY-HMG&#039;&#039;&#039; stands for &#039;&#039;&#039;S&#039;&#039;&#039;ex determining &#039;&#039;&#039;R&#039;&#039;&#039;egion &#039;&#039;&#039;Y&#039;&#039;&#039; - &#039;&#039;&#039;H&#039;&#039;&#039;igh &#039;&#039;&#039;M&#039;&#039;&#039;obility &#039;&#039;&#039;G&#039;&#039;&#039;roup domain.&lt;br /&gt;
It is approximately 80 residues long. It mediates the binding of the protein to the minor groove of DNA. It is the most important part of the SRY protein. Not only because it enable  the protein to bind the DNA but because even a little mutation can cause an inactivation of the protein.&lt;br /&gt;
&lt;br /&gt;
It has a Twisted L shape meaning that it has a long (28Å) and a short (22Å) arm. The HMG Box is made of 3 helices, its N-term and C-term are irregular. The overall structure is stabilized by a hydrophobic core especially at the intersection of the 3 helices where 3 aromatics cycles meet, surrounnded by aliphatic aminoacids.&lt;br /&gt;
&lt;br /&gt;
The interaction between the HMG-Box and DNA is specific and stable. It permits the bend of DNA (?75°). It is mostly hydrophobic interaction. Only one molecule of water interface the Box and the DNA. the complex is stabilized by salt bridges between positive charged residues of the HMG domain and negative charged phosphates.&amp;lt;ref&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[Image:HHMG-bitmap.png|thumb|alt=Image bitmap|Linear structure of hHMG domain]]&lt;br /&gt;
&lt;br /&gt;
The binding of SRY to DNA is specific. The DNA target site is a DNA octamer :&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:90%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
(5&#039;-dGCACAAAC)&lt;br /&gt;
(5&#039;-dGTTTGTGC)&lt;br /&gt;
&amp;lt;/small&amp;gt;&amp;lt;/div&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
This sequenece is found in the promoters of genes expressed during the testicular development&lt;br /&gt;
The bend of DNA permits the recruitment of different proteins and the build of massives proteins-DNA complexes that could change the expression of different genes. It is the role of a transcription factor.&amp;lt;ref&amp;gt;PMID:11563911&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
Even if the most important function of the HMG box is its capacity of binding and bending DNA, it is also involved in DNA condensation, recombination and DNA repair.&lt;br /&gt;
&lt;br /&gt;
There are 2 kinds of protein that contain a HMG box&lt;br /&gt;
* HMG1 : It is expressed in few cell types. It is found in transcription factors that contain a single HMG box. The bind to a DNA sequence is specific.&lt;br /&gt;
* HMG2 : Are found in all cell types and are abundant in chromatin. This proteins can contain two or more HMG boxes that can nonspecifically bind DNA. &lt;br /&gt;
&lt;br /&gt;
===General structure of SRY===&lt;br /&gt;
The overall structure of SRY is organized aroud the HMG-box.&lt;br /&gt;
3 domains:&lt;br /&gt;
* N-term domain&lt;br /&gt;
* Central domain : DNA binding (HMG box)&lt;br /&gt;
* C-term domain&lt;br /&gt;
&lt;br /&gt;
== Function ==&lt;br /&gt;
&lt;br /&gt;
===Sex determining===&lt;br /&gt;
&lt;br /&gt;
:It acts like a sex determinator thanks to it transcriptionnal activity. It inhibits the developpement of female sex structure in th embryonnic individual.&lt;br /&gt;
&lt;br /&gt;
The SRY protein is a transcription factor, which contains nuclear localization domains in N terminal and C terminal. An acetylation on these domains allows to export the protein SRY in the nucleus.  &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The SRY protein activates the SOX9 (SRY-box9) gene &amp;lt;ref&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;., this gene is found in the 17 chromosom in the long arm 24.3 &amp;lt;ref&amp;gt; NCBI [http://www.ncbi.nlm.nih.gov/gene/6662] &amp;lt;/ref&amp;gt; and is implicated in the stimulation of the differentiation of sertori cells. The activation of sox 9 are done with protein SRY and another transcriptional factor: SF1 (steroidogenic factor 1). These transcriptional factors are bind in an enhancers called: TESCO (testis-specific enhancer of Sox9 core element). The fixation of transcriptional factor in enhancer provokes a curvature of DNA (90°C) allowing a stabilisation of the elongation complex on the SOX9 promoter. The SOX 9 protein activates the gene AMH (anti-mullerian hormone)&amp;lt;ref&amp;gt;[http://www.ebi.ac.uk/interpro/entry/IPR006799?q=AMH] &amp;lt;/ref&amp;gt; allows the reduction of the channels of Müller in male. &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
:It has been shown that SRY would be involved in the regulation of the renin-angiotensin system in mice. Indeed, sequence mutations of the protein lead to hypertension.&lt;br /&gt;
Because the human&#039;s SRY organisation is very closed to he mouse&#039;s, it has been proposed that SRY would have the same function in human but it has not been studied directly.&amp;lt;ref&amp;gt;PMID:22315667&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Cathecolamines regulating===&lt;br /&gt;
&lt;br /&gt;
It has been shown SRY is present in brain regions and activate the Tyrosine-3-Hydroxylase expression. This enzyme is responsible for the catalysis of the rate-limiting step of catecholamine synthesis (L-Tyrosine to L-DOPA). Furthermore, SRY also activate the expression of Monoamine Oxidase A which is responsible for the inactivation of catecholamines. &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
== Disease ==&lt;br /&gt;
&lt;br /&gt;
=== Swyer syndrome (AKA XY gonadal dysgenis) :===&lt;br /&gt;
&lt;br /&gt;
	If the TDF protein is not able to bind its targeted DNA sequences, the genes responsible for the testis development are not expressed. The patient owning this defective protein will then develop female characters, even though he has a XY karyotype. This phenomenon is known as the « Swyer Syndrome ». &lt;br /&gt;
Different causes can explain this « XY gonadal dysgenis », as it is also called. About thirty mutations (named [http://www.uniprot.org/uniprot/Q05066#sequences &amp;quot;SRXY1&amp;quot;]) in the SRY gene have been shown to drive this phenotype development. It can also be due to crossovers during a meiosis. If a Y chromosome portion carrying the SRY gene is recombined into a X chromosome, a sperm cell will get this abnormal Y chromosome. If it then fecundates, a XY karyotype without any SRY gene will be formed. &lt;br /&gt;
&lt;br /&gt;
=== De La Chapelle syndrome (AKA XX male syndrome) :===&lt;br /&gt;
&lt;br /&gt;
From the meiosis just described would also result an abnormal X chromosome, carrying the SRY gene. If the sperm cell owning this chromosome fecundates an ovule, the resulting newborn will have a XX karyotype but a male phenotype. This is called the « De La Chapelle syndrome ». In this case, the patient can either develop testis or both testis and ovarian tissues. As some epigenetic mechanisms can inactivate the X chromosome carrying SRY, this syndrome keeps most of the patients sterile.&amp;lt;ref&amp;gt;PMID: 4622299&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
== Relevance ==&lt;br /&gt;
&lt;br /&gt;
== Structural highlights ==&lt;br /&gt;
&lt;br /&gt;
This is a sample scene created with SAT to &amp;lt;scene name=&amp;quot;/12/3456/Sample/1&amp;quot;&amp;gt;color&amp;lt;/scene&amp;gt; by Group, and another to make &amp;lt;scene name=&amp;quot;/12/3456/Sample/2&amp;quot;&amp;gt;a transparent representation&amp;lt;/scene&amp;gt; of the protein. You can make your own scenes on SAT starting from scratch or loading and editing one of these sample scenes.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;/StructureSection&amp;gt;&lt;br /&gt;
== References ==&lt;br /&gt;
[http://ghr.nlm.nih.gov/gene/SRY Genetic Home reference]&lt;br /&gt;
&amp;lt;references/&amp;gt;&lt;/div&gt;</summary>
		<author><name>Fantin Mesny</name></author>
	</entry>
	<entry>
		<id>https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2525375</id>
		<title>Sandbox Reserved 1120</title>
		<link rel="alternate" type="text/html" href="https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2525375"/>
		<updated>2016-01-28T10:31:59Z</updated>

		<summary type="html">&lt;p&gt;Fantin Mesny: Undo revision 2525374 by Fantin Mesny (Talk)&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{Sandbox_Reserved_ESBS_2015}}&amp;lt;!-- PLEASE ADD YOUR CONTENT BELOW HERE --&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==SRY protein (AKA TDF protein)==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;StructureSection load=&#039;1hry&#039; size=&#039;340&#039; side=&#039;right&#039; caption=&#039;The SRY protein linked to DNA&#039; scene=&#039;&#039;&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The SRY protein is a 204 residues long monomeric polypeptide. It is a &#039;&#039;&#039;transcriptionnal factor&#039;&#039;&#039;, It activates the &#039;&#039;&#039;M&#039;&#039;&#039;üllerian &#039;&#039;&#039;I&#039;&#039;&#039;nhibiting &#039;&#039;&#039;S&#039;&#039;&#039;ubstance (&#039;&#039;&#039;MIS&#039;&#039;&#039; gene).&lt;br /&gt;
It is encoded by the [[testis-determining sex gene]] and is itself involved in the sex determination in mammels by being responsible for the gonadogenesis thus the male sexual developement. It is the HMG-box that gives to the protein its ability to bind DNA by its minor groove. &amp;lt;ref&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Properties===&lt;br /&gt;
&lt;br /&gt;
&amp;lt;table style=&amp;quot;width:100%&amp;quot;;border: 1px solid #A0A0A0&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Molecular weight&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Gene&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Length&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;DNA target sequence&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Genes targeted&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Inhibitors&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;/table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==History==&lt;br /&gt;
&lt;br /&gt;
After centuries of unfounded theories mainly based on environmental factors, the first molecular theory concerning the sex determination appeared in 1891. At this time, the german biologist Hermann Henking was studying sperm formation in wasps. As a chromosome which was not present in all the wasps looked different from the others, he suspected it to play a role in sex determination and called it the &amp;quot;X chromosome&amp;quot;.&lt;br /&gt;
Ten years later, Clarence Erwin McClung saw that this chromosome behaved differently during the meiosis and was only present in half the sperm cells of grasshoppers. As the main characteristic that varies in 50/50 proportions among zygotes is the sex, McClung suspected the X chromosome to be implicated in sexual development. &lt;br /&gt;
In 1905, Nettie Stevens discovered the &amp;quot;Y chromosome&amp;quot; (and the female XX and male XY patterns) while she was counting the chromosomes of beetles under the microscope&amp;lt;ref&amp;gt;Sumner, A. T. Sex Chromosomes and Sex Determination. Chromosomes: Organization and Function, 97-108. [http://www.nature.com/scitable/nated/topicpage/Sex-Chromosomes-and-Sex-Determination-44565]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
During the next decades, a few theories were in competition. In 1921, Calvin Bridges&#039;s works on &#039;&#039;Drosophila melanogaster&#039;&#039; seemed to reveal that male characters acquisition is due to a genic balance between the genes contained in the X chromosome and those contained in the autosomes&amp;lt;ref&amp;gt;PMID: 17769897&amp;lt;/ref&amp;gt;.&lt;br /&gt;
In 1930, Ronald Fisher introduced the first Y-based control of sex theory by proposing two different models : either all the genes responsible for the male characters are located on the Y chromosome or there is a Y-located gene which regulates the expression of genes elsewhere in the genome&amp;lt;ref&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt;.&lt;br /&gt;
As Alfred Jost had shown the testosterone produced by the testis is responsible for the entire male phenotype acquisition&amp;lt;ref&amp;gt;PMID: 4805859&amp;lt;/ref&amp;gt;, in 1988, Peter Neville Goodfellow proposed that there is a gene (&#039;&#039;TDF&#039;&#039; in human, &#039;&#039;Tdy&#039;&#039; in mice)  on the Y chromosome which drives the development of the testis.&amp;lt;ref&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt; In 1990, Goodfellow&#039;s hypothesis was validated with the discovery of &#039;&#039;Tdy&#039;&#039;&#039;s localisation. This gene&#039;s product (expressed during the male gonadal development) owns an amino-acid motif showing homology to other known or putative DNA-binding domains. &#039;&#039;Tdy&#039;&#039; is therefore a transcriptional factor&amp;lt;ref&amp;gt;PMID: 2374589&amp;lt;/ref&amp;gt;. The same year, the human &#039;&#039;SRY&#039;&#039; gene (accepted later as the &#039;&#039;TDF&#039;&#039;) was discovered&amp;lt;ref&amp;gt;PMID: 1695712&amp;lt;/ref&amp;gt;. &lt;br /&gt;
Three dimensional structure of the SRY protein was determined in 1995 using NMR spectroscopy&amp;lt;ref&amp;gt;PMID: 7774012&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==SRY gene==&lt;br /&gt;
&lt;br /&gt;
===Generality===&lt;br /&gt;
&lt;br /&gt;
The SRY gene encodes the SRY protein. The SRY protein is a transcriptional factor inducing the male phenotype in embryo. The SRY gene is located on the [https://en.wikipedia.org/wiki/Y_chromosome Y chromosom] in the short arm (p) 11.3 &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/gene/6736]&amp;lt;/ref&amp;gt;. This gene has only one exon containing the HMG domain (DNA-binding high-mobility group box domain). That&#039;s means that SRY mRNA does not have a alternative splicing, so there is one isoform of SRY protein.&amp;lt;ref&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;. Moreover,the human genome contains one copy of the SRY gene, whereas the mouse genome contains 6 copy of this gene. &amp;lt;ref&amp;gt; Sekido R, Lovell-Badge R. Genetic control of testis development. Sex Dev Genet Mol Biol Evol Endocrinol Embryol Pathol Sex Determ Differ. 2013;7(1-3):21–32 &amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Sequence of the SRY gene===&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:90%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
&amp;gt;gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/nuccore]&amp;lt;/ref&amp;gt;&lt;br /&gt;
TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT&lt;br /&gt;
TTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACA&lt;br /&gt;
&amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;ATG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;CAATCATATGCTTCTGCTATGTTAAGCGTATTCAACAGCGATGATTACAGTCCAGCTGTGCAAGAGAAT&lt;br /&gt;
ATTCCCGCTCTCCGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTAAGTATCAGTGTGAAA&lt;br /&gt;
CGGGAGAAAACAGTAAAGGCAACGTCCAGGATAGAGTGAAGCGACCCATGAACGCATTCATCGTGTGGTC&lt;br /&gt;
&#039;&#039;&#039;TCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCAGAGATCAGCAAGCAGCTG&lt;br /&gt;
&#039;&#039;&#039;GGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCATTCTTCCAGGAGGCACAGAAATTACAGG&lt;br /&gt;
&#039;&#039;&#039;CCATGCACAGAGAGAAATACCCGAATTATAAGTATCGA&#039;&#039;&#039;CCTCGTCGGAAGGCGAAGATGCTGCCGAAGAA&lt;br /&gt;
TTGCAGTTTGCTTCCCGCAGATCCCGCTTCGGTACTCTGCAGCGAAGTGCAACTGGACAACAGGTTGTAC&lt;br /&gt;
AGGGATGACTGTACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAACG&lt;br /&gt;
CAGCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTG&amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;TAG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;GACAATCGGGTAACATT&lt;br /&gt;
GGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCACTTTCTTATGTTTAGTTT&lt;br /&gt;
CAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCATTTCA&amp;lt;/small&amp;gt;&lt;br /&gt;
&lt;br /&gt;
(Legend : &amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Initiation codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt; ; &amp;lt;b&amp;gt;HMG sequence&amp;lt;/b&amp;gt; ; &amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Stop codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;)&lt;br /&gt;
&amp;lt;/div&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Regulation of the expression of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
In humans, the SRY promoter is found at −408 bp to −95 bp upstream of the ATG initiation codon. Moreover, the SRY gene has enhancers at -727 pb upstream of the ATG initiation codon. The linkage between regulatory proteins and this enhancers have the property to increase the production of SRY protein. These regulatory proteins could be: SF1 (steroidogenic factor 1), SP1  and WT 1 (Wilms tumor). &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
*SF1: this transcriptional factor belong to the family of nuclear hormone receptor and contains a zinc finger. The activation of this protein requires a ligand (hormone).&lt;br /&gt;
&lt;br /&gt;
*SP1: this transciprional factor is a ubiquitous protein binding in site containing rich-GC sequences and implicated in the transcription of many genes. Moreover, this protein contains a zinc finger.&lt;br /&gt;
&lt;br /&gt;
*WT1:this transcriptional factor transactives SRY gene, it contains a zinc finger. &amp;lt;ref&amp;gt;Larney C, Bailey TL, Koopman P. Switching on sex: transcriptional regulation of the testis-determining gene Sry. Dev Camb Engl. 2014 Jun;141(11):2195–205. &amp;lt;/ref&amp;gt; &lt;br /&gt;
&lt;br /&gt;
=== Role of the SRY gene ===&lt;br /&gt;
&lt;br /&gt;
The SRY protein is a transcription factor, which contains nuclear localization domains in N terminal and C terminal. An acetylation on these domains allows to export the protein SRY in the nucleus.  &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The SRY protein activates the SOX9 (SRY-box9) gene &amp;lt;ref&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;., this gene is found in the 17 chromosom in the long arm 24.3 &amp;lt;ref&amp;gt; NCBI [http://www.ncbi.nlm.nih.gov/gene/6662] &amp;lt;/ref&amp;gt; and is implicated in the stimulation of the differentiation of sertori cells. The activation of sox 9 are done with protein SRY and another transcriptional factor: SF1 (steroidogenic factor 1). These transcriptional factors are bind in an enhancers called: TESCO (testis-specific enhancer of Sox9 core element). The fixation of transcriptional factor in enhancer provokes a curvature of DNA (90°C) allowing a stabilisation of the elongation complex on the SOX9 promoter. The SOX 9 protein activates the gene AMH (anti-mullerian hormone)&amp;lt;ref&amp;gt;[http://www.ebi.ac.uk/interpro/entry/IPR006799?q=AMH] &amp;lt;/ref&amp;gt; allows the reduction of the channels of Müller in male. &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==Structure==&lt;br /&gt;
&lt;br /&gt;
===The SRY-HMG domain (HMG-Box)===&lt;br /&gt;
&#039;&#039;&#039;SRY-HMG&#039;&#039;&#039; stands for &#039;&#039;&#039;S&#039;&#039;&#039;ex determining &#039;&#039;&#039;R&#039;&#039;&#039;egion &#039;&#039;&#039;Y&#039;&#039;&#039; - &#039;&#039;&#039;H&#039;&#039;&#039;igh &#039;&#039;&#039;M&#039;&#039;&#039;obility &#039;&#039;&#039;G&#039;&#039;&#039;roup domain.&lt;br /&gt;
It is approximately 80 residues long. It mediates the binding of the protein to the minor groove of DNA. It is the most important part of the SRY protein. Not only because it enable  the protein to bind the DNA but because even a little mutation can cause an inactivation of the protein.&lt;br /&gt;
&lt;br /&gt;
It has a Twisted L shape meaning that it has a long (28Å) and a short (22Å) arm. The HMG Box is made of 3 helices, its N-term and C-term are irregular. The overall structure is stabilized by a hydrophobic core especially at the intersection of the 3 helices where 3 aromatics cycles meet, surrounnded by aliphatic aminoacids.&lt;br /&gt;
&lt;br /&gt;
The interaction between the HMG-Box and DNA is specific and stable. It permits the bend of DNA (?75°). It is mostly hydrophobic interaction. Only one molecule of water interface the Box and the DNA. the complex is stabilized by salt bridges between positive charged residues of the HMG domain and negative charged phosphates.&amp;lt;ref&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[Image:HHMG-bitmap.png|thumb|alt=Image bitmap|Linear structure of hHMG domain]]&lt;br /&gt;
&lt;br /&gt;
The binding of SRY to DNA is specific. The DNA target site is a DNA octamer :&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;(5&#039;-dGCACAAAC)&lt;br /&gt;
(5&#039;-dGTTTGTGC)&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
This sequenece is found in the promoters of genes expressed during the testicular development&lt;br /&gt;
The bend of DNA permits the recruitment of different proteins and the build of massives proteins-DNA complexes that could change the expression of different genes. It is the role of a transcription factor.&amp;lt;ref&amp;gt;PMID:11563911&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
Even if the most important function of the HMG box is its capacity of binding and bending DNA, it is also involved in DNA condensation, recombination and DNA repair.&lt;br /&gt;
&lt;br /&gt;
There are 2 kinds of protein that contain a HMG box&lt;br /&gt;
* HMG1 : It is expressed in few cell types. It is found in transcription factors that contain a single HMG box. The bind to a DNA sequence is specific.&lt;br /&gt;
* HMG2 : Are found in all cell types and are abundant in chromatin. This proteins can contain two or more HMG boxes that can nonspecifically bind DNA. &lt;br /&gt;
&lt;br /&gt;
===General structure of SRY===&lt;br /&gt;
The overall structure of SRY is organized aroud the HMG-box.&lt;br /&gt;
3 domains:&lt;br /&gt;
* N-term domain&lt;br /&gt;
* Central domain : DNA binding (HMG box)&lt;br /&gt;
* C-term domain&lt;br /&gt;
&lt;br /&gt;
== Function ==&lt;br /&gt;
&lt;br /&gt;
===Sex determining===&lt;br /&gt;
&lt;br /&gt;
It acts like a sex determinator thanks to it transcriptionnal activity. It inhibits the developpement of female sex structure in th embryonnic individual.&lt;br /&gt;
&lt;br /&gt;
It has been shown that SRY would be involved in the regulation of the renin-angiotensin system in mice. Indeed, sequence mutations of the protein lead to hypertension.&lt;br /&gt;
Because the human&#039;s SRY organisation is very closed to he mouse&#039;s, it has been proposed that SRY would have the same function in human but it has not been studied directly.&lt;br /&gt;
&lt;br /&gt;
== Disease ==&lt;br /&gt;
&lt;br /&gt;
=== Swyer syndrome (AKA XY gonadal dysgenis) :===&lt;br /&gt;
&lt;br /&gt;
	If the TDF protein is not able to bind its targeted DNA sequences, the genes responsible for the testis development are not expressed. The patient owning this defective protein will then develop female characters, even though he has a XY karyotype. This phenomenon is known as the « Swyer Syndrome ». &lt;br /&gt;
Different causes can explain this « XY gonadal dysgenis », as it is also called. About thirty mutations (named [http://www.uniprot.org/uniprot/Q05066#sequences &amp;quot;SRXY1&amp;quot;]) in the SRY gene have been shown to drive this phenotype development. It can also be due to crossovers during a meiosis. If a Y chromosome portion carrying the SRY gene is recombined into a X chromosome, a sperm cell will get this abnormal Y chromosome. If it then fecundates, a XY karyotype without any SRY gene will be formed. &lt;br /&gt;
&lt;br /&gt;
=== De La Chapelle syndrome (AKA XX male syndrome) :===&lt;br /&gt;
&lt;br /&gt;
From the meiosis just described would also result an abnormal X chromosome, carrying the SRY gene. If the sperm cell owning this chromosome fecundates an ovule, the resulting newborn will have a XX karyotype but a male phenotype. This is called the « De La Chapelle syndrome ». In this case, the patient can either develop testis or both testis and ovarian tissues. As some epigenetic mechanisms can inactivate the X chromosome carrying SRY, this syndrome keeps most of the patients sterile.&amp;lt;ref&amp;gt;PMID: 4622299&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
== Relevance ==&lt;br /&gt;
&lt;br /&gt;
== Structural highlights ==&lt;br /&gt;
&lt;br /&gt;
This is a sample scene created with SAT to &amp;lt;scene name=&amp;quot;/12/3456/Sample/1&amp;quot;&amp;gt;color&amp;lt;/scene&amp;gt; by Group, and another to make &amp;lt;scene name=&amp;quot;/12/3456/Sample/2&amp;quot;&amp;gt;a transparent representation&amp;lt;/scene&amp;gt; of the protein. You can make your own scenes on SAT starting from scratch or loading and editing one of these sample scenes.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;/StructureSection&amp;gt;&lt;br /&gt;
== References ==&lt;br /&gt;
[http://ghr.nlm.nih.gov/gene/SRY Genetic Home reference]&lt;br /&gt;
&amp;lt;references/&amp;gt;&lt;/div&gt;</summary>
		<author><name>Fantin Mesny</name></author>
	</entry>
	<entry>
		<id>https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2525374</id>
		<title>Sandbox Reserved 1120</title>
		<link rel="alternate" type="text/html" href="https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2525374"/>
		<updated>2016-01-28T10:30:20Z</updated>

		<summary type="html">&lt;p&gt;Fantin Mesny: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{Sandbox_Reserved_ESBS_2015}}&amp;lt;!-- PLEASE ADD YOUR CONTENT BELOW HERE --&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==SRY protein (AKA TDF protein)==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;StructureSection load=&#039;1hry&#039; size=&#039;340&#039; side=&#039;right&#039; caption=&#039;The SRY protein linked to DNA&#039; scene=&#039;&#039;&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The SRY protein is a 204 residues long monomeric polypeptide. It is a &#039;&#039;&#039;transcriptionnal factor&#039;&#039;&#039;, It activates the &#039;&#039;&#039;M&#039;&#039;&#039;üllerian &#039;&#039;&#039;I&#039;&#039;&#039;nhibiting &#039;&#039;&#039;S&#039;&#039;&#039;ubstance (&#039;&#039;&#039;MIS&#039;&#039;&#039; gene).&lt;br /&gt;
It is encoded by the [[testis-determining sex gene]] and is itself involved in the sex determination in mammels by being responsible for the gonadogenesis thus the male sexual developement. It is the HMG-box that gives to the protein its ability to bind DNA by its minor groove. &amp;lt;ref&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Properties===&lt;br /&gt;
&lt;br /&gt;
&amp;lt;table style=&amp;quot;width:100%&amp;quot;;border: 1px solid #A0A0A0&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Molecular weight&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Gene&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Length&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;DNA target sequence&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Genes targeted&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Inhibitors&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;/table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==History==&lt;br /&gt;
&lt;br /&gt;
After centuries of unfounded theories mainly based on environmental factors, the first molecular theory concerning the sex determination appeared in 1891. At this time, the german biologist Hermann Henking was studying sperm formation in wasps. As a chromosome which was not present in all the wasps looked different from the others, he suspected it to play a role in sex determination and called it the &amp;quot;X chromosome&amp;quot;.&lt;br /&gt;
Ten years later, Clarence Erwin McClung saw that this chromosome behaved differently during the meiosis and was only present in half the sperm cells of grasshoppers. As the main characteristic that varies in 50/50 proportions among zygotes is the sex, McClung suspected the X chromosome to be implicated in sexual development. &lt;br /&gt;
In 1905, Nettie Stevens discovered the &amp;quot;Y chromosome&amp;quot; (and the female XX and male XY patterns) while she was counting the chromosomes of beetles under the microscope&amp;lt;ref&amp;gt;Sumner, A. T. Sex Chromosomes and Sex Determination. Chromosomes: Organization and Function, 97-108. [http://www.nature.com/scitable/nated/topicpage/Sex-Chromosomes-and-Sex-Determination-44565]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
During the next decades, a few theories were in competition. In 1921, Calvin Bridges&#039;s works on &#039;&#039;Drosophila melanogaster&#039;&#039; seemed to reveal that male characters acquisition is due to a genic balance between the genes contained in the X chromosome and those contained in the autosomes&amp;lt;ref&amp;gt;PMID: 17769897&amp;lt;/ref&amp;gt;.&lt;br /&gt;
In 1930, Ronald Fisher introduced the first Y-based control of sex theory by proposing two different models : either all the genes responsible for the male characters are located on the Y chromosome or there is a Y-located gene which regulates the expression of genes elsewhere in the genome&amp;lt;ref&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt;.&lt;br /&gt;
As Alfred Jost had shown the testosterone produced by the testis is responsible for the entire male phenotype acquisition&amp;lt;ref&amp;gt;PMID: 4805859&amp;lt;/ref&amp;gt;, in 1988, Peter Neville Goodfellow proposed that there is a gene (&#039;&#039;TDF&#039;&#039; in human, &#039;&#039;Tdy&#039;&#039; in mice)  on the Y chromosome which drives the development of the testis.&amp;lt;ref&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt; In 1990, Goodfellow&#039;s hypothesis was validated with the discovery of &#039;&#039;Tdy&#039;&#039;&#039;s localisation. This gene&#039;s product (expressed during the male gonadal development) owns an amino-acid motif showing homology to other known or putative DNA-binding domains. &#039;&#039;Tdy&#039;&#039; is therefore a transcriptional factor&amp;lt;ref&amp;gt;PMID: 2374589&amp;lt;/ref&amp;gt;. The same year, the human &#039;&#039;SRY&#039;&#039; gene (accepted later as the &#039;&#039;TDF&#039;&#039;) was discovered&amp;lt;ref&amp;gt;PMID: 1695712&amp;lt;/ref&amp;gt;. &lt;br /&gt;
Three dimensional structure of the SRY protein was determined in 1995 using NMR spectroscopy&amp;lt;ref&amp;gt;PMID: 7774012&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==SRY gene==&lt;br /&gt;
&lt;br /&gt;
===Generality===&lt;br /&gt;
&lt;br /&gt;
The SRY gene encodes the SRY protein. The SRY protein is a transcriptional factor inducing the male phenotype in embryo. The SRY gene is located on the [https://en.wikipedia.org/wiki/Y_chromosome Y chromosom] in the short arm (p) 11.3 &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/gene/6736]&amp;lt;/ref&amp;gt;. This gene has only one exon containing the HMG domain (DNA-binding high-mobility group box domain). That&#039;s means that SRY mRNA does not have a alternative splicing, so there is one isoform of SRY protein.&amp;lt;ref&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;. Moreover,the human genome contains one copy of the SRY gene, whereas the mouse genome contains 6 copy of this gene. &amp;lt;ref&amp;gt; Sekido R, Lovell-Badge R. Genetic control of testis development. Sex Dev Genet Mol Biol Evol Endocrinol Embryol Pathol Sex Determ Differ. 2013;7(1-3):21–32 &amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Sequence of the SRY gene===&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:90%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
&amp;gt;gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/nuccore]&amp;lt;/ref&amp;gt;&lt;br /&gt;
TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT TTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACA&amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;ATG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;CAATCATATGCTTCTGCTATGTTAAGCGTATTCAACAGCGATGATTACAGTCCAGCTGTGCAAGAGAATATTCCCGCTCTCCGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTAAGTATCAGTGTGAAACGGGAGAAAACAGTAAAGGCAACGTCCAGGATAGAGTGAAGCGACCCATGAACGCATTCATCGTGTGGTC&#039;&#039;&#039;TCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCAGAGATCAGCAAGCAGCTG&lt;br /&gt;
&#039;&#039;&#039;GGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCATTCTTCCAGGAGGCACAGAAATTACAGG&#039;&#039;&#039;CCATGCACAGAGAGAAATACCCGAATTATAAGTATCGA&#039;&#039;&#039;CCTCGTCGGAAGGCGAAGATGCTGCCGAAGAA&lt;br /&gt;
TTGCAGTTTGCTTCCCGCAGATCCCGCTTCGGTACTCTGCAGCGAAGTGCAACTGGACAACAGGTTGTACAGGGATGACTGTACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAACGCAGCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTG&amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;TAG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;GACAATCGGGTAACATTGGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCACTTTCTTATGTTTAGTTTCAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCATTTCA&amp;lt;/small&amp;gt;&lt;br /&gt;
&lt;br /&gt;
(Legend : &amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Initiation codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt; ; &amp;lt;b&amp;gt;HMG sequence&amp;lt;/b&amp;gt; ; &amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Stop codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;)&lt;br /&gt;
&amp;lt;/div&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Regulation of the expression of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
In humans, the SRY promoter is found at −408 bp to −95 bp upstream of the ATG initiation codon. Moreover, the SRY gene has enhancers at -727 pb upstream of the ATG initiation codon. The linkage between regulatory proteins and this enhancers have the property to increase the production of SRY protein. These regulatory proteins could be: SF1 (steroidogenic factor 1), SP1  and WT 1 (Wilms tumor). &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
*SF1: this transcriptional factor belong to the family of nuclear hormone receptor and contains a zinc finger. The activation of this protein requires a ligand (hormone).&lt;br /&gt;
&lt;br /&gt;
*SP1: this transciprional factor is a ubiquitous protein binding in site containing rich-GC sequences and implicated in the transcription of many genes. Moreover, this protein contains a zinc finger.&lt;br /&gt;
&lt;br /&gt;
*WT1:this transcriptional factor transactives SRY gene, it contains a zinc finger. &amp;lt;ref&amp;gt;Larney C, Bailey TL, Koopman P. Switching on sex: transcriptional regulation of the testis-determining gene Sry. Dev Camb Engl. 2014 Jun;141(11):2195–205. &amp;lt;/ref&amp;gt; &lt;br /&gt;
&lt;br /&gt;
=== Role of the SRY gene ===&lt;br /&gt;
&lt;br /&gt;
The SRY protein is a transcription factor, which contains nuclear localization domains in N terminal and C terminal. An acetylation on these domains allows to export the protein SRY in the nucleus.  &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The SRY protein activates the SOX9 (SRY-box9) gene &amp;lt;ref&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;., this gene is found in the 17 chromosom in the long arm 24.3 &amp;lt;ref&amp;gt; NCBI [http://www.ncbi.nlm.nih.gov/gene/6662] &amp;lt;/ref&amp;gt; and is implicated in the stimulation of the differentiation of sertori cells. The activation of sox 9 are done with protein SRY and another transcriptional factor: SF1 (steroidogenic factor 1). These transcriptional factors are bind in an enhancers called: TESCO (testis-specific enhancer of Sox9 core element). The fixation of transcriptional factor in enhancer provokes a curvature of DNA (90°C) allowing a stabilisation of the elongation complex on the SOX9 promoter. The SOX 9 protein activates the gene AMH (anti-mullerian hormone)&amp;lt;ref&amp;gt;[http://www.ebi.ac.uk/interpro/entry/IPR006799?q=AMH] &amp;lt;/ref&amp;gt; allows the reduction of the channels of Müller in male. &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==Structure==&lt;br /&gt;
&lt;br /&gt;
===The SRY-HMG domain (HMG-Box)===&lt;br /&gt;
&#039;&#039;&#039;SRY-HMG&#039;&#039;&#039; stands for &#039;&#039;&#039;S&#039;&#039;&#039;ex determining &#039;&#039;&#039;R&#039;&#039;&#039;egion &#039;&#039;&#039;Y&#039;&#039;&#039; - &#039;&#039;&#039;H&#039;&#039;&#039;igh &#039;&#039;&#039;M&#039;&#039;&#039;obility &#039;&#039;&#039;G&#039;&#039;&#039;roup domain.&lt;br /&gt;
It is approximately 80 residues long. It mediates the binding of the protein to the minor groove of DNA. It is the most important part of the SRY protein. Not only because it enable  the protein to bind the DNA but because even a little mutation can cause an inactivation of the protein.&lt;br /&gt;
&lt;br /&gt;
It has a Twisted L shape meaning that it has a long (28Å) and a short (22Å) arm. The HMG Box is made of 3 helices, its N-term and C-term are irregular. The overall structure is stabilized by a hydrophobic core especially at the intersection of the 3 helices where 3 aromatics cycles meet, surrounnded by aliphatic aminoacids.&lt;br /&gt;
&lt;br /&gt;
The interaction between the HMG-Box and DNA is specific and stable. It permits the bend of DNA (?75°). It is mostly hydrophobic interaction. Only one molecule of water interface the Box and the DNA. the complex is stabilized by salt bridges between positive charged residues of the HMG domain and negative charged phosphates.&amp;lt;ref&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[Image:HHMG-bitmap.png|thumb|alt=Image bitmap|Linear structure of hHMG domain]]&lt;br /&gt;
&lt;br /&gt;
The binding of SRY to DNA is specific. The DNA target site is a DNA octamer :&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;(5&#039;-dGCACAAAC)&lt;br /&gt;
(5&#039;-dGTTTGTGC)&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
This sequenece is found in the promoters of genes expressed during the testicular development&lt;br /&gt;
The bend of DNA permits the recruitment of different proteins and the build of massives proteins-DNA complexes that could change the expression of different genes. It is the role of a transcription factor.&amp;lt;ref&amp;gt;PMID:11563911&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
Even if the most important function of the HMG box is its capacity of binding and bending DNA, it is also involved in DNA condensation, recombination and DNA repair.&lt;br /&gt;
&lt;br /&gt;
There are 2 kinds of protein that contain a HMG box&lt;br /&gt;
* HMG1 : It is expressed in few cell types. It is found in transcription factors that contain a single HMG box. The bind to a DNA sequence is specific.&lt;br /&gt;
* HMG2 : Are found in all cell types and are abundant in chromatin. This proteins can contain two or more HMG boxes that can nonspecifically bind DNA. &lt;br /&gt;
&lt;br /&gt;
===General structure of SRY===&lt;br /&gt;
The overall structure of SRY is organized aroud the HMG-box.&lt;br /&gt;
3 domains:&lt;br /&gt;
* N-term domain&lt;br /&gt;
* Central domain : DNA binding (HMG box)&lt;br /&gt;
* C-term domain&lt;br /&gt;
&lt;br /&gt;
== Function ==&lt;br /&gt;
&lt;br /&gt;
===Sex determining===&lt;br /&gt;
&lt;br /&gt;
It acts like a sex determinator thanks to it transcriptionnal activity. It inhibits the developpement of female sex structure in th embryonnic individual.&lt;br /&gt;
&lt;br /&gt;
It has been shown that SRY would be involved in the regulation of the renin-angiotensin system in mice. Indeed, sequence mutations of the protein lead to hypertension.&lt;br /&gt;
Because the human&#039;s SRY organisation is very closed to he mouse&#039;s, it has been proposed that SRY would have the same function in human but it has not been studied directly.&lt;br /&gt;
&lt;br /&gt;
== Disease ==&lt;br /&gt;
&lt;br /&gt;
=== Swyer syndrome (AKA XY gonadal dysgenis) :===&lt;br /&gt;
&lt;br /&gt;
	If the TDF protein is not able to bind its targeted DNA sequences, the genes responsible for the testis development are not expressed. The patient owning this defective protein will then develop female characters, even though he has a XY karyotype. This phenomenon is known as the « Swyer Syndrome ». &lt;br /&gt;
Different causes can explain this « XY gonadal dysgenis », as it is also called. About thirty mutations (named [http://www.uniprot.org/uniprot/Q05066#sequences &amp;quot;SRXY1&amp;quot;]) in the SRY gene have been shown to drive this phenotype development. It can also be due to crossovers during a meiosis. If a Y chromosome portion carrying the SRY gene is recombined into a X chromosome, a sperm cell will get this abnormal Y chromosome. If it then fecundates, a XY karyotype without any SRY gene will be formed. &lt;br /&gt;
&lt;br /&gt;
=== De La Chapelle syndrome (AKA XX male syndrome) :===&lt;br /&gt;
&lt;br /&gt;
From the meiosis just described would also result an abnormal X chromosome, carrying the SRY gene. If the sperm cell owning this chromosome fecundates an ovule, the resulting newborn will have a XX karyotype but a male phenotype. This is called the « De La Chapelle syndrome ». In this case, the patient can either develop testis or both testis and ovarian tissues. As some epigenetic mechanisms can inactivate the X chromosome carrying SRY, this syndrome keeps most of the patients sterile.&amp;lt;ref&amp;gt;PMID: 4622299&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
== Relevance ==&lt;br /&gt;
&lt;br /&gt;
== Structural highlights ==&lt;br /&gt;
&lt;br /&gt;
This is a sample scene created with SAT to &amp;lt;scene name=&amp;quot;/12/3456/Sample/1&amp;quot;&amp;gt;color&amp;lt;/scene&amp;gt; by Group, and another to make &amp;lt;scene name=&amp;quot;/12/3456/Sample/2&amp;quot;&amp;gt;a transparent representation&amp;lt;/scene&amp;gt; of the protein. You can make your own scenes on SAT starting from scratch or loading and editing one of these sample scenes.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;/StructureSection&amp;gt;&lt;br /&gt;
== References ==&lt;br /&gt;
[http://ghr.nlm.nih.gov/gene/SRY Genetic Home reference]&lt;br /&gt;
&amp;lt;references/&amp;gt;&lt;/div&gt;</summary>
		<author><name>Fantin Mesny</name></author>
	</entry>
	<entry>
		<id>https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2525370</id>
		<title>Sandbox Reserved 1120</title>
		<link rel="alternate" type="text/html" href="https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2525370"/>
		<updated>2016-01-28T10:28:39Z</updated>

		<summary type="html">&lt;p&gt;Fantin Mesny: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{Sandbox_Reserved_ESBS_2015}}&amp;lt;!-- PLEASE ADD YOUR CONTENT BELOW HERE --&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==SRY protein (AKA TDF protein)==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;StructureSection load=&#039;1hry&#039; size=&#039;340&#039; side=&#039;right&#039; caption=&#039;The SRY protein linked to DNA&#039; scene=&#039;&#039;&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The SRY protein is a 204 residues long monomeric polypeptide. It is a &#039;&#039;&#039;transcriptionnal factor&#039;&#039;&#039;, It activates the &#039;&#039;&#039;M&#039;&#039;&#039;üllerian &#039;&#039;&#039;I&#039;&#039;&#039;nhibiting &#039;&#039;&#039;S&#039;&#039;&#039;ubstance (&#039;&#039;&#039;MIS&#039;&#039;&#039; gene).&lt;br /&gt;
It is encoded by the [[testis-determining sex gene]] and is itself involved in the sex determination in mammels by being responsible for the gonadogenesis thus the male sexual developement. It is the HMG-box that gives to the protein its ability to bind DNA by its minor groove. &amp;lt;ref&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Properties===&lt;br /&gt;
&lt;br /&gt;
&amp;lt;table style=&amp;quot;width:100%&amp;quot;;border: 1px solid #A0A0A0&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Molecular weight&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Gene&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Length&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;DNA target sequence&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Genes targeted&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Inhibitors&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;/table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==History==&lt;br /&gt;
&lt;br /&gt;
After centuries of unfounded theories mainly based on environmental factors, the first molecular theory concerning the sex determination appeared in 1891. At this time, the german biologist Hermann Henking was studying sperm formation in wasps. As a chromosome which was not present in all the wasps looked different from the others, he suspected it to play a role in sex determination and called it the &amp;quot;X chromosome&amp;quot;.&lt;br /&gt;
Ten years later, Clarence Erwin McClung saw that this chromosome behaved differently during the meiosis and was only present in half the sperm cells of grasshoppers. As the main characteristic that varies in 50/50 proportions among zygotes is the sex, McClung suspected the X chromosome to be implicated in sexual development. &lt;br /&gt;
In 1905, Nettie Stevens discovered the &amp;quot;Y chromosome&amp;quot; (and the female XX and male XY patterns) while she was counting the chromosomes of beetles under the microscope&amp;lt;ref&amp;gt;Sumner, A. T. Sex Chromosomes and Sex Determination. Chromosomes: Organization and Function, 97-108. [http://www.nature.com/scitable/nated/topicpage/Sex-Chromosomes-and-Sex-Determination-44565]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
During the next decades, a few theories were in competition. In 1921, Calvin Bridges&#039;s works on &#039;&#039;Drosophila melanogaster&#039;&#039; seemed to reveal that male characters acquisition is due to a genic balance between the genes contained in the X chromosome and those contained in the autosomes&amp;lt;ref&amp;gt;PMID: 17769897&amp;lt;/ref&amp;gt;.&lt;br /&gt;
In 1930, Ronald Fisher introduced the first Y-based control of sex theory by proposing two different models : either all the genes responsible for the male characters are located on the Y chromosome or there is a Y-located gene which regulates the expression of genes elsewhere in the genome&amp;lt;ref&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt;.&lt;br /&gt;
As Alfred Jost had shown the testosterone produced by the testis is responsible for the entire male phenotype acquisition&amp;lt;ref&amp;gt;PMID: 4805859&amp;lt;/ref&amp;gt;, in 1988, Peter Neville Goodfellow proposed that there is a gene (&#039;&#039;TDF&#039;&#039; in human, &#039;&#039;Tdy&#039;&#039; in mice)  on the Y chromosome which drives the development of the testis.&amp;lt;ref&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt; In 1990, Goodfellow&#039;s hypothesis was validated with the discovery of &#039;&#039;Tdy&#039;&#039;&#039;s localisation. This gene&#039;s product (expressed during the male gonadal development) owns an amino-acid motif showing homology to other known or putative DNA-binding domains. &#039;&#039;Tdy&#039;&#039; is therefore a transcriptional factor&amp;lt;ref&amp;gt;PMID: 2374589&amp;lt;/ref&amp;gt;. The same year, the human &#039;&#039;SRY&#039;&#039; gene (accepted later as the &#039;&#039;TDF&#039;&#039;) was discovered&amp;lt;ref&amp;gt;PMID: 1695712&amp;lt;/ref&amp;gt;. &lt;br /&gt;
Three dimensional structure of the SRY protein was determined in 1995 using NMR spectroscopy&amp;lt;ref&amp;gt;PMID: 7774012&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==SRY gene==&lt;br /&gt;
&lt;br /&gt;
===Generality===&lt;br /&gt;
&lt;br /&gt;
The SRY gene encodes the SRY protein. The SRY protein is a transcriptional factor inducing the male phenotype in embryo. The SRY gene is located on the [https://en.wikipedia.org/wiki/Y_chromosome Y chromosom] in the short arm (p) 11.3 &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/gene/6736]&amp;lt;/ref&amp;gt;. This gene has only one exon containing the HMG domain (DNA-binding high-mobility group box domain). That&#039;s means that SRY mRNA does not have a alternative splicing, so there is one isoform of SRY protein.&amp;lt;ref&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;. Moreover,the human genome contains one copy of the SRY gene, whereas the mouse genome contains 6 copy of this gene. &amp;lt;ref&amp;gt; Sekido R, Lovell-Badge R. Genetic control of testis development. Sex Dev Genet Mol Biol Evol Endocrinol Embryol Pathol Sex Determ Differ. 2013;7(1-3):21–32 &amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Sequence of the SRY gene===&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:90%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
&amp;gt;gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/nuccore]&amp;lt;/ref&amp;gt;&lt;br /&gt;
TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT TTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACA&lt;br /&gt;
&amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;ATG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;CAATCATATGCTTCTGCTATGTTAAGCGTATTCAACAGCGATGATTACAGTCCAGCTGTGCAAGAGAAT&lt;br /&gt;
ATTCCCGCTCTCCGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTAAGTATCAGTGTGAAA&lt;br /&gt;
CGGGAGAAAACAGTAAAGGCAACGTCCAGGATAGAGTGAAGCGACCCATGAACGCATTCATCGTGTGGTC&lt;br /&gt;
&#039;&#039;&#039;TCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCAGAGATCAGCAAGCAGCTG&lt;br /&gt;
&#039;&#039;&#039;GGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCATTCTTCCAGGAGGCACAGAAATTACAGG&lt;br /&gt;
&#039;&#039;&#039;CCATGCACAGAGAGAAATACCCGAATTATAAGTATCGA&#039;&#039;&#039;CCTCGTCGGAAGGCGAAGATGCTGCCGAAGAA&lt;br /&gt;
TTGCAGTTTGCTTCCCGCAGATCCCGCTTCGGTACTCTGCAGCGAAGTGCAACTGGACAACAGGTTGTAC&lt;br /&gt;
AGGGATGACTGTACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAACG&lt;br /&gt;
CAGCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTG&amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;TAG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;GACAATCGGGTAACATT&lt;br /&gt;
GGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCACTTTCTTATGTTTAGTTT&lt;br /&gt;
CAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCATTTCA&amp;lt;/small&amp;gt;&lt;br /&gt;
&lt;br /&gt;
(Legend : &amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Initiation codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt; ; &amp;lt;b&amp;gt;HMG sequence&amp;lt;/b&amp;gt; ; &amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Stop codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;)&lt;br /&gt;
&amp;lt;/div&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Regulation of the expression of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
In humans, the SRY promoter is found at −408 bp to −95 bp upstream of the ATG initiation codon. Moreover, the SRY gene has enhancers at -727 pb upstream of the ATG initiation codon. The linkage between regulatory proteins and this enhancers have the property to increase the production of SRY protein. These regulatory proteins could be: SF1 (steroidogenic factor 1), SP1  and WT 1 (Wilms tumor). &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
*SF1: this transcriptional factor belong to the family of nuclear hormone receptor and contains a zinc finger. The activation of this protein requires a ligand (hormone).&lt;br /&gt;
&lt;br /&gt;
*SP1: this transciprional factor is a ubiquitous protein binding in site containing rich-GC sequences and implicated in the transcription of many genes. Moreover, this protein contains a zinc finger.&lt;br /&gt;
&lt;br /&gt;
*WT1:this transcriptional factor transactives SRY gene, it contains a zinc finger. &amp;lt;ref&amp;gt;Larney C, Bailey TL, Koopman P. Switching on sex: transcriptional regulation of the testis-determining gene Sry. Dev Camb Engl. 2014 Jun;141(11):2195–205. &amp;lt;/ref&amp;gt; &lt;br /&gt;
&lt;br /&gt;
=== Role of the SRY gene ===&lt;br /&gt;
&lt;br /&gt;
The SRY protein is a transcription factor, which contains nuclear localization domains in N terminal and C terminal. An acetylation on these domains allows to export the protein SRY in the nucleus.  &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The SRY protein activates the SOX9 (SRY-box9) gene &amp;lt;ref&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;., this gene is found in the 17 chromosom in the long arm 24.3 &amp;lt;ref&amp;gt; NCBI [http://www.ncbi.nlm.nih.gov/gene/6662] &amp;lt;/ref&amp;gt; and is implicated in the stimulation of the differentiation of sertori cells. The activation of sox 9 are done with protein SRY and another transcriptional factor: SF1 (steroidogenic factor 1). These transcriptional factors are bind in an enhancers called: TESCO (testis-specific enhancer of Sox9 core element). The fixation of transcriptional factor in enhancer provokes a curvature of DNA (90°C) allowing a stabilisation of the elongation complex on the SOX9 promoter. The SOX 9 protein activates the gene AMH (anti-mullerian hormone)&amp;lt;ref&amp;gt;[http://www.ebi.ac.uk/interpro/entry/IPR006799?q=AMH] &amp;lt;/ref&amp;gt; allows the reduction of the channels of Müller in male. &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==Structure==&lt;br /&gt;
&lt;br /&gt;
===The SRY-HMG domain (HMG-Box)===&lt;br /&gt;
&#039;&#039;&#039;SRY-HMG&#039;&#039;&#039; stands for &#039;&#039;&#039;S&#039;&#039;&#039;ex determining &#039;&#039;&#039;R&#039;&#039;&#039;egion &#039;&#039;&#039;Y&#039;&#039;&#039; - &#039;&#039;&#039;H&#039;&#039;&#039;igh &#039;&#039;&#039;M&#039;&#039;&#039;obility &#039;&#039;&#039;G&#039;&#039;&#039;roup domain.&lt;br /&gt;
It is approximately 80 residues long. It mediates the binding of the protein to the minor groove of DNA. It is the most important part of the SRY protein. Not only because it enable  the protein to bind the DNA but because even a little mutation can cause an inactivation of the protein.&lt;br /&gt;
&lt;br /&gt;
It has a Twisted L shape meaning that it has a long (28Å) and a short (22Å) arm. The HMG Box is made of 3 helices, its N-term and C-term are irregular. The overall structure is stabilized by a hydrophobic core especially at the intersection of the 3 helices where 3 aromatics cycles meet, surrounnded by aliphatic aminoacids.&lt;br /&gt;
&lt;br /&gt;
The interaction between the HMG-Box and DNA is specific and stable. It permits the bend of DNA (?75°). It is mostly hydrophobic interaction. Only one molecule of water interface the Box and the DNA. the complex is stabilized by salt bridges between positive charged residues of the HMG domain and negative charged phosphates.&amp;lt;ref&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[Image:HHMG-bitmap.png|thumb|alt=Image bitmap|Linear structure of hHMG domain]]&lt;br /&gt;
&lt;br /&gt;
The binding of SRY to DNA is specific. The DNA target site is a DNA octamer :&lt;br /&gt;
&lt;br /&gt;
&amp;lt;center&amp;gt;(5&#039;-dGCACAAAC)&lt;br /&gt;
(5&#039;-dGTTTGTGC)&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
This sequenece is found in the promoters of genes expressed during the testicular development&lt;br /&gt;
The bend of DNA permits the recruitment of different proteins and the build of massives proteins-DNA complexes that could change the expression of different genes. It is the role of a transcription factor.&amp;lt;ref&amp;gt;PMID:11563911&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
Even if the most important function of the HMG box is its capacity of binding and bending DNA, it is also involved in DNA condensation, recombination and DNA repair.&lt;br /&gt;
&lt;br /&gt;
There are 2 kinds of protein that contain a HMG box&lt;br /&gt;
* HMG1 : It is expressed in few cell types. It is found in transcription factors that contain a single HMG box. The bind to a DNA sequence is specific.&lt;br /&gt;
* HMG2 : Are found in all cell types and are abundant in chromatin. This proteins can contain two or more HMG boxes that can nonspecifically bind DNA. &lt;br /&gt;
&lt;br /&gt;
===General structure of SRY===&lt;br /&gt;
The overall structure of SRY is organized aroud the HMG-box.&lt;br /&gt;
3 domains:&lt;br /&gt;
* N-term domain&lt;br /&gt;
* Central domain : DNA binding (HMG box)&lt;br /&gt;
* C-term domain&lt;br /&gt;
&lt;br /&gt;
== Function ==&lt;br /&gt;
&lt;br /&gt;
===Sex determining===&lt;br /&gt;
&lt;br /&gt;
It acts like a sex determinator thanks to it transcriptionnal activity. It inhibits the developpement of female sex structure in th embryonnic individual.&lt;br /&gt;
&lt;br /&gt;
It has been shown that SRY would be involved in the regulation of the renin-angiotensin system in mice. Indeed, sequence mutations of the protein lead to hypertension.&lt;br /&gt;
Because the human&#039;s SRY organisation is very closed to he mouse&#039;s, it has been proposed that SRY would have the same function in human but it has not been studied directly.&lt;br /&gt;
&lt;br /&gt;
== Disease ==&lt;br /&gt;
&lt;br /&gt;
=== Swyer syndrome (AKA XY gonadal dysgenis) :===&lt;br /&gt;
&lt;br /&gt;
	If the TDF protein is not able to bind its targeted DNA sequences, the genes responsible for the testis development are not expressed. The patient owning this defective protein will then develop female characters, even though he has a XY karyotype. This phenomenon is known as the « Swyer Syndrome ». &lt;br /&gt;
Different causes can explain this « XY gonadal dysgenis », as it is also called. About thirty mutations (named [http://www.uniprot.org/uniprot/Q05066#sequences &amp;quot;SRXY1&amp;quot;]) in the SRY gene have been shown to drive this phenotype development. It can also be due to crossovers during a meiosis. If a Y chromosome portion carrying the SRY gene is recombined into a X chromosome, a sperm cell will get this abnormal Y chromosome. If it then fecundates, a XY karyotype without any SRY gene will be formed. &lt;br /&gt;
&lt;br /&gt;
=== De La Chapelle syndrome (AKA XX male syndrome) :===&lt;br /&gt;
&lt;br /&gt;
From the meiosis just described would also result an abnormal X chromosome, carrying the SRY gene. If the sperm cell owning this chromosome fecundates an ovule, the resulting newborn will have a XX karyotype but a male phenotype. This is called the « De La Chapelle syndrome ». In this case, the patient can either develop testis or both testis and ovarian tissues. As some epigenetic mechanisms can inactivate the X chromosome carrying SRY, this syndrome keeps most of the patients sterile.&amp;lt;ref&amp;gt;PMID: 4622299&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
== Relevance ==&lt;br /&gt;
&lt;br /&gt;
== Structural highlights ==&lt;br /&gt;
&lt;br /&gt;
This is a sample scene created with SAT to &amp;lt;scene name=&amp;quot;/12/3456/Sample/1&amp;quot;&amp;gt;color&amp;lt;/scene&amp;gt; by Group, and another to make &amp;lt;scene name=&amp;quot;/12/3456/Sample/2&amp;quot;&amp;gt;a transparent representation&amp;lt;/scene&amp;gt; of the protein. You can make your own scenes on SAT starting from scratch or loading and editing one of these sample scenes.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;/StructureSection&amp;gt;&lt;br /&gt;
== References ==&lt;br /&gt;
[http://ghr.nlm.nih.gov/gene/SRY Genetic Home reference]&lt;br /&gt;
&amp;lt;references/&amp;gt;&lt;/div&gt;</summary>
		<author><name>Fantin Mesny</name></author>
	</entry>
	<entry>
		<id>https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2525359</id>
		<title>Sandbox Reserved 1120</title>
		<link rel="alternate" type="text/html" href="https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2525359"/>
		<updated>2016-01-28T10:13:14Z</updated>

		<summary type="html">&lt;p&gt;Fantin Mesny: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{Sandbox_Reserved_ESBS_2015}}&amp;lt;!-- PLEASE ADD YOUR CONTENT BELOW HERE --&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==SRY protein (AKA TDF protein)==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;StructureSection load=&#039;1hry&#039; size=&#039;340&#039; side=&#039;right&#039; caption=&#039;The SRY protein linked to DNA&#039; scene=&#039;&#039;&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The SRY protein is a 204 residues long monomeric polypeptide. It is a &#039;&#039;&#039;transcriptionnal factor&#039;&#039;&#039;, It activates the &#039;&#039;&#039;M&#039;&#039;&#039;üllerian &#039;&#039;&#039;I&#039;&#039;&#039;nhibiting &#039;&#039;&#039;S&#039;&#039;&#039;ubstance (&#039;&#039;&#039;MIS&#039;&#039;&#039; gene).&lt;br /&gt;
It is encoded by the [[testis-determining sex gene]] and is itself involved in the sex determination in mammels by being responsible for the gonadogenesis thus the male sexual developement. It is the HMG-box that gives to the protein its ability to bind DNA by its minor groove. &amp;lt;ref&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Properties===&lt;br /&gt;
&lt;br /&gt;
&amp;lt;table style=&amp;quot;width:100%&amp;quot;;border: 3px solid #A0A0A0&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Molecular weight&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Gene&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Length&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;DNA target sequence&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Genes targeted&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Inhibitors&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;/table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==History==&lt;br /&gt;
&lt;br /&gt;
After centuries of unfounded theories mainly based on environmental factors, the first molecular theory concerning the sex determination appeared in 1891. At this time, the german biologist Hermann Henking was studying sperm formation in wasps. As a chromosome which was not present in all the wasps looked different from the others, he suspected it to play a role in sex determination and called it the &amp;quot;X chromosome&amp;quot;.&lt;br /&gt;
Ten years later, Clarence Erwin McClung saw that this chromosome behaved differently during the meiosis and was only present in half the sperm cells of grasshoppers. As the main characteristic that varies in 50/50 proportions among zygotes is the sex, McClung suspected the X chromosome to be implicated in sexual development. &lt;br /&gt;
In 1905, Nettie Stevens discovered the &amp;quot;Y chromosome&amp;quot; (and the female XX and male XY patterns) while she was counting the chromosomes of beetles under the microscope&amp;lt;ref&amp;gt;Sumner, A. T. Sex Chromosomes and Sex Determination. Chromosomes: Organization and Function, 97-108. [http://www.nature.com/scitable/nated/topicpage/Sex-Chromosomes-and-Sex-Determination-44565]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
During the next decades, a few theories were in competition. In 1921, Calvin Bridges&#039;s works on &#039;&#039;Drosophila melanogaster&#039;&#039; seemed to reveal that male characters acquisition is due to a genic balance between the genes contained in the X chromosome and those contained in the autosomes&amp;lt;ref&amp;gt;PMID: 17769897&amp;lt;/ref&amp;gt;.&lt;br /&gt;
In 1930, Ronald Fisher introduced the first Y-based control of sex theory by proposing two different models : either all the genes responsible for the male characters are located on the Y chromosome or there is a Y-located gene which regulates the expression of genes elsewhere in the genome&amp;lt;ref&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt;.&lt;br /&gt;
As Alfred Jost had shown the testosterone produced by the testis is responsible for the entire male phenotype acquisition&amp;lt;ref&amp;gt;PMID: 4805859&amp;lt;/ref&amp;gt;, in 1988, Peter Neville Goodfellow proposed that there is a gene (&#039;&#039;TDF&#039;&#039; in human, &#039;&#039;Tdy&#039;&#039; in mice)  on the Y chromosome which drives the development of the testis.&amp;lt;ref&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt; In 1990, Goodfellow&#039;s hypothesis was validated with the discovery of &#039;&#039;Tdy&#039;&#039;&#039;s localisation. This gene&#039;s product (expressed during the male gonadal development) owns an amino-acid motif showing homology to other known or putative DNA-binding domains. &#039;&#039;Tdy&#039;&#039; is therefore a transcriptional factor&amp;lt;ref&amp;gt;PMID: 2374589&amp;lt;/ref&amp;gt;. The same year, the human &#039;&#039;SRY&#039;&#039; gene (accepted later as the &#039;&#039;TDF&#039;&#039;) was discovered&amp;lt;ref&amp;gt;PMID: 1695712&amp;lt;/ref&amp;gt;. &lt;br /&gt;
Three dimensional structure of the SRY protein was determined in 1995 using NMR spectroscopy&amp;lt;ref&amp;gt;PMID: 7774012&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==SRY gene==&lt;br /&gt;
&lt;br /&gt;
===Generality===&lt;br /&gt;
&lt;br /&gt;
The SRY gene encodes the SRY protein. The SRY protein is a transcriptional factor inducing the male phenotype in embryo. The SRY gene is located on the [https://en.wikipedia.org/wiki/Y_chromosome Y chromosom] in the short arm (p) 11.3 &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/gene/6736]&amp;lt;/ref&amp;gt;. This gene has only one exon containing the HMG domain (DNA-binding high-mobility group box domain). That&#039;s means that SRY mRNA does not have a alternative splicing, so there is one isoform of SRY protein.&amp;lt;ref&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;. Moreover,the human genome contains one copy of the SRY gene, whereas the mouse genome contains 6 copy of this gene. &amp;lt;ref&amp;gt; Sekido R, Lovell-Badge R. Genetic control of testis development. Sex Dev Genet Mol Biol Evol Endocrinol Embryol Pathol Sex Determ Differ. 2013;7(1-3):21–32 &amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Sequence of the SRY gene===&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:90%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
&amp;gt;gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/nuccore]&amp;lt;/ref&amp;gt;&lt;br /&gt;
TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT&lt;br /&gt;
TTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACA&lt;br /&gt;
&amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;ATG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;CAATCATATGCTTCTGCTATGTTAAGCGTATTCAACAGCGATGATTACAGTCCAGCTGTGCAAGAGAAT&lt;br /&gt;
ATTCCCGCTCTCCGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTAAGTATCAGTGTGAAA&lt;br /&gt;
CGGGAGAAAACAGTAAAGGCAACGTCCAGGATAGAGTGAAGCGACCCATGAACGCATTCATCGTGTGGTC&lt;br /&gt;
&#039;&#039;&#039;TCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCAGAGATCAGCAAGCAGCTG&lt;br /&gt;
&#039;&#039;&#039;GGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCATTCTTCCAGGAGGCACAGAAATTACAGG&lt;br /&gt;
&#039;&#039;&#039;CCATGCACAGAGAGAAATACCCGAATTATAAGTATCGA&#039;&#039;&#039;CCTCGTCGGAAGGCGAAGATGCTGCCGAAGAA&lt;br /&gt;
TTGCAGTTTGCTTCCCGCAGATCCCGCTTCGGTACTCTGCAGCGAAGTGCAACTGGACAACAGGTTGTAC&lt;br /&gt;
AGGGATGACTGTACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAACG&lt;br /&gt;
CAGCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTG&amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;TAG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;GACAATCGGGTAACATT&lt;br /&gt;
GGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCACTTTCTTATGTTTAGTTT&lt;br /&gt;
CAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCATTTCA&amp;lt;/small&amp;gt;&lt;br /&gt;
&lt;br /&gt;
(Legend : &amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Initiation codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt; ; &amp;lt;b&amp;gt;HMG sequence&amp;lt;/b&amp;gt; ; &amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Stop codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;)&lt;br /&gt;
&amp;lt;/div&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Regulation of the expression of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
In humans, the SRY promoter is found at −408 bp to −95 bp upstream of the ATG initiation codon. Moreover, the SRY gene has enhancers at -727 pb upstream of the ATG initiation codon. The linkage between regulatory proteins and this enhancers have the property to increase the production of SRY protein. These regulatory proteins could be: SF1 (steroidogenic factor 1), SP1  and WT 1 (Wilms tumor). &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
*SF1: this transcriptional factor belong to the family of nuclear hormone receptor and contains a zinc finger. The activation of this protein requires a ligand (hormone).&lt;br /&gt;
&lt;br /&gt;
*SP1: this transciprional factor is a ubiquitous protein binding in site containing rich-GC sequences and implicated in the transcription of many genes. Moreover, this protein contains a zinc finger.&lt;br /&gt;
&lt;br /&gt;
*WT1:this transcriptional factor transactives SRY gene, it contains a zinc finger. &amp;lt;ref&amp;gt;Larney C, Bailey TL, Koopman P. Switching on sex: transcriptional regulation of the testis-determining gene Sry. Dev Camb Engl. 2014 Jun;141(11):2195–205. &amp;lt;/ref&amp;gt; &lt;br /&gt;
&lt;br /&gt;
=== Role of the SRY gene ===&lt;br /&gt;
&lt;br /&gt;
The SRY protein is a transcription factor, which contains nuclear localization domains in N terminal and C terminal. An acetylation on these domains allows to export the protein SRY in the nucleus.  &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The SRY protein activates the SOX9 (SRY-box9) gene &amp;lt;ref&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;., this gene is found in the 17 chromosom in the long arm 24.3 &amp;lt;ref&amp;gt; NCBI [http://www.ncbi.nlm.nih.gov/gene/6662] &amp;lt;/ref&amp;gt; and is implicated in the stimulation of the differentiation of sertori cells. The activation of sox 9 are done with protein SRY and another transcriptional factor: SF1 (steroidogenic factor 1). These transcriptional factors are bind in an enhancers called: TESCO (testis-specific enhancer of Sox9 core element). The fixation of transcriptional factor in enhancer provokes a curvature of DNA (90°C) allowing a stabilisation of the elongation complex on the SOX9 promoter. The SOX 9 protein activates the gene AMH (anti-mullerian hormone)&amp;lt;ref&amp;gt;[http://www.ebi.ac.uk/interpro/entry/IPR006799?q=AMH] &amp;lt;/ref&amp;gt; allows the reduction of the channels of Müller in male. &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==Structure==&lt;br /&gt;
&lt;br /&gt;
===The SRY-HMG domain (HMG-Box)===&lt;br /&gt;
&#039;&#039;&#039;SRY-HMG&#039;&#039;&#039; stands for &#039;&#039;&#039;S&#039;&#039;&#039;ex determining &#039;&#039;&#039;R&#039;&#039;&#039;egion &#039;&#039;&#039;Y&#039;&#039;&#039; - &#039;&#039;&#039;H&#039;&#039;&#039;igh &#039;&#039;&#039;M&#039;&#039;&#039;obility &#039;&#039;&#039;G&#039;&#039;&#039;roup domain.&lt;br /&gt;
It is approximately 80 residues long. It mediates the binding of the protein to the minor groove of DNA. It is the most important part of the SRY protein. Not only because it enable  the protein to bind the DNA but because even a little mutation can cause an inactivation of the protein.&lt;br /&gt;
&lt;br /&gt;
It has a Twisted L shape meaning that it has a long (28Å) and a short (22Å) arm. The HMG Box is made of 3 helices, its N-term and C-term are irregular. The overall structure is stabilized by a hydrophobic core especially at the intersection of the 3 helices where 3 aromatics cycles meet, surrounnded by aliphatic aminoacids.&lt;br /&gt;
&lt;br /&gt;
The interaction between the HMG-Box and DNA is specific and stable. It permits the bend of DNA (?75°). It is mostly hydrophobic interaction. Only one molecule of water interface the Box and the DNA. the complex is stabilized by salt bridges between positive charged residues of the HMG domain and negative charged phosphates.&amp;lt;ref&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[Image:HHMG-bitmap.png|thumb|alt=Image bitmap|Linear structure of hHMG domain]]&lt;br /&gt;
&lt;br /&gt;
The binding of SRY to DNA is specific. The DNA target site is a DNA octamer :&lt;br /&gt;
&lt;br /&gt;
(5&#039;-dGCACAAAC)&lt;br /&gt;
(5&#039;-dGTTTGTGC)&lt;br /&gt;
&lt;br /&gt;
This sequenece is found in the promoters of genes expressed during the testicular development&lt;br /&gt;
The bend of DNA permits the recruitment of different proteins and the build of massives proteins-DNA complexes that could change the expression of different genes. It is the role of a transcription factor.&amp;lt;ref&amp;gt;PMID:11563911&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
Even if the most important function of the HMG box is its capacity of binding and bending DNA, it is also involved in DNA condensation, recombination and DNA repair.&lt;br /&gt;
&lt;br /&gt;
There are 2 kinds of protein that contain a HMG box&lt;br /&gt;
* HMG1 : It is expressed in few cell types. It is found in transcription factors that contain a single HMG box. The bind to a DNA sequence is specific.&lt;br /&gt;
* HMG2 : Are found in all cell types and are abundant in chromatin. This proteins can contain two or more HMG boxes that can nonspecifically bind DNA. &lt;br /&gt;
&lt;br /&gt;
===General structure of SRY===&lt;br /&gt;
The overall structure of SRY is organized aroud the HMG-box.&lt;br /&gt;
3 domains:&lt;br /&gt;
* N-term domain&lt;br /&gt;
* Central domain : DNA binding (HMG box)&lt;br /&gt;
* C-term domain&lt;br /&gt;
&lt;br /&gt;
== Function ==&lt;br /&gt;
&lt;br /&gt;
===Sex determining===&lt;br /&gt;
It acts like a sex determinator thanks to it transcriptionnal activity. It inhibits the developpement of female sex structure in th embryonnic individual.&lt;br /&gt;
&lt;br /&gt;
==Implication - Future for SRY ?==&lt;br /&gt;
&lt;br /&gt;
== Disease ==&lt;br /&gt;
&lt;br /&gt;
=== Swyer syndrome (AKA XY gonadal dysgenis) :===&lt;br /&gt;
&lt;br /&gt;
	If the TDF protein is not able to bind its targeted DNA sequences, the genes responsible for the testis development are not expressed. The patient owning this defective protein will then develop female characters, even though he has a XY karyotype. This phenomenon is known as the « Swyer Syndrome ». &lt;br /&gt;
Different causes can explain this « XY gonadal dysgenis », as it is also called. About thirty mutations (named [http://www.uniprot.org/uniprot/Q05066#sequences &amp;quot;SRXY1&amp;quot;]) in the SRY gene have been shown to drive this phenotype development. It can also be due to crossovers during a meiosis. If a Y chromosome portion carrying the SRY gene is recombined into a X chromosome, a sperm cell will get this abnormal Y chromosome. If it then fecundates, a XY karyotype without any SRY gene will be formed. &lt;br /&gt;
&lt;br /&gt;
=== De La Chapelle syndrome (AKA XX male syndrome) :===&lt;br /&gt;
&lt;br /&gt;
From the meiosis just described would also result an abnormal X chromosome, carrying the SRY gene. If the sperm cell owning this chromosome fecundates an ovule, the resulting newborn will have a XX karyotype but a male phenotype. This is called the « De La Chapelle syndrome ». In this case, the patient can either develop testis or both testis and ovarian tissues. As some epigenetic mechanisms can inactivate the X chromosome carrying SRY, this syndrome keeps most of the patients sterile.&amp;lt;ref&amp;gt;PMID: 4622299&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
== Relevance ==&lt;br /&gt;
&lt;br /&gt;
== Structural highlights ==&lt;br /&gt;
&lt;br /&gt;
This is a sample scene created with SAT to &amp;lt;scene name=&amp;quot;/12/3456/Sample/1&amp;quot;&amp;gt;color&amp;lt;/scene&amp;gt; by Group, and another to make &amp;lt;scene name=&amp;quot;/12/3456/Sample/2&amp;quot;&amp;gt;a transparent representation&amp;lt;/scene&amp;gt; of the protein. You can make your own scenes on SAT starting from scratch or loading and editing one of these sample scenes.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;/StructureSection&amp;gt;&lt;br /&gt;
== References ==&lt;br /&gt;
[http://ghr.nlm.nih.gov/gene/SRY Genetic Home reference]&lt;br /&gt;
&amp;lt;references/&amp;gt;&lt;/div&gt;</summary>
		<author><name>Fantin Mesny</name></author>
	</entry>
	<entry>
		<id>https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2525358</id>
		<title>Sandbox Reserved 1120</title>
		<link rel="alternate" type="text/html" href="https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2525358"/>
		<updated>2016-01-28T10:12:10Z</updated>

		<summary type="html">&lt;p&gt;Fantin Mesny: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{Sandbox_Reserved_ESBS_2015}}&amp;lt;!-- PLEASE ADD YOUR CONTENT BELOW HERE --&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==SRY protein (AKA TDF protein)==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;StructureSection load=&#039;1hry&#039; size=&#039;340&#039; side=&#039;right&#039; caption=&#039;The SRY protein linked to DNA&#039; scene=&#039;&#039;&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The SRY protein is a 204 residues long monomeric polypeptide. It is a &#039;&#039;&#039;transcriptionnal factor&#039;&#039;&#039;, It activates the &#039;&#039;&#039;M&#039;&#039;&#039;üllerian &#039;&#039;&#039;I&#039;&#039;&#039;nhibiting &#039;&#039;&#039;S&#039;&#039;&#039;ubstance (&#039;&#039;&#039;MIS&#039;&#039;&#039; gene).&lt;br /&gt;
It is encoded by the [[testis-determining sex gene]] and is itself involved in the sex determination in mammels by being responsible for the gonadogenesis thus the male sexual developement. It is the HMG-box that gives to the protein its ability to bind DNA by its minor groove. &amp;lt;ref&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Properties===&lt;br /&gt;
&lt;br /&gt;
&amp;lt;table style=&amp;quot;width:100%&amp;quot;;border: 3px solid #A0A0A0&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Molecular weight&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Gene&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Length&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;DNA target sequence&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Genes targeted&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Inhibitors&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;/table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==History==&lt;br /&gt;
&lt;br /&gt;
After centuries of unfounded theories mainly based on environmental factors, the first molecular theory concerning the sex determination appeared in 1891. At this time, the german biologist Hermann Henking was studying sperm formation in wasps. As a chromosome which was not present in all the wasps looked different from the others, he suspected it to play a role in sex determination and called it the &amp;quot;X chromosome&amp;quot;.&lt;br /&gt;
Ten years later, Clarence Erwin McClung saw that this chromosome behaved differently during the meiosis and was only present in half the sperm cells of grasshoppers. As the main characteristic that varies in 50/50 proportions among zygotes is the sex, McClung suspected the X chromosome to be implicated in sexual development. &lt;br /&gt;
In 1905, Nettie Stevens discovered the &amp;quot;Y chromosome&amp;quot; (and the female XX and male XY patterns) while she was counting the chromosomes of beetles under the microscope&amp;lt;ref&amp;gt;Sumner, A. T. Sex Chromosomes and Sex Determination. Chromosomes: Organization and Function, 97-108. [http://www.nature.com/scitable/nated/topicpage/Sex-Chromosomes-and-Sex-Determination-44565]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
During the next decades, a few theories were in competition. In 1921, Calvin Bridges&#039;s works on &#039;&#039;Drosophila melanogaster&#039;&#039; seemed to reveal that male characters acquisition is due to a genic balance between the genes contained in the X chromosome and those contained in the autosomes&amp;lt;ref&amp;gt;PMID: 17769897&amp;lt;/ref&amp;gt;.&lt;br /&gt;
In 1930, Ronald Fisher introduced the first Y-based control of sex theory by proposing two different models : either all the genes responsible for the male characters are located on the Y chromosome or there is a Y-located gene which regulates the expression of genes elsewhere in the genome&amp;lt;ref&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt;.&lt;br /&gt;
As Alfred Jost had shown the testosterone produced by the testis is responsible for the entire male phenotype acquisition&amp;lt;ref&amp;gt;PMID: 4805859&amp;lt;/ref&amp;gt;, in 1988, Peter Neville Goodfellow proposed that there is a gene (&#039;&#039;TDF&#039;&#039; in human, &#039;&#039;Tdy&#039;&#039; in mice)  on the Y chromosome which drives the development of the testis.&amp;lt;ref&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt; In 1990, Goodfellow&#039;s hypothesis was validated with the discovery of &#039;&#039;Tdy&#039;&#039;&#039;s localisation. This gene&#039;s product (expressed during the male gonadal development) owns an amino-acid motif showing homology to other known or putative DNA-binding domains. &#039;&#039;Tdy&#039;&#039; is therefore a transcriptional factor&amp;lt;ref&amp;gt;PMID: 2374589&amp;lt;/ref&amp;gt;. The same year, the human &#039;&#039;SRY&#039;&#039; gene (accepted later as the &#039;&#039;TDF&#039;&#039;) was discovered&amp;lt;ref&amp;gt;PMID: 1695712&amp;lt;/ref&amp;gt;. &lt;br /&gt;
Three dimensional structure of the SRY protein was determined in 1995 using NMR spectroscopy&amp;lt;ref&amp;gt;PMID: 7774012&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==SRY gene==&lt;br /&gt;
&lt;br /&gt;
===Generality===&lt;br /&gt;
&lt;br /&gt;
The SRY gene encodes the SRY protein. The SRY protein is a transcriptional factor inducing the male phenotype in embryo. The SRY gene is located on the [https://en.wikipedia.org/wiki/Y_chromosome Y chromosom] in the short arm (p) 11.3 &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/gene/6736]&amp;lt;/ref&amp;gt;. This gene has only one exon containing the HMG domain (DNA-binding high-mobility group box domain). That&#039;s means that SRY mRNA does not have a alternative splicing, so there is one isoform of SRY protein.&amp;lt;ref&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;. Moreover,the human genome contains one copy of the SRY gene, whereas the mouse genome contains 6 copy of this gene. &amp;lt;ref&amp;gt; Sekido R, Lovell-Badge R. Genetic control of testis development. Sex Dev Genet Mol Biol Evol Endocrinol Embryol Pathol Sex Determ Differ. 2013;7(1-3):21–32 &amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Sequence of the SRY gene===&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:90%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
&amp;gt;gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/nuccore]&amp;lt;/ref&amp;gt;&lt;br /&gt;
TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT&lt;br /&gt;
TTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACA&lt;br /&gt;
&amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;ATG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;CAATCATATGCTTCTGCTATGTTAAGCGTATTCAACAGCGATGATTACAGTCCAGCTGTGCAAGAGAAT&lt;br /&gt;
ATTCCCGCTCTCCGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTAAGTATCAGTGTGAAA&lt;br /&gt;
CGGGAGAAAACAGTAAAGGCAACGTCCAGGATAGAGTGAAGCGACCCATGAACGCATTCATCGTGTGGTC&lt;br /&gt;
&#039;&#039;&#039;TCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCAGAGATCAGCAAGCAGCTG&lt;br /&gt;
&#039;&#039;&#039;GGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCATTCTTCCAGGAGGCACAGAAATTACAGG&lt;br /&gt;
&#039;&#039;&#039;CCATGCACAGAGAGAAATACCCGAATTATAAGTATCGA&#039;&#039;&#039;CCTCGTCGGAAGGCGAAGATGCTGCCGAAGAA&lt;br /&gt;
TTGCAGTTTGCTTCCCGCAGATCCCGCTTCGGTACTCTGCAGCGAAGTGCAACTGGACAACAGGTTGTAC&lt;br /&gt;
AGGGATGACTGTACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAACG&lt;br /&gt;
CAGCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTG&amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;TAG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;GACAATCGGGTAACATT&lt;br /&gt;
GGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCACTTTCTTATGTTTAGTTT&lt;br /&gt;
CAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCATTTCA&amp;lt;/small&amp;gt;&lt;br /&gt;
&lt;br /&gt;
(Legend : &amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Initiation codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt; ; &amp;lt;b&amp;gt;HMG sequence&amp;lt;/b&amp;gt; ; &amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Stop codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;)&lt;br /&gt;
&amp;lt;/center&amp;gt;&amp;lt;/div&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Regulation of the expression of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
In humans, the SRY promoter is found at −408 bp to −95 bp upstream of the ATG initiation codon. Moreover, the SRY gene has enhancers at -727 pb upstream of the ATG initiation codon. The linkage between regulatory proteins and this enhancers have the property to increase the production of SRY protein. These regulatory proteins could be: SF1 (steroidogenic factor 1), SP1  and WT 1 (Wilms tumor). &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
*SF1: this transcriptional factor belong to the family of nuclear hormone receptor and contains a zinc finger. The activation of this protein requires a ligand (hormone).&lt;br /&gt;
&lt;br /&gt;
*SP1: this transciprional factor is a ubiquitous protein binding in site containing rich-GC sequences and implicated in the transcription of many genes. Moreover, this protein contains a zinc finger.&lt;br /&gt;
&lt;br /&gt;
*WT1:this transcriptional factor transactives SRY gene, it contains a zinc finger. &amp;lt;ref&amp;gt;Larney C, Bailey TL, Koopman P. Switching on sex: transcriptional regulation of the testis-determining gene Sry. Dev Camb Engl. 2014 Jun;141(11):2195–205. &amp;lt;/ref&amp;gt; &lt;br /&gt;
&lt;br /&gt;
=== Role of the SRY gene ===&lt;br /&gt;
&lt;br /&gt;
The SRY protein is a transcription factor, which contains nuclear localization domains in N terminal and C terminal. An acetylation on these domains allows to export the protein SRY in the nucleus.  &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The SRY protein activates the SOX9 (SRY-box9) gene &amp;lt;ref&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;., this gene is found in the 17 chromosom in the long arm 24.3 &amp;lt;ref&amp;gt; NCBI [http://www.ncbi.nlm.nih.gov/gene/6662] &amp;lt;/ref&amp;gt; and is implicated in the stimulation of the differentiation of sertori cells. The activation of sox 9 are done with protein SRY and another transcriptional factor: SF1 (steroidogenic factor 1). These transcriptional factors are bind in an enhancers called: TESCO (testis-specific enhancer of Sox9 core element). The fixation of transcriptional factor in enhancer provokes a curvature of DNA (90°C) allowing a stabilisation of the elongation complex on the SOX9 promoter. The SOX 9 protein activates the gene AMH (anti-mullerian hormone)&amp;lt;ref&amp;gt;[http://www.ebi.ac.uk/interpro/entry/IPR006799?q=AMH] &amp;lt;/ref&amp;gt; allows the reduction of the channels of Müller in male. &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==Structure==&lt;br /&gt;
&lt;br /&gt;
===The SRY-HMG domain (HMG-Box)===&lt;br /&gt;
&#039;&#039;&#039;SRY-HMG&#039;&#039;&#039; stands for &#039;&#039;&#039;S&#039;&#039;&#039;ex determining &#039;&#039;&#039;R&#039;&#039;&#039;egion &#039;&#039;&#039;Y&#039;&#039;&#039; - &#039;&#039;&#039;H&#039;&#039;&#039;igh &#039;&#039;&#039;M&#039;&#039;&#039;obility &#039;&#039;&#039;G&#039;&#039;&#039;roup domain.&lt;br /&gt;
It is approximately 80 residues long. It mediates the binding of the protein to the minor groove of DNA. It is the most important part of the SRY protein. Not only because it enable  the protein to bind the DNA but because even a little mutation can cause an inactivation of the protein.&lt;br /&gt;
&lt;br /&gt;
It has a Twisted L shape meaning that it has a long (28Å) and a short (22Å) arm. The HMG Box is made of 3 helices, its N-term and C-term are irregular. The overall structure is stabilized by a hydrophobic core especially at the intersection of the 3 helices where 3 aromatics cycles meet, surrounnded by aliphatic aminoacids.&lt;br /&gt;
&lt;br /&gt;
The interaction between the HMG-Box and DNA is specific and stable. It permits the bend of DNA (?75°). It is mostly hydrophobic interaction. Only one molecule of water interface the Box and the DNA. the complex is stabilized by salt bridges between positive charged residues of the HMG domain and negative charged phosphates.&amp;lt;ref&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[Image:HHMG-bitmap.png|thumb|alt=Image bitmap|Linear structure of hHMG domain]]&lt;br /&gt;
&lt;br /&gt;
The binding of SRY to DNA is specific. The DNA target site is a DNA octamer :&lt;br /&gt;
&lt;br /&gt;
(5&#039;-dGCACAAAC)&lt;br /&gt;
(5&#039;-dGTTTGTGC)&lt;br /&gt;
&lt;br /&gt;
This sequenece is found in the promoters of genes expressed during the testicular development&lt;br /&gt;
The bend of DNA permits the recruitment of different proteins and the build of massives proteins-DNA complexes that could change the expression of different genes. It is the role of a transcription factor.&amp;lt;ref&amp;gt;PMID:11563911&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
Even if the most important function of the HMG box is its capacity of binding and bending DNA, it is also involved in DNA condensation, recombination and DNA repair.&lt;br /&gt;
&lt;br /&gt;
There are 2 kinds of protein that contain a HMG box&lt;br /&gt;
* HMG1 : It is expressed in few cell types. It is found in transcription factors that contain a single HMG box. The bind to a DNA sequence is specific.&lt;br /&gt;
* HMG2 : Are found in all cell types and are abundant in chromatin. This proteins can contain two or more HMG boxes that can nonspecifically bind DNA. &lt;br /&gt;
&lt;br /&gt;
===General structure of SRY===&lt;br /&gt;
The overall structure of SRY is organized aroud the HMG-box.&lt;br /&gt;
3 domains:&lt;br /&gt;
* N-term domain&lt;br /&gt;
* Central domain : DNA binding (HMG box)&lt;br /&gt;
* C-term domain&lt;br /&gt;
&lt;br /&gt;
== Function ==&lt;br /&gt;
&lt;br /&gt;
===Sex determining===&lt;br /&gt;
It acts like a sex determinator thanks to it transcriptionnal activity. It inhibits the developpement of female sex structure in th embryonnic individual.&lt;br /&gt;
&lt;br /&gt;
==Implication - Future for SRY ?==&lt;br /&gt;
&lt;br /&gt;
== Disease ==&lt;br /&gt;
&lt;br /&gt;
=== Swyer syndrome (AKA XY gonadal dysgenis) :===&lt;br /&gt;
&lt;br /&gt;
	If the TDF protein is not able to bind its targeted DNA sequences, the genes responsible for the testis development are not expressed. The patient owning this defective protein will then develop female characters, even though he has a XY karyotype. This phenomenon is known as the « Swyer Syndrome ». &lt;br /&gt;
Different causes can explain this « XY gonadal dysgenis », as it is also called. About thirty mutations (named [http://www.uniprot.org/uniprot/Q05066#sequences &amp;quot;SRXY1&amp;quot;]) in the SRY gene have been shown to drive this phenotype development. It can also be due to crossovers during a meiosis. If a Y chromosome portion carrying the SRY gene is recombined into a X chromosome, a sperm cell will get this abnormal Y chromosome. If it then fecundates, a XY karyotype without any SRY gene will be formed. &lt;br /&gt;
&lt;br /&gt;
=== De La Chapelle syndrome (AKA XX male syndrome) :===&lt;br /&gt;
&lt;br /&gt;
From the meiosis just described would also result an abnormal X chromosome, carrying the SRY gene. If the sperm cell owning this chromosome fecundates an ovule, the resulting newborn will have a XX karyotype but a male phenotype. This is called the « De La Chapelle syndrome ». In this case, the patient can either develop testis or both testis and ovarian tissues. As some epigenetic mechanisms can inactivate the X chromosome carrying SRY, this syndrome keeps most of the patients sterile.&amp;lt;ref&amp;gt;PMID: 4622299&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
== Relevance ==&lt;br /&gt;
&lt;br /&gt;
== Structural highlights ==&lt;br /&gt;
&lt;br /&gt;
This is a sample scene created with SAT to &amp;lt;scene name=&amp;quot;/12/3456/Sample/1&amp;quot;&amp;gt;color&amp;lt;/scene&amp;gt; by Group, and another to make &amp;lt;scene name=&amp;quot;/12/3456/Sample/2&amp;quot;&amp;gt;a transparent representation&amp;lt;/scene&amp;gt; of the protein. You can make your own scenes on SAT starting from scratch or loading and editing one of these sample scenes.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;/StructureSection&amp;gt;&lt;br /&gt;
== References ==&lt;br /&gt;
[http://ghr.nlm.nih.gov/gene/SRY Genetic Home reference]&lt;br /&gt;
&amp;lt;references/&amp;gt;&lt;/div&gt;</summary>
		<author><name>Fantin Mesny</name></author>
	</entry>
	<entry>
		<id>https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2525357</id>
		<title>Sandbox Reserved 1120</title>
		<link rel="alternate" type="text/html" href="https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2525357"/>
		<updated>2016-01-28T10:11:17Z</updated>

		<summary type="html">&lt;p&gt;Fantin Mesny: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{Sandbox_Reserved_ESBS_2015}}&amp;lt;!-- PLEASE ADD YOUR CONTENT BELOW HERE --&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==SRY protein (AKA TDF protein)==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;StructureSection load=&#039;1hry&#039; size=&#039;340&#039; side=&#039;right&#039; caption=&#039;The SRY protein linked to DNA&#039; scene=&#039;&#039;&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The SRY protein is a 204 residues long monomeric polypeptide. It is a &#039;&#039;&#039;transcriptionnal factor&#039;&#039;&#039;, It activates the &#039;&#039;&#039;M&#039;&#039;&#039;üllerian &#039;&#039;&#039;I&#039;&#039;&#039;nhibiting &#039;&#039;&#039;S&#039;&#039;&#039;ubstance (&#039;&#039;&#039;MIS&#039;&#039;&#039; gene).&lt;br /&gt;
It is encoded by the [[testis-determining sex gene]] and is itself involved in the sex determination in mammels by being responsible for the gonadogenesis thus the male sexual developement. It is the HMG-box that gives to the protein its ability to bind DNA by its minor groove. &amp;lt;ref&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Properties===&lt;br /&gt;
&lt;br /&gt;
&amp;lt;table style=&amp;quot;width:100%&amp;quot;;border: 3px solid #A0A0A0&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Molecular weight&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Gene&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Length&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;DNA target sequence&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Genes targeted&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Inhibitors&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;/table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==History==&lt;br /&gt;
&lt;br /&gt;
After centuries of unfounded theories mainly based on environmental factors, the first molecular theory concerning the sex determination appeared in 1891. At this time, the german biologist Hermann Henking was studying sperm formation in wasps. As a chromosome which was not present in all the wasps looked different from the others, he suspected it to play a role in sex determination and called it the &amp;quot;X chromosome&amp;quot;.&lt;br /&gt;
Ten years later, Clarence Erwin McClung saw that this chromosome behaved differently during the meiosis and was only present in half the sperm cells of grasshoppers. As the main characteristic that varies in 50/50 proportions among zygotes is the sex, McClung suspected the X chromosome to be implicated in sexual development. &lt;br /&gt;
In 1905, Nettie Stevens discovered the &amp;quot;Y chromosome&amp;quot; (and the female XX and male XY patterns) while she was counting the chromosomes of beetles under the microscope&amp;lt;ref&amp;gt;Sumner, A. T. Sex Chromosomes and Sex Determination. Chromosomes: Organization and Function, 97-108. [http://www.nature.com/scitable/nated/topicpage/Sex-Chromosomes-and-Sex-Determination-44565]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
During the next decades, a few theories were in competition. In 1921, Calvin Bridges&#039;s works on &#039;&#039;Drosophila melanogaster&#039;&#039; seemed to reveal that male characters acquisition is due to a genic balance between the genes contained in the X chromosome and those contained in the autosomes&amp;lt;ref&amp;gt;PMID: 17769897&amp;lt;/ref&amp;gt;.&lt;br /&gt;
In 1930, Ronald Fisher introduced the first Y-based control of sex theory by proposing two different models : either all the genes responsible for the male characters are located on the Y chromosome or there is a Y-located gene which regulates the expression of genes elsewhere in the genome&amp;lt;ref&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt;.&lt;br /&gt;
As Alfred Jost had shown the testosterone produced by the testis is responsible for the entire male phenotype acquisition&amp;lt;ref&amp;gt;PMID: 4805859&amp;lt;/ref&amp;gt;, in 1988, Peter Neville Goodfellow proposed that there is a gene (&#039;&#039;TDF&#039;&#039; in human, &#039;&#039;Tdy&#039;&#039; in mice)  on the Y chromosome which drives the development of the testis.&amp;lt;ref&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt; In 1990, Goodfellow&#039;s hypothesis was validated with the discovery of &#039;&#039;Tdy&#039;&#039;&#039;s localisation. This gene&#039;s product (expressed during the male gonadal development) owns an amino-acid motif showing homology to other known or putative DNA-binding domains. &#039;&#039;Tdy&#039;&#039; is therefore a transcriptional factor&amp;lt;ref&amp;gt;PMID: 2374589&amp;lt;/ref&amp;gt;. The same year, the human &#039;&#039;SRY&#039;&#039; gene (accepted later as the &#039;&#039;TDF&#039;&#039;) was discovered&amp;lt;ref&amp;gt;PMID: 1695712&amp;lt;/ref&amp;gt;. &lt;br /&gt;
Three dimensional structure of the SRY protein was determined in 1995 using NMR spectroscopy&amp;lt;ref&amp;gt;PMID: 7774012&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==SRY gene==&lt;br /&gt;
&lt;br /&gt;
===Generality===&lt;br /&gt;
&lt;br /&gt;
The SRY gene encodes the SRY protein. The SRY protein is a transcriptional factor inducing the male phenotype in embryo. The SRY gene is located on the [https://en.wikipedia.org/wiki/Y_chromosome Y chromosom] in the short arm (p) 11.3 &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/gene/6736]&amp;lt;/ref&amp;gt;. This gene has only one exon containing the HMG domain (DNA-binding high-mobility group box domain). That&#039;s means that SRY mRNA does not have a alternative splicing, so there is one isoform of SRY protein.&amp;lt;ref&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;. Moreover,the human genome contains one copy of the SRY gene, whereas the mouse genome contains 6 copy of this gene. &amp;lt;ref&amp;gt; Sekido R, Lovell-Badge R. Genetic control of testis development. Sex Dev Genet Mol Biol Evol Endocrinol Embryol Pathol Sex Determ Differ. 2013;7(1-3):21–32 &amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Sequence of the SRY gene===&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:90%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
&amp;gt;gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/nuccore]&amp;lt;/ref&amp;gt;&lt;br /&gt;
TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT&lt;br /&gt;
TTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACA&lt;br /&gt;
&amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;ATG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;CAATCATATGCTTCTGCTATGTTAAGCGTATTCAACAGCGATGATTACAGTCCAGCTGTGCAAGAGAAT&lt;br /&gt;
ATTCCCGCTCTCCGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTAAGTATCAGTGTGAAA&lt;br /&gt;
CGGGAGAAAACAGTAAAGGCAACGTCCAGGATAGAGTGAAGCGACCCATGAACGCATTCATCGTGTGGTC&lt;br /&gt;
&#039;&#039;&#039;TCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCAGAGATCAGCAAGCAGCTG&lt;br /&gt;
&#039;&#039;&#039;GGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCATTCTTCCAGGAGGCACAGAAATTACAGG&lt;br /&gt;
&#039;&#039;&#039;CCATGCACAGAGAGAAATACCCGAATTATAAGTATCGA&#039;&#039;&#039;CCTCGTCGGAAGGCGAAGATGCTGCCGAAGAA&lt;br /&gt;
TTGCAGTTTGCTTCCCGCAGATCCCGCTTCGGTACTCTGCAGCGAAGTGCAACTGGACAACAGGTTGTAC&lt;br /&gt;
AGGGATGACTGTACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAACG&lt;br /&gt;
CAGCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTG&amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;TAG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;GACAATCGGGTAACATT&lt;br /&gt;
GGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCACTTTCTTATGTTTAGTTT&lt;br /&gt;
CAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCATTTCA&amp;lt;/small&amp;gt;&lt;br /&gt;
&lt;br /&gt;
(Legend : &amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Initiation codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt; ; &amp;lt;b&amp;gt;HMG sequence&amp;lt;/b&amp;gt; ; &amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Stop codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;)&lt;br /&gt;
&amp;lt;/center&amp;gt;&amp;lt;/div&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Regulation of the expression of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
In humans, the SRY promoter is found at −408 bp to −95 bp upstream of the ATG initiation codon. Moreover, the SRY gene has enhancers at -727 pb upstream of the ATG initiation codon. The linkage between regulatory proteins and this enhancers have the property to increase the production of SRY protein. These regulatory proteins could be: SF1 (steroidogenic factor 1), SP1  and WT 1 (Wilms tumor). &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
*SF1: this transcriptional factor belong to the family of nuclear hormone receptor and contains a zinc finger. The activation of this protein requires a ligand (hormone).&lt;br /&gt;
&lt;br /&gt;
*SP1: this transciprional factor is a ubiquitous protein binding in site containing rich-GC sequences and implicated in the transcription of many genes. Moreover, this protein contains a zinc finger.&lt;br /&gt;
&lt;br /&gt;
*WT1:this transcriptional factor transactives SRY gene, it contains a zinc finger. &amp;lt;ref&amp;gt;Larney C, Bailey TL, Koopman P. Switching on sex: transcriptional regulation of the testis-determining gene Sry. Dev Camb Engl. 2014 Jun;141(11):2195–205. &amp;lt;/ref&amp;gt; &lt;br /&gt;
&lt;br /&gt;
=== Role of the SRY gene ===&lt;br /&gt;
&lt;br /&gt;
The SRY protein is a transcription factor, which contains nuclear localization domains in N terminal and C terminal. An acetylation on these domains allows to export the protein SRY in the nucleus.  &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The SRY protein activates the SOX9 (SRY-box9) gene &amp;lt;ref&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;., this gene is found in the 17 chromosom in the long arm 24.3 &amp;lt;ref&amp;gt; NCBI [http://www.ncbi.nlm.nih.gov/gene/6662] &amp;lt;/ref&amp;gt; and is implicated in the stimulation of the differentiation of sertori cells. The activation of sox 9 are done with protein SRY and another transcriptional factor: SF1 (steroidogenic factor 1). These transcriptional factors are bind in an enhancers called: TESCO (testis-specific enhancer of Sox9 core element). The fixation of transcriptional factor in enhancer provokes a curvature of DNA (90°C) allowing a stabilisation of the elongation complex on the SOX9 promoter. The SOX 9 protein activates the gene AMH (anti-mullerian hormone)&amp;lt;ref&amp;gt;[http://www.ebi.ac.uk/interpro/entry/IPR006799?q=AMH] &amp;lt;/ref&amp;gt; allows the reduction of the channels of Müller in male. &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==Structure==&lt;br /&gt;
&lt;br /&gt;
===The SRY-HMG domain (HMG-Box)===&lt;br /&gt;
&#039;&#039;&#039;SRY-HMG&#039;&#039;&#039; stands for &#039;&#039;&#039;S&#039;&#039;&#039;ex determining &#039;&#039;&#039;R&#039;&#039;&#039;egion &#039;&#039;&#039;Y&#039;&#039;&#039; - &#039;&#039;&#039;H&#039;&#039;&#039;igh &#039;&#039;&#039;M&#039;&#039;&#039;obility &#039;&#039;&#039;G&#039;&#039;&#039;roup domain.&lt;br /&gt;
It is approximately 80 residues long. It mediates the binding of the protein to the minor groove of DNA. It is the most important part of the SRY protein. Not only because it enable  the protein to bind the DNA but because even a little mutation can cause an inactivation of the protein.&lt;br /&gt;
&lt;br /&gt;
It has a Twisted L shape meaning that it has a long (28Å) and a short (22Å) arm. The HMG Box is made of 3 helices, its N-term and C-term are irregular. The overall structure is stabilized by a hydrophobic core especially at the intersection of the 3 helices where 3 aromatics cycles meet, surrounnded by aliphatic aminoacids.&lt;br /&gt;
&lt;br /&gt;
The interaction between the HMG-Box and DNA is specific and stable. It permits the bend of DNA (?75°). It is mostly hydrophobic interaction. Only one molecule of water interface the Box and the DNA. the complex is stabilized by salt bridges between positive charged residues of the HMG domain and negative charged phosphates.&amp;lt;ref&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[Image:HHMG-bitmap.png|thumb|alt=Image bitmap|Linear structure of hHMG domain]]&lt;br /&gt;
&lt;br /&gt;
The binding of SRY to DNA is specific. The DNA target site is a DNA octamer :&lt;br /&gt;
&lt;br /&gt;
(5&#039;-dGCACAAAC)&lt;br /&gt;
(5&#039;-dGTTTGTGC)&lt;br /&gt;
&lt;br /&gt;
This sequenece is found in the promoters of genes expressed during the testicular development&lt;br /&gt;
The bend of DNA permits the recruitment of different proteins and the build of massives proteins-DNA complexes that could change the expression of different genes. It is the role of a transcription factor.&amp;lt;ref&amp;gt;PMID:11563911&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
Even if the most important function of the HMG box is its capacity of binding and bending DNA, it is also involved in DNA condensation, recombination and DNA repair.&lt;br /&gt;
&lt;br /&gt;
There are 2 kinds of protein that contain a HMG box&lt;br /&gt;
* HMG1 : It is expressed in few cell types. It is found in transcription factors that contain a single HMG box. The bind to a DNA sequence is specific.&lt;br /&gt;
* HMG2 : Are found in all cell types and are abundant in chromatin. This proteins can contain two or more HMG boxes that can nonspecifically bind DNA. &lt;br /&gt;
&lt;br /&gt;
===General structure of SRY===&lt;br /&gt;
The overall structure of SRY is organized aroud the HMG-box.&lt;br /&gt;
3 domains:&lt;br /&gt;
* N-term domain&lt;br /&gt;
* Central domain : DNA binding (HMG box)&lt;br /&gt;
* C-term domain&lt;br /&gt;
&lt;br /&gt;
== Function ==&lt;br /&gt;
&lt;br /&gt;
===Sex determining===&lt;br /&gt;
It acts like a sex determinator thanks to it transcriptionnal activity. It inhibits the developpement of female sex structure in th embryonnic individual.&lt;br /&gt;
&lt;br /&gt;
==Implication - Future for SRY ?==&lt;br /&gt;
&lt;br /&gt;
== Disease ==&lt;br /&gt;
&lt;br /&gt;
=== Swyer syndrome (AKA XY gonadal dysgenis) :===&lt;br /&gt;
&lt;br /&gt;
	If the TDF protein is not able to bind its targeted DNA sequences, the genes responsible for the testis development are not expressed. The patient owning this defective protein will then develop female characters, even though he has a XY karyotype. This phenomenon is known as the « Swyer Syndrome ». &lt;br /&gt;
Different causes can explain this « XY gonadal dysgenis », as it is also called. About thirty mutations (named [http://www.uniprot.org/uniprot/Q05066#sequences &amp;quot;SRXY1&amp;quot;]) in the SRY gene have been shown to drive this phenotype development. It can also be due to crossovers during a meiosis. If a Y chromosome portion carrying the SRY gene is recombined into a X chromosome, a sperm cell will get this abnormal Y chromosome. If it then fecundates, a XY karyotype without any SRY gene will be formed. &lt;br /&gt;
&lt;br /&gt;
=== De La Chapelle syndrome (AKA XX male syndrome) :===&lt;br /&gt;
&lt;br /&gt;
From the meiosis just described would also result an abnormal X chromosome, carrying the SRY gene. If the sperm cell owning this chromosome fecundates an ovule, the resulting newborn will have a XX karyotype but a male phenotype. This is called the « De La Chapelle syndrome ». In this case, the patient can either develop testis or both testis and ovarian tissues. As some epigenetic mechanisms can inactivate the X chromosome carrying SRY, this syndrome keeps most of the patients sterile.&amp;lt;ref&amp;gt;PMID: 4622299&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
== Relevance ==&lt;br /&gt;
&lt;br /&gt;
== Structural highlights ==&lt;br /&gt;
&lt;br /&gt;
This is a sample scene created with SAT to &amp;lt;scene name=&amp;quot;/12/3456/Sample/1&amp;quot;&amp;gt;color&amp;lt;/scene&amp;gt; by Group, and another to make &amp;lt;scene name=&amp;quot;/12/3456/Sample/2&amp;quot;&amp;gt;a transparent representation&amp;lt;/scene&amp;gt; of the protein. You can make your own scenes on SAT starting from scratch or loading and editing one of these sample scenes.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;/StructureSection&amp;gt;&lt;br /&gt;
== References ==&lt;br /&gt;
[http://ghr.nlm.nih.gov/gene/SRY Genetic Home reference]&lt;br /&gt;
&amp;lt;references/&amp;gt;&lt;/div&gt;</summary>
		<author><name>Fantin Mesny</name></author>
	</entry>
	<entry>
		<id>https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2525355</id>
		<title>Sandbox Reserved 1120</title>
		<link rel="alternate" type="text/html" href="https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2525355"/>
		<updated>2016-01-28T10:10:30Z</updated>

		<summary type="html">&lt;p&gt;Fantin Mesny: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{Sandbox_Reserved_ESBS_2015}}&amp;lt;!-- PLEASE ADD YOUR CONTENT BELOW HERE --&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==SRY protein (AKA TDF protein)==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;StructureSection load=&#039;1hry&#039; size=&#039;340&#039; side=&#039;right&#039; caption=&#039;The SRY protein linked to DNA&#039; scene=&#039;&#039;&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The SRY protein is a 204 residues long monomeric polypeptide. It is a &#039;&#039;&#039;transcriptionnal factor&#039;&#039;&#039;, It activates the &#039;&#039;&#039;M&#039;&#039;&#039;üllerian &#039;&#039;&#039;I&#039;&#039;&#039;nhibiting &#039;&#039;&#039;S&#039;&#039;&#039;ubstance (&#039;&#039;&#039;MIS&#039;&#039;&#039; gene).&lt;br /&gt;
It is encoded by the [[testis-determining sex gene]] and is itself involved in the sex determination in mammels by being responsible for the gonadogenesis thus the male sexual developement. It is the HMG-box that gives to the protein its ability to bind DNA by its minor groove. &amp;lt;ref&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Properties===&lt;br /&gt;
&lt;br /&gt;
&amp;lt;table style=&amp;quot;width:100%&amp;quot;;border: 3px solid #A0A0A0&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Molecular weight&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Gene&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Length&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;DNA target sequence&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Genes targeted&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Inhibitors&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;/table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==History==&lt;br /&gt;
&lt;br /&gt;
After centuries of unfounded theories mainly based on environmental factors, the first molecular theory concerning the sex determination appeared in 1891. At this time, the german biologist Hermann Henking was studying sperm formation in wasps. As a chromosome which was not present in all the wasps looked different from the others, he suspected it to play a role in sex determination and called it the &amp;quot;X chromosome&amp;quot;.&lt;br /&gt;
Ten years later, Clarence Erwin McClung saw that this chromosome behaved differently during the meiosis and was only present in half the sperm cells of grasshoppers. As the main characteristic that varies in 50/50 proportions among zygotes is the sex, McClung suspected the X chromosome to be implicated in sexual development. &lt;br /&gt;
In 1905, Nettie Stevens discovered the &amp;quot;Y chromosome&amp;quot; (and the female XX and male XY patterns) while she was counting the chromosomes of beetles under the microscope&amp;lt;ref&amp;gt;Sumner, A. T. Sex Chromosomes and Sex Determination. Chromosomes: Organization and Function, 97-108. [http://www.nature.com/scitable/nated/topicpage/Sex-Chromosomes-and-Sex-Determination-44565]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
During the next decades, a few theories were in competition. In 1921, Calvin Bridges&#039;s works on &#039;&#039;Drosophila melanogaster&#039;&#039; seemed to reveal that male characters acquisition is due to a genic balance between the genes contained in the X chromosome and those contained in the autosomes&amp;lt;ref&amp;gt;PMID: 17769897&amp;lt;/ref&amp;gt;.&lt;br /&gt;
In 1930, Ronald Fisher introduced the first Y-based control of sex theory by proposing two different models : either all the genes responsible for the male characters are located on the Y chromosome or there is a Y-located gene which regulates the expression of genes elsewhere in the genome&amp;lt;ref&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt;.&lt;br /&gt;
As Alfred Jost had shown the testosterone produced by the testis is responsible for the entire male phenotype acquisition&amp;lt;ref&amp;gt;PMID: 4805859&amp;lt;/ref&amp;gt;, in 1988, Peter Neville Goodfellow proposed that there is a gene (&#039;&#039;TDF&#039;&#039; in human, &#039;&#039;Tdy&#039;&#039; in mice)  on the Y chromosome which drives the development of the testis.&amp;lt;ref&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt; In 1990, Goodfellow&#039;s hypothesis was validated with the discovery of &#039;&#039;Tdy&#039;&#039;&#039;s localisation. This gene&#039;s product (expressed during the male gonadal development) owns an amino-acid motif showing homology to other known or putative DNA-binding domains. &#039;&#039;Tdy&#039;&#039; is therefore a transcriptional factor&amp;lt;ref&amp;gt;PMID: 2374589&amp;lt;/ref&amp;gt;. The same year, the human &#039;&#039;SRY&#039;&#039; gene (accepted later as the &#039;&#039;TDF&#039;&#039;) was discovered&amp;lt;ref&amp;gt;PMID: 1695712&amp;lt;/ref&amp;gt;. &lt;br /&gt;
Three dimensional structure of the SRY protein was determined in 1995 using NMR spectroscopy&amp;lt;ref&amp;gt;PMID: 7774012&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==SRY gene==&lt;br /&gt;
&lt;br /&gt;
===Generality===&lt;br /&gt;
&lt;br /&gt;
The SRY gene encodes the SRY protein. The SRY protein is a transcriptional factor inducing the male phenotype in embryo. The SRY gene is located on the [https://en.wikipedia.org/wiki/Y_chromosome Y chromosom] in the short arm (p) 11.3 &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/gene/6736]&amp;lt;/ref&amp;gt;. This gene has only one exon containing the HMG domain (DNA-binding high-mobility group box domain). That&#039;s means that SRY mRNA does not have a alternative splicing, so there is one isoform of SRY protein.&amp;lt;ref&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;. Moreover,the human genome contains one copy of the SRY gene, whereas the mouse genome contains 6 copy of this gene. &amp;lt;ref&amp;gt; Sekido R, Lovell-Badge R. Genetic control of testis development. Sex Dev Genet Mol Biol Evol Endocrinol Embryol Pathol Sex Determ Differ. 2013;7(1-3):21–32 &amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Sequence of the SRY gene===&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:90%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
&amp;gt;gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/nuccore]&amp;lt;/ref&amp;gt;&lt;br /&gt;
TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT&lt;br /&gt;
TTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACA&lt;br /&gt;
&amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;ATG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;CAATCATATGCTTCTGCTATGTTAAGCGTATTCAACAGCGATGATTACAGTCCAGCTGTGCAAGAGAAT&lt;br /&gt;
ATTCCCGCTCTCCGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTAAGTATCAGTGTGAAA&lt;br /&gt;
CGGGAGAAAACAGTAAAGGCAACGTCCAGGATAGAGTGAAGCGACCCATGAACGCATTCATCGTGTGGTC&lt;br /&gt;
&#039;&#039;&#039;TCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCAGAGATCAGCAAGCAGCTG&lt;br /&gt;
&#039;&#039;&#039;GGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCATTCTTCCAGGAGGCACAGAAATTACAGG&lt;br /&gt;
&#039;&#039;&#039;CCATGCACAGAGAGAAATACCCGAATTATAAGTATCGA&#039;&#039;&#039;CCTCGTCGGAAGGCGAAGATGCTGCCGAAGAA&lt;br /&gt;
TTGCAGTTTGCTTCCCGCAGATCCCGCTTCGGTACTCTGCAGCGAAGTGCAACTGGACAACAGGTTGTAC&lt;br /&gt;
AGGGATGACTGTACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAACG&lt;br /&gt;
CAGCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTG&amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;TAG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;GACAATCGGGTAACATT&lt;br /&gt;
GGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCACTTTCTTATGTTTAGTTT&lt;br /&gt;
CAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCATTTCA&amp;lt;/small&amp;gt;&lt;br /&gt;
&lt;br /&gt;
(Legend : &amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Initiation codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt; ; &amp;lt;b&amp;gt;HMG sequence&amp;lt;/b&amp;gt; ; &amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Stop codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;)&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Regulation of the expression of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
In humans, the SRY promoter is found at −408 bp to −95 bp upstream of the ATG initiation codon. Moreover, the SRY gene has enhancers at -727 pb upstream of the ATG initiation codon. The linkage between regulatory proteins and this enhancers have the property to increase the production of SRY protein. These regulatory proteins could be: SF1 (steroidogenic factor 1), SP1  and WT 1 (Wilms tumor). &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
*SF1: this transcriptional factor belong to the family of nuclear hormone receptor and contains a zinc finger. The activation of this protein requires a ligand (hormone).&lt;br /&gt;
&lt;br /&gt;
*SP1: this transciprional factor is a ubiquitous protein binding in site containing rich-GC sequences and implicated in the transcription of many genes. Moreover, this protein contains a zinc finger.&lt;br /&gt;
&lt;br /&gt;
*WT1:this transcriptional factor transactives SRY gene, it contains a zinc finger. &amp;lt;ref&amp;gt;Larney C, Bailey TL, Koopman P. Switching on sex: transcriptional regulation of the testis-determining gene Sry. Dev Camb Engl. 2014 Jun;141(11):2195–205. &amp;lt;/ref&amp;gt; &lt;br /&gt;
&lt;br /&gt;
=== Role of the SRY gene ===&lt;br /&gt;
&lt;br /&gt;
The SRY protein is a transcription factor, which contains nuclear localization domains in N terminal and C terminal. An acetylation on these domains allows to export the protein SRY in the nucleus.  &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The SRY protein activates the SOX9 (SRY-box9) gene &amp;lt;ref&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;., this gene is found in the 17 chromosom in the long arm 24.3 &amp;lt;ref&amp;gt; NCBI [http://www.ncbi.nlm.nih.gov/gene/6662] &amp;lt;/ref&amp;gt; and is implicated in the stimulation of the differentiation of sertori cells. The activation of sox 9 are done with protein SRY and another transcriptional factor: SF1 (steroidogenic factor 1). These transcriptional factors are bind in an enhancers called: TESCO (testis-specific enhancer of Sox9 core element). The fixation of transcriptional factor in enhancer provokes a curvature of DNA (90°C) allowing a stabilisation of the elongation complex on the SOX9 promoter. The SOX 9 protein activates the gene AMH (anti-mullerian hormone)&amp;lt;ref&amp;gt;[http://www.ebi.ac.uk/interpro/entry/IPR006799?q=AMH] &amp;lt;/ref&amp;gt; allows the reduction of the channels of Müller in male. &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==Structure==&lt;br /&gt;
&lt;br /&gt;
===The SRY-HMG domain (HMG-Box)===&lt;br /&gt;
&#039;&#039;&#039;SRY-HMG&#039;&#039;&#039; stands for &#039;&#039;&#039;S&#039;&#039;&#039;ex determining &#039;&#039;&#039;R&#039;&#039;&#039;egion &#039;&#039;&#039;Y&#039;&#039;&#039; - &#039;&#039;&#039;H&#039;&#039;&#039;igh &#039;&#039;&#039;M&#039;&#039;&#039;obility &#039;&#039;&#039;G&#039;&#039;&#039;roup domain.&lt;br /&gt;
It is approximately 80 residues long. It mediates the binding of the protein to the minor groove of DNA. It is the most important part of the SRY protein. Not only because it enable  the protein to bind the DNA but because even a little mutation can cause an inactivation of the protein.&lt;br /&gt;
&lt;br /&gt;
It has a Twisted L shape meaning that it has a long (28Å) and a short (22Å) arm. The HMG Box is made of 3 helices, its N-term and C-term are irregular. The overall structure is stabilized by a hydrophobic core especially at the intersection of the 3 helices where 3 aromatics cycles meet, surrounnded by aliphatic aminoacids.&lt;br /&gt;
&lt;br /&gt;
The interaction between the HMG-Box and DNA is specific and stable. It permits the bend of DNA (?75°). It is mostly hydrophobic interaction. Only one molecule of water interface the Box and the DNA. the complex is stabilized by salt bridges between positive charged residues of the HMG domain and negative charged phosphates.&amp;lt;ref&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[Image:HHMG-bitmap.png|thumb|alt=Image bitmap|Linear structure of hHMG domain]]&lt;br /&gt;
&lt;br /&gt;
The binding of SRY to DNA is specific. The DNA target site is a DNA octamer :&lt;br /&gt;
&lt;br /&gt;
(5&#039;-dGCACAAAC)&lt;br /&gt;
(5&#039;-dGTTTGTGC)&lt;br /&gt;
&lt;br /&gt;
This sequenece is found in the promoters of genes expressed during the testicular development&lt;br /&gt;
The bend of DNA permits the recruitment of different proteins and the build of massives proteins-DNA complexes that could change the expression of different genes. It is the role of a transcription factor.&amp;lt;ref&amp;gt;PMID:11563911&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
Even if the most important function of the HMG box is its capacity of binding and bending DNA, it is also involved in DNA condensation, recombination and DNA repair.&lt;br /&gt;
&lt;br /&gt;
There are 2 kinds of protein that contain a HMG box&lt;br /&gt;
* HMG1 : It is expressed in few cell types. It is found in transcription factors that contain a single HMG box. The bind to a DNA sequence is specific.&lt;br /&gt;
* HMG2 : Are found in all cell types and are abundant in chromatin. This proteins can contain two or more HMG boxes that can nonspecifically bind DNA. &lt;br /&gt;
&lt;br /&gt;
===General structure of SRY===&lt;br /&gt;
The overall structure of SRY is organized aroud the HMG-box.&lt;br /&gt;
3 domains:&lt;br /&gt;
* N-term domain&lt;br /&gt;
* Central domain : DNA binding (HMG box)&lt;br /&gt;
* C-term domain&lt;br /&gt;
&lt;br /&gt;
== Function ==&lt;br /&gt;
&lt;br /&gt;
===Sex determining===&lt;br /&gt;
It acts like a sex determinator thanks to it transcriptionnal activity. It inhibits the developpement of female sex structure in th embryonnic individual.&lt;br /&gt;
&lt;br /&gt;
==Implication - Future for SRY ?==&lt;br /&gt;
&lt;br /&gt;
== Disease ==&lt;br /&gt;
&lt;br /&gt;
=== Swyer syndrome (AKA XY gonadal dysgenis) :===&lt;br /&gt;
&lt;br /&gt;
	If the TDF protein is not able to bind its targeted DNA sequences, the genes responsible for the testis development are not expressed. The patient owning this defective protein will then develop female characters, even though he has a XY karyotype. This phenomenon is known as the « Swyer Syndrome ». &lt;br /&gt;
Different causes can explain this « XY gonadal dysgenis », as it is also called. About thirty mutations (named [http://www.uniprot.org/uniprot/Q05066#sequences &amp;quot;SRXY1&amp;quot;]) in the SRY gene have been shown to drive this phenotype development. It can also be due to crossovers during a meiosis. If a Y chromosome portion carrying the SRY gene is recombined into a X chromosome, a sperm cell will get this abnormal Y chromosome. If it then fecundates, a XY karyotype without any SRY gene will be formed. &lt;br /&gt;
&lt;br /&gt;
=== De La Chapelle syndrome (AKA XX male syndrome) :===&lt;br /&gt;
&lt;br /&gt;
From the meiosis just described would also result an abnormal X chromosome, carrying the SRY gene. If the sperm cell owning this chromosome fecundates an ovule, the resulting newborn will have a XX karyotype but a male phenotype. This is called the « De La Chapelle syndrome ». In this case, the patient can either develop testis or both testis and ovarian tissues. As some epigenetic mechanisms can inactivate the X chromosome carrying SRY, this syndrome keeps most of the patients sterile.&amp;lt;ref&amp;gt;PMID: 4622299&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
== Relevance ==&lt;br /&gt;
&lt;br /&gt;
== Structural highlights ==&lt;br /&gt;
&lt;br /&gt;
This is a sample scene created with SAT to &amp;lt;scene name=&amp;quot;/12/3456/Sample/1&amp;quot;&amp;gt;color&amp;lt;/scene&amp;gt; by Group, and another to make &amp;lt;scene name=&amp;quot;/12/3456/Sample/2&amp;quot;&amp;gt;a transparent representation&amp;lt;/scene&amp;gt; of the protein. You can make your own scenes on SAT starting from scratch or loading and editing one of these sample scenes.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;/StructureSection&amp;gt;&lt;br /&gt;
== References ==&lt;br /&gt;
[http://ghr.nlm.nih.gov/gene/SRY Genetic Home reference]&lt;br /&gt;
&amp;lt;references/&amp;gt;&lt;/div&gt;</summary>
		<author><name>Fantin Mesny</name></author>
	</entry>
	<entry>
		<id>https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2525349</id>
		<title>Sandbox Reserved 1120</title>
		<link rel="alternate" type="text/html" href="https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2525349"/>
		<updated>2016-01-28T10:07:17Z</updated>

		<summary type="html">&lt;p&gt;Fantin Mesny: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{Sandbox_Reserved_ESBS_2015}}&amp;lt;!-- PLEASE ADD YOUR CONTENT BELOW HERE --&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==SRY protein (AKA TDF protein)==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;StructureSection load=&#039;1hry&#039; size=&#039;340&#039; side=&#039;right&#039; caption=&#039;The SRY protein linked to DNA&#039; scene=&#039;&#039;&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The SRY protein is a 204 residues long monomeric polypeptide. It is a &#039;&#039;&#039;transcriptionnal factor&#039;&#039;&#039;, It activates the &#039;&#039;&#039;M&#039;&#039;&#039;üllerian &#039;&#039;&#039;I&#039;&#039;&#039;nhibiting &#039;&#039;&#039;S&#039;&#039;&#039;ubstance (&#039;&#039;&#039;MIS&#039;&#039;&#039; gene).&lt;br /&gt;
It is encoded by the [[testis-determining sex gene]] and is itself involved in the sex determination in mammels by being responsible for the gonadogenesis thus the male sexual developement. It is the HMG-box that gives to the protein its ability to bind DNA by its minor groove. &amp;lt;ref&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Properties===&lt;br /&gt;
&lt;br /&gt;
&amp;lt;table style=&amp;quot;width:100%&amp;quot;;border: 3px solid #A0A0A0&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Molecular weight&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Gene&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Length&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;DNA target sequence&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Genes targeted&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Inhibitors&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;/table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==History==&lt;br /&gt;
&lt;br /&gt;
After centuries of unfounded theories mainly based on environmental factors, the first molecular theory concerning the sex determination appeared in 1891. At this time, the german biologist Hermann Henking was studying sperm formation in wasps. As a chromosome which was not present in all the wasps looked different from the others, he suspected it to play a role in sex determination and called it the &amp;quot;X chromosome&amp;quot;.&lt;br /&gt;
Ten years later, Clarence Erwin McClung saw that this chromosome behaved differently during the meiosis and was only present in half the sperm cells of grasshoppers. As the main characteristic that varies in 50/50 proportions among zygotes is the sex, McClung suspected the X chromosome to be implicated in sexual development. &lt;br /&gt;
In 1905, Nettie Stevens discovered the &amp;quot;Y chromosome&amp;quot; (and the female XX and male XY patterns) while she was counting the chromosomes of beetles under the microscope&amp;lt;ref&amp;gt;Sumner, A. T. Sex Chromosomes and Sex Determination. Chromosomes: Organization and Function, 97-108. [http://www.nature.com/scitable/nated/topicpage/Sex-Chromosomes-and-Sex-Determination-44565]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
During the next decades, a few theories were in competition. In 1921, Calvin Bridges&#039;s works on &#039;&#039;Drosophila melanogaster&#039;&#039; seemed to reveal that male characters acquisition is due to a genic balance between the genes contained in the X chromosome and those contained in the autosomes&amp;lt;ref&amp;gt;PMID: 17769897&amp;lt;/ref&amp;gt;.&lt;br /&gt;
In 1930, Ronald Fisher introduced the first Y-based control of sex theory by proposing two different models : either all the genes responsible for the male characters are located on the Y chromosome or there is a Y-located gene which regulates the expression of genes elsewhere in the genome&amp;lt;ref&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt;.&lt;br /&gt;
As Alfred Jost had shown the testosterone produced by the testis is responsible for the entire male phenotype acquisition&amp;lt;ref&amp;gt;PMID: 4805859&amp;lt;/ref&amp;gt;, in 1988, Peter Neville Goodfellow proposed that there is a gene (&#039;&#039;TDF&#039;&#039; in human, &#039;&#039;Tdy&#039;&#039; in mice)  on the Y chromosome which drives the development of the testis.&amp;lt;ref&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt; In 1990, Goodfellow&#039;s hypothesis was validated with the discovery of &#039;&#039;Tdy&#039;&#039;&#039;s localisation. This gene&#039;s product (expressed during the male gonadal development) owns an amino-acid motif showing homology to other known or putative DNA-binding domains. &#039;&#039;Tdy&#039;&#039; is therefore a transcriptional factor&amp;lt;ref&amp;gt;PMID: 2374589&amp;lt;/ref&amp;gt;. The same year, the human &#039;&#039;SRY&#039;&#039; gene (accepted later as the &#039;&#039;TDF&#039;&#039;) was discovered&amp;lt;ref&amp;gt;PMID: 1695712&amp;lt;/ref&amp;gt;. &lt;br /&gt;
Three dimensional structure of the SRY protein was determined in 1995 using NMR spectroscopy&amp;lt;ref&amp;gt;PMID: 7774012&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==SRY gene==&lt;br /&gt;
&lt;br /&gt;
===Generality===&lt;br /&gt;
&lt;br /&gt;
The SRY gene encodes the SRY protein. The SRY protein is a transcriptional factor inducing the male phenotype in embryo. The SRY gene is located on the [https://en.wikipedia.org/wiki/Y_chromosome Y chromosom] in the short arm (p) 11.3 &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/gene/6736]&amp;lt;/ref&amp;gt;. This gene has only one exon containing the HMG domain (DNA-binding high-mobility group box domain). That&#039;s means that SRY mRNA does not have a alternative splicing, so there is one isoform of SRY protein.&amp;lt;ref&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;. Moreover,the human genome contains one copy of the SRY gene, whereas the mouse genome contains 6 copy of this gene. &amp;lt;ref&amp;gt; Sekido R, Lovell-Badge R. Genetic control of testis development. Sex Dev Genet Mol Biol Evol Endocrinol Embryol Pathol Sex Determ Differ. 2013;7(1-3):21–32 &amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Sequence of the SRY gene===&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:90%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
&amp;gt;gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/nuccore]&amp;lt;/ref&amp;gt;&lt;br /&gt;
TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT&lt;br /&gt;
TTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACA&lt;br /&gt;
&amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;ATG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;CAATCATATGCTTCTGCTATGTTAAGCGTATTCAACAGCGATGATTACAGTCCAGCTGTGCAAGAGAAT&lt;br /&gt;
ATTCCCGCTCTCCGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTAAGTATCAGTGTGAAA&lt;br /&gt;
CGGGAGAAAACAGTAAAGGCAACGTCCAGGATAGAGTGAAGCGACCCATGAACGCATTCATCGTGTGGTC&lt;br /&gt;
&#039;&#039;&#039;TCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCAGAGATCAGCAAGCAGCTG&lt;br /&gt;
&#039;&#039;&#039;GGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCATTCTTCCAGGAGGCACAGAAATTACAGG&lt;br /&gt;
&#039;&#039;&#039;CCATGCACAGAGAGAAATACCCGAATTATAAGTATCGA&#039;&#039;&#039;CCTCGTCGGAAGGCGAAGATGCTGCCGAAGAA&lt;br /&gt;
TTGCAGTTTGCTTCCCGCAGATCCCGCTTCGGTACTCTGCAGCGAAGTGCAACTGGACAACAGGTTGTAC&lt;br /&gt;
AGGGATGACTGTACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAACG&lt;br /&gt;
CAGCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTG&amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;TAG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;GACAATCGGGTAACATT&lt;br /&gt;
GGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCACTTT&lt;br /&gt;
CTTATGTTTAGTTTCAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCATTTCA&amp;lt;/small&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
(Legend : &amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Initiation codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt; ; &amp;lt;b&amp;gt;HMG sequence&amp;lt;/b&amp;gt; ;&amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Stop codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Regulation of the expression of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
In humans, the SRY promoter is found at −408 bp to −95 bp upstream of the ATG initiation codon. Moreover, the SRY gene has enhancers at -727 pb upstream of the ATG initiation codon. The linkage between regulatory proteins and this enhancers have the property to increase the production of SRY protein. These regulatory proteins could be: SF1 (steroidogenic factor 1), SP1  and WT 1 (Wilms tumor). &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
*SF1: this transcriptional factor belong to the family of nuclear hormone receptor and contains a zinc finger. The activation of this protein requires a ligand (hormone).&lt;br /&gt;
&lt;br /&gt;
*SP1: this transciprional factor is a ubiquitous protein binding in site containing rich-GC sequences and implicated in the transcription of many genes. Moreover, this protein contains a zinc finger.&lt;br /&gt;
&lt;br /&gt;
*WT1:this transcriptional factor transactives SRY gene, it contains a zinc finger. &amp;lt;ref&amp;gt;Larney C, Bailey TL, Koopman P. Switching on sex: transcriptional regulation of the testis-determining gene Sry. Dev Camb Engl. 2014 Jun;141(11):2195–205. &amp;lt;/ref&amp;gt; &lt;br /&gt;
&lt;br /&gt;
=== Role of the SRY gene ===&lt;br /&gt;
&lt;br /&gt;
The SRY protein is a transcription factor, which contains nuclear localization domains in N terminal and C terminal. An acetylation on these domains allows to export the protein SRY in the nucleus.  &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The SRY protein activates the SOX9 (SRY-box9) gene &amp;lt;ref&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;., this gene is found in the 17 chromosom in the long arm 24.3 &amp;lt;ref&amp;gt; NCBI [http://www.ncbi.nlm.nih.gov/gene/6662] &amp;lt;/ref&amp;gt; and is implicated in the stimulation of the differentiation of sertori cells. The activation of sox 9 are done with protein SRY and another transcriptional factor: SF1 (steroidogenic factor 1). These transcriptional factors are bind in an enhancers called: TESCO (testis-specific enhancer of Sox9 core element). The fixation of transcriptional factor in enhancer provokes a curvature of DNA (90°C) allowing a stabilisation of the elongation complex on the SOX9 promoter. The SOX 9 protein activates the gene AMH (anti-mullerian hormone)&amp;lt;ref&amp;gt;[http://www.ebi.ac.uk/interpro/entry/IPR006799?q=AMH] &amp;lt;/ref&amp;gt; allows the reduction of the channels of Müller in male. &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==Structure==&lt;br /&gt;
&lt;br /&gt;
===The SRY-HMG domain (HMG-Box)===&lt;br /&gt;
&#039;&#039;&#039;SRY-HMG&#039;&#039;&#039; stands for &#039;&#039;&#039;S&#039;&#039;&#039;ex determining &#039;&#039;&#039;R&#039;&#039;&#039;egion &#039;&#039;&#039;Y&#039;&#039;&#039; - &#039;&#039;&#039;H&#039;&#039;&#039;igh &#039;&#039;&#039;M&#039;&#039;&#039;obility &#039;&#039;&#039;G&#039;&#039;&#039;roup domain.&lt;br /&gt;
It is approximately 80 residues long. It mediates the binding of the protein to the minor groove of DNA. It is the most important part of the SRY protein. Not only because it enable  the protein to bind the DNA but because even a little mutation can cause an inactivation of the protein.&lt;br /&gt;
&lt;br /&gt;
It has a Twisted L shape meaning that it has a long (28Å) and a short (22Å) arm. The HMG Box is made of 3 helices, its N-term and C-term are irregular. The overall structure is stabilized by a hydrophobic core especially at the intersection of the 3 helices where 3 aromatics cycles meet, surrounnded by aliphatic aminoacids.&lt;br /&gt;
&lt;br /&gt;
The interaction between the HMG-Box and DNA is specific and stable. It permits the bend of DNA (?75°). It is mostly hydrophobic interaction. Only one molecule of water interface the Box and the DNA. the complex is stabilized by salt bridges between positive charged residues of the HMG domain and negative charged phosphates.&amp;lt;ref&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[Image:HHMG-bitmap.png|thumb|alt=Image bitmap|Linear structure of hHMG domain]]&lt;br /&gt;
&lt;br /&gt;
The binding of SRY to DNA is specific. The DNA target site is a DNA octamer :&lt;br /&gt;
&lt;br /&gt;
(5&#039;-dGCACAAAC)&lt;br /&gt;
(5&#039;-dGTTTGTGC)&lt;br /&gt;
&lt;br /&gt;
This sequenece is found in the promoters of genes expressed during the testicular development&lt;br /&gt;
The bend of DNA permits the recruitment of different proteins and the build of massives proteins-DNA complexes that could change the expression of different genes. It is the role of a transcription factor.&amp;lt;ref&amp;gt;PMID:11563911&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
Even if the most important function of the HMG box is its capacity of binding and bending DNA, it is also involved in DNA condensation, recombination and DNA repair.&lt;br /&gt;
&lt;br /&gt;
There are 2 kinds of protein that contain a HMG box&lt;br /&gt;
* HMG1 : It is expressed in few cell types. It is found in transcription factors that contain a single HMG box. The bind to a DNA sequence is specific.&lt;br /&gt;
* HMG2 : Are found in all cell types and are abundant in chromatin. This proteins can contain two or more HMG boxes that can nonspecifically bind DNA. &lt;br /&gt;
&lt;br /&gt;
===General structure of SRY===&lt;br /&gt;
The overall structure of SRY is organized aroud the HMG-box.&lt;br /&gt;
3 domains:&lt;br /&gt;
* N-term domain&lt;br /&gt;
* Central domain : DNA binding (HMG box)&lt;br /&gt;
* C-term domain&lt;br /&gt;
&lt;br /&gt;
== Function ==&lt;br /&gt;
&lt;br /&gt;
===Sex determining===&lt;br /&gt;
It acts like a sex determinator thanks to it transcriptionnal activity. It inhibits the developpement of female sex structure in th embryonnic individual.&lt;br /&gt;
&lt;br /&gt;
==Implication - Future for SRY ?==&lt;br /&gt;
&lt;br /&gt;
== Disease ==&lt;br /&gt;
&lt;br /&gt;
=== Swyer syndrome (AKA XY gonadal dysgenis) :===&lt;br /&gt;
&lt;br /&gt;
	If the TDF protein is not able to bind its targeted DNA sequences, the genes responsible for the testis development are not expressed. The patient owning this defective protein will then develop female characters, even though he has a XY karyotype. This phenomenon is known as the « Swyer Syndrome ». &lt;br /&gt;
Different causes can explain this « XY gonadal dysgenis », as it is also called. About thirty mutations (named [http://www.uniprot.org/uniprot/Q05066#sequences &amp;quot;SRXY1&amp;quot;]) in the SRY gene have been shown to drive this phenotype development. It can also be due to crossovers during a meiosis. If a Y chromosome portion carrying the SRY gene is recombined into a X chromosome, a sperm cell will get this abnormal Y chromosome. If it then fecundates, a XY karyotype without any SRY gene will be formed. &lt;br /&gt;
&lt;br /&gt;
=== De La Chapelle syndrome (AKA XX male syndrome) :===&lt;br /&gt;
&lt;br /&gt;
From the meiosis just described would also result an abnormal X chromosome, carrying the SRY gene. If the sperm cell owning this chromosome fecundates an ovule, the resulting newborn will have a XX karyotype but a male phenotype. This is called the « De La Chapelle syndrome ». In this case, the patient can either develop testis or both testis and ovarian tissues. As some epigenetic mechanisms can inactivate the X chromosome carrying SRY, this syndrome keeps most of the patients sterile.&amp;lt;ref&amp;gt;PMID: 4622299&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
== Relevance ==&lt;br /&gt;
&lt;br /&gt;
== Structural highlights ==&lt;br /&gt;
&lt;br /&gt;
This is a sample scene created with SAT to &amp;lt;scene name=&amp;quot;/12/3456/Sample/1&amp;quot;&amp;gt;color&amp;lt;/scene&amp;gt; by Group, and another to make &amp;lt;scene name=&amp;quot;/12/3456/Sample/2&amp;quot;&amp;gt;a transparent representation&amp;lt;/scene&amp;gt; of the protein. You can make your own scenes on SAT starting from scratch or loading and editing one of these sample scenes.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;/StructureSection&amp;gt;&lt;br /&gt;
== References ==&lt;br /&gt;
[http://ghr.nlm.nih.gov/gene/SRY Genetic Home reference]&lt;br /&gt;
&amp;lt;references/&amp;gt;&lt;/div&gt;</summary>
		<author><name>Fantin Mesny</name></author>
	</entry>
	<entry>
		<id>https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2525347</id>
		<title>Sandbox Reserved 1120</title>
		<link rel="alternate" type="text/html" href="https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2525347"/>
		<updated>2016-01-28T10:04:58Z</updated>

		<summary type="html">&lt;p&gt;Fantin Mesny: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{Sandbox_Reserved_ESBS_2015}}&amp;lt;!-- PLEASE ADD YOUR CONTENT BELOW HERE --&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==SRY protein (AKA TDF protein)==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;StructureSection load=&#039;1hry&#039; size=&#039;340&#039; side=&#039;right&#039; caption=&#039;The SRY protein linked to DNA&#039; scene=&#039;&#039;&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The SRY protein is a 204 residues long monomeric polypeptide. It is a &#039;&#039;&#039;transcriptionnal factor&#039;&#039;&#039;, It activates the &#039;&#039;&#039;M&#039;&#039;&#039;üllerian &#039;&#039;&#039;I&#039;&#039;&#039;nhibiting &#039;&#039;&#039;S&#039;&#039;&#039;ubstance (&#039;&#039;&#039;MIS&#039;&#039;&#039; gene).&lt;br /&gt;
It is encoded by the [[testis-determining sex gene]] and is itself involved in the sex determination in mammels by being responsible for the gonadogenesis thus the male sexual developement. It is the HMG-box that gives to the protein its ability to bind DNA by its minor groove. &amp;lt;ref&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Properties===&lt;br /&gt;
&lt;br /&gt;
&amp;lt;table style=&amp;quot;width:100%&amp;quot;;border: 3px solid #A0A0A0&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Molecular weight&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Gene&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Length&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;DNA target sequence&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Genes targeted&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Inhibitors&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;/table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==History==&lt;br /&gt;
&lt;br /&gt;
After centuries of unfounded theories mainly based on environmental factors, the first molecular theory concerning the sex determination appeared in 1891. At this time, the german biologist Hermann Henking was studying sperm formation in wasps. As a chromosome which was not present in all the wasps looked different from the others, he suspected it to play a role in sex determination and called it the &amp;quot;X chromosome&amp;quot;.&lt;br /&gt;
Ten years later, Clarence Erwin McClung saw that this chromosome behaved differently during the meiosis and was only present in half the sperm cells of grasshoppers. As the main characteristic that varies in 50/50 proportions among zygotes is the sex, McClung suspected the X chromosome to be implicated in sexual development. &lt;br /&gt;
In 1905, Nettie Stevens discovered the &amp;quot;Y chromosome&amp;quot; (and the female XX and male XY patterns) while she was counting the chromosomes of beetles under the microscope&amp;lt;ref&amp;gt;Sumner, A. T. Sex Chromosomes and Sex Determination. Chromosomes: Organization and Function, 97-108. [http://www.nature.com/scitable/nated/topicpage/Sex-Chromosomes-and-Sex-Determination-44565]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
During the next decades, a few theories were in competition. In 1921, Calvin Bridges&#039;s works on &#039;&#039;Drosophila melanogaster&#039;&#039; seemed to reveal that male characters acquisition is due to a genic balance between the genes contained in the X chromosome and those contained in the autosomes&amp;lt;ref&amp;gt;PMID: 17769897&amp;lt;/ref&amp;gt;.&lt;br /&gt;
In 1930, Ronald Fisher introduced the first Y-based control of sex theory by proposing two different models : either all the genes responsible for the male characters are located on the Y chromosome or there is a Y-located gene which regulates the expression of genes elsewhere in the genome&amp;lt;ref&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt;.&lt;br /&gt;
As Alfred Jost had shown the testosterone produced by the testis is responsible for the entire male phenotype acquisition&amp;lt;ref&amp;gt;PMID: 4805859&amp;lt;/ref&amp;gt;, in 1988, Peter Neville Goodfellow proposed that there is a gene (&#039;&#039;TDF&#039;&#039; in human, &#039;&#039;Tdy&#039;&#039; in mice)  on the Y chromosome which drives the development of the testis.&amp;lt;ref&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt; In 1990, Goodfellow&#039;s hypothesis was validated with the discovery of &#039;&#039;Tdy&#039;&#039;&#039;s localisation. This gene&#039;s product (expressed during the male gonadal development) owns an amino-acid motif showing homology to other known or putative DNA-binding domains. &#039;&#039;Tdy&#039;&#039; is therefore a transcriptional factor&amp;lt;ref&amp;gt;PMID: 2374589&amp;lt;/ref&amp;gt;. The same year, the human &#039;&#039;SRY&#039;&#039; gene (accepted later as the &#039;&#039;TDF&#039;&#039;) was discovered&amp;lt;ref&amp;gt;PMID: 1695712&amp;lt;/ref&amp;gt;. &lt;br /&gt;
Three dimensional structure of the SRY protein was determined in 1995 using NMR spectroscopy&amp;lt;ref&amp;gt;PMID: 7774012&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==SRY gene==&lt;br /&gt;
&lt;br /&gt;
===Generality===&lt;br /&gt;
&lt;br /&gt;
The SRY gene encodes the SRY protein. The SRY protein is a transcriptional factor inducing the male phenotype in embryo. The SRY gene is located on the [https://en.wikipedia.org/wiki/Y_chromosome Y chromosom] in the short arm (p) 11.3 &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/gene/6736]&amp;lt;/ref&amp;gt;. This gene has only one exon containing the HMG domain (DNA-binding high-mobility group box domain). That&#039;s means that SRY mRNA does not have a alternative splicing, so there is one isoform of SRY protein.&amp;lt;ref&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;. Moreover,the human genome contains one copy of the SRY gene, whereas the mouse genome contains 6 copy of this gene. &amp;lt;ref&amp;gt; Sekido R, Lovell-Badge R. Genetic control of testis development. Sex Dev Genet Mol Biol Evol Endocrinol Embryol Pathol Sex Determ Differ. 2013;7(1-3):21–32 &amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Sequence of the SRY gene===&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:90%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
&amp;gt;gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/nuccore]&amp;lt;/ref&amp;gt;&lt;br /&gt;
TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT&lt;br /&gt;
TTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACA&lt;br /&gt;
&amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;ATG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;CAATCATATGCTTCTGCTATGTTAAGCGTATTCAACAGCGATGATTACAGTCCAGCTGTGCAAGAGAAT&lt;br /&gt;
ATTCCCGCTCTCCGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTAAGTATCAGTGTGAAA&lt;br /&gt;
CGGGAGAAAACAGTAAAGGCAACGTCCAGGATAGAGTGAAGCGACCCATGAACGCATTCATCGTGTGGTC&lt;br /&gt;
&#039;&#039;&#039;TCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCAGAGATCAGCAAGCAGCTG&lt;br /&gt;
&#039;&#039;&#039;GGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCATTCTTCCAGGAGGCACAGAAATTACAGG&lt;br /&gt;
&#039;&#039;&#039;CCATGCACAGAGAGAAATACCCGAATTATAAGTATCGA&#039;&#039;&#039;CCTCGTCGGAAGGCGAAGATGCTGCCGAAGAA&lt;br /&gt;
TTGCAGTTTGCTTCCCGCAGATCCCGCTTCGGTACTCTGCAGCGAAGTGCAACTGGACAACAGGTTGTAC&lt;br /&gt;
AGGGATGACTGTACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAACG&lt;br /&gt;
CAGCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTG&amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;TAG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;GACAATCGGGTAACATT&lt;br /&gt;
GGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCACTTTCTTATGTTTAGTTTCAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCATTTCA&amp;lt;/small&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Initiation codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;b&amp;gt;HMG sequence&amp;lt;/b&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Stop codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;&amp;lt;/div&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Regulation of the expression of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
In humans, the SRY promoter is found at −408 bp to −95 bp upstream of the ATG initiation codon. Moreover, the SRY gene has enhancers at -727 pb upstream of the ATG initiation codon. The linkage between regulatory proteins and this enhancers have the property to increase the production of SRY protein. These regulatory proteins could be: SF1 (steroidogenic factor 1), SP1  and WT 1 (Wilms tumor). &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
*SF1: this transcriptional factor belong to the family of nuclear hormone receptor and contains a zinc finger. The activation of this protein requires a ligand (hormone).&lt;br /&gt;
&lt;br /&gt;
*SP1: this transciprional factor is a ubiquitous protein binding in site containing rich-GC sequences and implicated in the transcription of many genes. Moreover, this protein contains a zinc finger.&lt;br /&gt;
&lt;br /&gt;
*WT1:this transcriptional factor transactives SRY gene, it contains a zinc finger. &amp;lt;ref&amp;gt;Larney C, Bailey TL, Koopman P. Switching on sex: transcriptional regulation of the testis-determining gene Sry. Dev Camb Engl. 2014 Jun;141(11):2195–205. &amp;lt;/ref&amp;gt; &lt;br /&gt;
&lt;br /&gt;
=== Role of the SRY gene ===&lt;br /&gt;
&lt;br /&gt;
The SRY protein is a transcription factor, which contains nuclear localization domains in N terminal and C terminal. An acetylation on these domains allows to export the protein SRY in the nucleus.  &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The SRY protein activates the SOX9 (SRY-box9) gene &amp;lt;ref&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;., this gene is found in the 17 chromosom in the long arm 24.3 &amp;lt;ref&amp;gt; NCBI [http://www.ncbi.nlm.nih.gov/gene/6662] &amp;lt;/ref&amp;gt; and is implicated in the stimulation of the differentiation of sertori cells. The activation of sox 9 are done with protein SRY and another transcriptional factor: SF1 (steroidogenic factor 1). These transcriptional factors are bind in an enhancers called: TESCO (testis-specific enhancer of Sox9 core element). The fixation of transcriptional factor in enhancer provokes a curvature of DNA (90°C) allowing a stabilisation of the elongation complex on the SOX9 promoter. The SOX 9 protein activates the gene AMH (anti-mullerian hormone)&amp;lt;ref&amp;gt;[http://www.ebi.ac.uk/interpro/entry/IPR006799?q=AMH] &amp;lt;/ref&amp;gt; allows the reduction of the channels of Müller in male. &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==Structure==&lt;br /&gt;
&lt;br /&gt;
===The SRY-HMG domain (HMG-Box)===&lt;br /&gt;
&#039;&#039;&#039;SRY-HMG&#039;&#039;&#039; stands for &#039;&#039;&#039;S&#039;&#039;&#039;ex determining &#039;&#039;&#039;R&#039;&#039;&#039;egion &#039;&#039;&#039;Y&#039;&#039;&#039; - &#039;&#039;&#039;H&#039;&#039;&#039;igh &#039;&#039;&#039;M&#039;&#039;&#039;obility &#039;&#039;&#039;G&#039;&#039;&#039;roup domain.&lt;br /&gt;
It is approximately 80 residues long. It mediates the binding of the protein to the minor groove of DNA. It is the most important part of the SRY protein. Not only because it enable  the protein to bind the DNA but because even a little mutation can cause an inactivation of the protein.&lt;br /&gt;
&lt;br /&gt;
It has a Twisted L shape meaning that it has a long (28Å) and a short (22Å) arm. The HMG Box is made of 3 helices, its N-term and C-term are irregular. The overall structure is stabilized by a hydrophobic core especially at the intersection of the 3 helices where 3 aromatics cycles meet, surrounnded by aliphatic aminoacids.&lt;br /&gt;
&lt;br /&gt;
The interaction between the HMG-Box and DNA is specific and stable. It permits the bend of DNA (?75°). It is mostly hydrophobic interaction. Only one molecule of water interface the Box and the DNA. the complex is stabilized by salt bridges between positive charged residues of the HMG domain and negative charged phosphates.&amp;lt;ref&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[Image:HHMG-bitmap.png|thumb|alt=Image bitmap|Linear structure of hHMG domain]]&lt;br /&gt;
&lt;br /&gt;
The binding of SRY to DNA is specific. The DNA target site is a DNA octamer :&lt;br /&gt;
&lt;br /&gt;
(5&#039;-dGCACAAAC)&lt;br /&gt;
(5&#039;-dGTTTGTGC)&lt;br /&gt;
&lt;br /&gt;
This sequenece is found in the promoters of genes expressed during the testicular development&lt;br /&gt;
The bend of DNA permits the recruitment of different proteins and the build of massives proteins-DNA complexes that could change the expression of different genes. It is the role of a transcription factor.&amp;lt;ref&amp;gt;PMID:11563911&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
Even if the most important function of the HMG box is its capacity of binding and bending DNA, it is also involved in DNA condensation, recombination and DNA repair.&lt;br /&gt;
&lt;br /&gt;
There are 2 kinds of protein that contain a HMG box&lt;br /&gt;
* HMG1 : It is expressed in few cell types. It is found in transcription factors that contain a single HMG box. The bind to a DNA sequence is specific.&lt;br /&gt;
* HMG2 : Are found in all cell types and are abundant in chromatin. This proteins can contain two or more HMG boxes that can nonspecifically bind DNA. &lt;br /&gt;
&lt;br /&gt;
===General structure of SRY===&lt;br /&gt;
The overall structure of SRY is organized aroud the HMG-box.&lt;br /&gt;
3 domains:&lt;br /&gt;
* N-term domain&lt;br /&gt;
* Central domain : DNA binding (HMG box)&lt;br /&gt;
* C-term domain&lt;br /&gt;
&lt;br /&gt;
== Function ==&lt;br /&gt;
&lt;br /&gt;
===Sex determining===&lt;br /&gt;
It acts like a sex determinator thanks to it transcriptionnal activity. It inhibits the developpement of female sex structure in th embryonnic individual.&lt;br /&gt;
&lt;br /&gt;
==Implication - Future for SRY ?==&lt;br /&gt;
&lt;br /&gt;
== Disease ==&lt;br /&gt;
&lt;br /&gt;
=== Swyer syndrome (AKA XY gonadal dysgenis) :===&lt;br /&gt;
&lt;br /&gt;
	If the TDF protein is not able to bind its targeted DNA sequences, the genes responsible for the testis development are not expressed. The patient owning this defective protein will then develop female characters, even though he has a XY karyotype. This phenomenon is known as the « Swyer Syndrome ». &lt;br /&gt;
Different causes can explain this « XY gonadal dysgenis », as it is also called. About thirty mutations (named [http://www.uniprot.org/uniprot/Q05066#sequences &amp;quot;SRXY1&amp;quot;]) in the SRY gene have been shown to drive this phenotype development. It can also be due to crossovers during a meiosis. If a Y chromosome portion carrying the SRY gene is recombined into a X chromosome, a sperm cell will get this abnormal Y chromosome. If it then fecundates, a XY karyotype without any SRY gene will be formed. &lt;br /&gt;
&lt;br /&gt;
=== De La Chapelle syndrome (AKA XX male syndrome) :===&lt;br /&gt;
&lt;br /&gt;
From the meiosis just described would also result an abnormal X chromosome, carrying the SRY gene. If the sperm cell owning this chromosome fecundates an ovule, the resulting newborn will have a XX karyotype but a male phenotype. This is called the « De La Chapelle syndrome ». In this case, the patient can either develop testis or both testis and ovarian tissues. As some epigenetic mechanisms can inactivate the X chromosome carrying SRY, this syndrome keeps most of the patients sterile.&amp;lt;ref&amp;gt;PMID: 4622299&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
== Relevance ==&lt;br /&gt;
&lt;br /&gt;
== Structural highlights ==&lt;br /&gt;
&lt;br /&gt;
This is a sample scene created with SAT to &amp;lt;scene name=&amp;quot;/12/3456/Sample/1&amp;quot;&amp;gt;color&amp;lt;/scene&amp;gt; by Group, and another to make &amp;lt;scene name=&amp;quot;/12/3456/Sample/2&amp;quot;&amp;gt;a transparent representation&amp;lt;/scene&amp;gt; of the protein. You can make your own scenes on SAT starting from scratch or loading and editing one of these sample scenes.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;/StructureSection&amp;gt;&lt;br /&gt;
== References ==&lt;br /&gt;
[http://ghr.nlm.nih.gov/gene/SRY Genetic Home reference]&lt;br /&gt;
&amp;lt;references/&amp;gt;&lt;/div&gt;</summary>
		<author><name>Fantin Mesny</name></author>
	</entry>
	<entry>
		<id>https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2525344</id>
		<title>Sandbox Reserved 1120</title>
		<link rel="alternate" type="text/html" href="https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2525344"/>
		<updated>2016-01-28T10:01:10Z</updated>

		<summary type="html">&lt;p&gt;Fantin Mesny: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{Sandbox_Reserved_ESBS_2015}}&amp;lt;!-- PLEASE ADD YOUR CONTENT BELOW HERE --&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==SRY protein (AKA TDF protein)==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;StructureSection load=&#039;1hry&#039; size=&#039;340&#039; side=&#039;right&#039; caption=&#039;The SRY protein linked to DNA&#039; scene=&#039;&#039;&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The SRY protein is a 204 residues long monomeric polypeptide. It is a &#039;&#039;&#039;transcriptionnal factor&#039;&#039;&#039;, It activates the &#039;&#039;&#039;M&#039;&#039;&#039;üllerian &#039;&#039;&#039;I&#039;&#039;&#039;nhibiting &#039;&#039;&#039;S&#039;&#039;&#039;ubstance (&#039;&#039;&#039;MIS&#039;&#039;&#039; gene).&lt;br /&gt;
It is encoded by the [[testis-determining sex gene]] and is itself involved in the sex determination in mammels by being responsible for the gonadogenesis thus the male sexual developement. It is the HMG-box that gives to the protein its ability to bind DNA by its minor groove. &amp;lt;ref&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Properties===&lt;br /&gt;
&lt;br /&gt;
&amp;lt;table style=&amp;quot;width:100%&amp;quot;;border: 3px solid #A0A0A0&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Molecular weight&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Gene&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Length&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;DNA target sequence&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Genes targeted&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Inhibitors&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;/table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==History==&lt;br /&gt;
&lt;br /&gt;
After centuries of unfounded theories mainly based on environmental factors, the first molecular theory concerning the sex determination appeared in 1891. At this time, the german biologist Hermann Henking was studying sperm formation in wasps. As a chromosome which was not present in all the wasps looked different from the others, he suspected it to play a role in sex determination and called it the &amp;quot;X chromosome&amp;quot;.&lt;br /&gt;
Ten years later, Clarence Erwin McClung saw that this chromosome behaved differently during the meiosis and was only present in half the sperm cells of grasshoppers. As the main characteristic that varies in 50/50 proportions among zygotes is the sex, McClung suspected the X chromosome to be implicated in sexual development. &lt;br /&gt;
In 1905, Nettie Stevens discovered the &amp;quot;Y chromosome&amp;quot; (and the female XX and male XY patterns) while she was counting the chromosomes of beetles under the microscope&amp;lt;ref&amp;gt;Sumner, A. T. Sex Chromosomes and Sex Determination. Chromosomes: Organization and Function, 97-108. [http://www.nature.com/scitable/nated/topicpage/Sex-Chromosomes-and-Sex-Determination-44565]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
During the next decades, a few theories were in competition. In 1921, Calvin Bridges&#039;s works on &#039;&#039;Drosophila melanogaster&#039;&#039; seemed to reveal that male characters acquisition is due to a genic balance between the genes contained in the X chromosome and those contained in the autosomes&amp;lt;ref&amp;gt;PMID: 17769897&amp;lt;/ref&amp;gt;.&lt;br /&gt;
In 1930, Ronald Fisher introduced the first Y-based control of sex theory by proposing two different models : either all the genes responsible for the male characters are located on the Y chromosome or there is a Y-located gene which regulates the expression of genes elsewhere in the genome&amp;lt;ref&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt;.&lt;br /&gt;
As Alfred Jost had shown the testosterone produced by the testis is responsible for the entire male phenotype acquisition&amp;lt;ref&amp;gt;PMID: 4805859&amp;lt;/ref&amp;gt;, in 1988, Peter Neville Goodfellow proposed that there is a gene (&#039;&#039;TDF&#039;&#039; in human, &#039;&#039;Tdy&#039;&#039; in mice)  on the Y chromosome which drives the development of the testis.&amp;lt;ref&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt; In 1990, Goodfellow&#039;s hypothesis was validated with the discovery of &#039;&#039;Tdy&#039;&#039;&#039;s localisation. This gene&#039;s product (expressed during the male gonadal development) owns an amino-acid motif showing homology to other known or putative DNA-binding domains. &#039;&#039;Tdy&#039;&#039; is therefore a transcriptional factor&amp;lt;ref&amp;gt;PMID: 2374589&amp;lt;/ref&amp;gt;. The same year, the human &#039;&#039;SRY&#039;&#039; gene (accepted later as the &#039;&#039;TDF&#039;&#039;) was discovered&amp;lt;ref&amp;gt;PMID: 1695712&amp;lt;/ref&amp;gt;. &lt;br /&gt;
Three dimensional structure of the SRY protein was determined in 1995 using NMR spectroscopy&amp;lt;ref&amp;gt;PMID: 7774012&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==SRY gene==&lt;br /&gt;
&lt;br /&gt;
===Generality===&lt;br /&gt;
&lt;br /&gt;
The SRY gene encodes the SRY protein. The SRY protein is a transcriptional factor inducing the male phenotype in embryo. The SRY gene is located on the [https://en.wikipedia.org/wiki/Y_chromosome Y chromosom] in the short arm (p) 11.3 &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/gene/6736]&amp;lt;/ref&amp;gt;. This gene has only one exon containing the HMG domain (DNA-binding high-mobility group box domain). That&#039;s means that SRY mRNA does not have a alternative splicing, so there is one isoform of SRY protein.&amp;lt;ref&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;. Moreover,the human genome contains one copy of the SRY gene, whereas the mouse genome contains 6 copy of this gene. &amp;lt;ref&amp;gt; Sekido R, Lovell-Badge R. Genetic control of testis development. Sex Dev Genet Mol Biol Evol Endocrinol Embryol Pathol Sex Determ Differ. 2013;7(1-3):21–32 &amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Sequence of the SRY gene===&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:90%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
&amp;gt;gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/nuccore]&amp;lt;/ref&amp;gt;&lt;br /&gt;
TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT&lt;br /&gt;
TTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACA&lt;br /&gt;
&amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;ATG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;CAATCATATGCTTCTGCTATGTTAAGCGTATTCAACAGCGATGATTACAGTCCAGCTGTGCAAGAGAAT&lt;br /&gt;
ATTCCCGCTCTCCGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTAAGTATCAGTGTGAAA&lt;br /&gt;
CGGGAGAAAACAGTAAAGGCAACGTCCAGGATAGAGTGAAGCGACCCATGAACGCATTCATCGTGTGGTC&lt;br /&gt;
&#039;&#039;&#039;TCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCAGAGATCAGCAAGCAGCTG&lt;br /&gt;
&#039;&#039;&#039;GGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCATTCTTCCAGGAGGCACAGAAATTACAGG&lt;br /&gt;
&#039;&#039;&#039;CCATGCACAGAGAGAAATACCCGAATTATAAGTATCGA&#039;&#039;&#039;CCTCGTCGGAAGGCGAAGATGCTGCCGAAGAA&lt;br /&gt;
TTGCAGTTTGCTTCCCGCAGATCCCGCTTCGGTACTCTGCAGCGAAGTGCAACTGGACAACAGGTTGTAC&lt;br /&gt;
AGGGATGACTGTACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAACG&lt;br /&gt;
CAGCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTG&amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;TAG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;GACAATCGGGTAACATT&lt;br /&gt;
GGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCACTTTCTTATGTTTAGTTT&lt;br /&gt;
CAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCATTTCA&amp;lt;/small&amp;gt;&amp;lt;/div&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;&#039;legend of bold &#039;&#039;&#039;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Initiation codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;b&amp;gt;HMG sequence&amp;lt;/b&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;Stop codon&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Regulation of the expression of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
In humans, the SRY promoter is found at −408 bp to −95 bp upstream of the ATG initiation codon. Moreover, the SRY gene has enhancers at -727 pb upstream of the ATG initiation codon. The linkage between regulatory proteins and this enhancers have the property to increase the production of SRY protein. These regulatory proteins could be: SF1 (steroidogenic factor 1), SP1  and WT 1 (Wilms tumor). &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
*SF1: this transcriptional factor belong to the family of nuclear hormone receptor and contains a zinc finger. The activation of this protein requires a ligand (hormone).&lt;br /&gt;
&lt;br /&gt;
*SP1: this transciprional factor is a ubiquitous protein binding in site containing rich-GC sequences and implicated in the transcription of many genes. Moreover, this protein contains a zinc finger.&lt;br /&gt;
&lt;br /&gt;
*WT1:this transcriptional factor transactives SRY gene, it contains a zinc finger. &amp;lt;ref&amp;gt;Larney C, Bailey TL, Koopman P. Switching on sex: transcriptional regulation of the testis-determining gene Sry. Dev Camb Engl. 2014 Jun;141(11):2195–205. &amp;lt;/ref&amp;gt; &lt;br /&gt;
&lt;br /&gt;
=== Role of the SRY gene ===&lt;br /&gt;
&lt;br /&gt;
The SRY protein is a transcription factor, which contains nuclear localization domains in N terminal and C terminal. An acetylation on these domains allows to export the protein SRY in the nucleus.  &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The SRY protein activates the SOX9 (SRY-box9) gene &amp;lt;ref&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;., this gene is found in the 17 chromosom in the long arm 24.3 &amp;lt;ref&amp;gt; NCBI [http://www.ncbi.nlm.nih.gov/gene/6662] &amp;lt;/ref&amp;gt; and is implicated in the stimulation of the differentiation of sertori cells. The activation of sox 9 are done with protein SRY and another transcriptional factor: SF1 (steroidogenic factor 1). These transcriptional factors are bind in an enhancers called: TESCO (testis-specific enhancer of Sox9 core element). The fixation of transcriptional factor in enhancer provokes a curvature of DNA (90°C) allowing a stabilisation of the elongation complex on the SOX9 promoter. The SOX 9 protein activates the gene AMH (anti-mullerian hormone)&amp;lt;ref&amp;gt;[http://www.ebi.ac.uk/interpro/entry/IPR006799?q=AMH] &amp;lt;/ref&amp;gt; allows the reduction of the channels of Müller in male. &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==Structure==&lt;br /&gt;
&lt;br /&gt;
===The SRY-HMG domain (HMG-Box)===&lt;br /&gt;
&#039;&#039;&#039;SRY-HMG&#039;&#039;&#039; stands for &#039;&#039;&#039;S&#039;&#039;&#039;ex determining &#039;&#039;&#039;R&#039;&#039;&#039;egion &#039;&#039;&#039;Y&#039;&#039;&#039; - &#039;&#039;&#039;H&#039;&#039;&#039;igh &#039;&#039;&#039;M&#039;&#039;&#039;obility &#039;&#039;&#039;G&#039;&#039;&#039;roup domain.&lt;br /&gt;
It is approximately 80 residues long. It mediates the binding of the protein to the minor groove of DNA. It is the most important part of the SRY protein. Not only because it enable  the protein to bind the DNA but because even a little mutation can cause an inactivation of the protein.&lt;br /&gt;
&lt;br /&gt;
It has a Twisted L shape meaning that it has a long (28Å) and a short (22Å) arm. The HMG Box is made of 3 helices, its N-term and C-term are irregular. The overall structure is stabilized by a hydrophobic core especially at the intersection of the 3 helices where 3 aromatics cycles meet, surrounnded by aliphatic aminoacids.&lt;br /&gt;
&lt;br /&gt;
The interaction between the HMG-Box and DNA is specific and stable. It permits the bend of DNA (?75°). It is mostly hydrophobic interaction. Only one molecule of water interface the Box and the DNA. the complex is stabilized by salt bridges between positive charged residues of the HMG domain and negative charged phosphates.&amp;lt;ref&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[Image:HHMG-bitmap.png|thumb|alt=Image bitmap|Linear structure of hHMG domain]]&lt;br /&gt;
&lt;br /&gt;
The binding of SRY to DNA is specific. The DNA target site is a DNA octamer :&lt;br /&gt;
&lt;br /&gt;
(5&#039;-dGCACAAAC)&lt;br /&gt;
(5&#039;-dGTTTGTGC)&lt;br /&gt;
&lt;br /&gt;
This sequenece is found in the promoters of genes expressed during the testicular development&lt;br /&gt;
The bend of DNA permits the recruitment of different proteins and the build of massives proteins-DNA complexes that could change the expression of different genes. It is the role of a transcription factor.&amp;lt;ref&amp;gt;PMID:11563911&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
Even if the most important function of the HMG box is its capacity of binding and bending DNA, it is also involved in DNA condensation, recombination and DNA repair.&lt;br /&gt;
&lt;br /&gt;
There are 2 kinds of protein that contain a HMG box&lt;br /&gt;
* HMG1 : It is expressed in few cell types. It is found in transcription factors that contain a single HMG box. The bind to a DNA sequence is specific.&lt;br /&gt;
* HMG2 : Are found in all cell types and are abundant in chromatin. This proteins can contain two or more HMG boxes that can nonspecifically bind DNA. &lt;br /&gt;
&lt;br /&gt;
===General structure of SRY===&lt;br /&gt;
The overall structure of SRY is organized aroud the HMG-box.&lt;br /&gt;
3 domains:&lt;br /&gt;
* N-term domain&lt;br /&gt;
* Central domain : DNA binding (HMG box)&lt;br /&gt;
* C-term domain&lt;br /&gt;
&lt;br /&gt;
== Function ==&lt;br /&gt;
&lt;br /&gt;
===Sex determining===&lt;br /&gt;
It acts like a sex determinator thanks to it transcriptionnal activity. It inhibits the developpement of female sex structure in th embryonnic individual.&lt;br /&gt;
&lt;br /&gt;
==Implication - Future for SRY ?==&lt;br /&gt;
&lt;br /&gt;
== Disease ==&lt;br /&gt;
&lt;br /&gt;
=== Swyer syndrome (AKA XY gonadal dysgenis) :===&lt;br /&gt;
&lt;br /&gt;
	If the TDF protein is not able to bind its targeted DNA sequences, the genes responsible for the testis development are not expressed. The patient owning this defective protein will then develop female characters, even though he has a XY karyotype. This phenomenon is known as the « Swyer Syndrome ». &lt;br /&gt;
Different causes can explain this « XY gonadal dysgenis », as it is also called. About thirty mutations (named [http://www.uniprot.org/uniprot/Q05066#sequences &amp;quot;SRXY1&amp;quot;]) in the SRY gene have been shown to drive this phenotype development. It can also be due to crossovers during a meiosis. If a Y chromosome portion carrying the SRY gene is recombined into a X chromosome, a sperm cell will get this abnormal Y chromosome. If it then fecundates, a XY karyotype without any SRY gene will be formed. &lt;br /&gt;
&lt;br /&gt;
=== De La Chapelle syndrome (AKA XX male syndrome) :===&lt;br /&gt;
&lt;br /&gt;
From the meiosis just described would also result an abnormal X chromosome, carrying the SRY gene. If the sperm cell owning this chromosome fecundates an ovule, the resulting newborn will have a XX karyotype but a male phenotype. This is called the « De La Chapelle syndrome ». In this case, the patient can either develop testis or both testis and ovarian tissues. As some epigenetic mechanisms can inactivate the X chromosome carrying SRY, this syndrome keeps most of the patients sterile.&amp;lt;ref&amp;gt;PMID: 4622299&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
== Relevance ==&lt;br /&gt;
&lt;br /&gt;
== Structural highlights ==&lt;br /&gt;
&lt;br /&gt;
This is a sample scene created with SAT to &amp;lt;scene name=&amp;quot;/12/3456/Sample/1&amp;quot;&amp;gt;color&amp;lt;/scene&amp;gt; by Group, and another to make &amp;lt;scene name=&amp;quot;/12/3456/Sample/2&amp;quot;&amp;gt;a transparent representation&amp;lt;/scene&amp;gt; of the protein. You can make your own scenes on SAT starting from scratch or loading and editing one of these sample scenes.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;/StructureSection&amp;gt;&lt;br /&gt;
== References ==&lt;br /&gt;
[http://ghr.nlm.nih.gov/gene/SRY Genetic Home reference]&lt;br /&gt;
&amp;lt;references/&amp;gt;&lt;/div&gt;</summary>
		<author><name>Fantin Mesny</name></author>
	</entry>
	<entry>
		<id>https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2525343</id>
		<title>Sandbox Reserved 1120</title>
		<link rel="alternate" type="text/html" href="https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2525343"/>
		<updated>2016-01-28T09:57:20Z</updated>

		<summary type="html">&lt;p&gt;Fantin Mesny: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{Sandbox_Reserved_ESBS_2015}}&amp;lt;!-- PLEASE ADD YOUR CONTENT BELOW HERE --&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==SRY protein (AKA TDF protein)==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;StructureSection load=&#039;1hry&#039; size=&#039;340&#039; side=&#039;right&#039; caption=&#039;The SRY protein linked to DNA&#039; scene=&#039;&#039;&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The SRY protein is a 204 residues long monomeric polypeptide. It is a &#039;&#039;&#039;transcriptionnal factor&#039;&#039;&#039;, It activates the &#039;&#039;&#039;M&#039;&#039;&#039;üllerian &#039;&#039;&#039;I&#039;&#039;&#039;nhibiting &#039;&#039;&#039;S&#039;&#039;&#039;ubstance (&#039;&#039;&#039;MIS&#039;&#039;&#039; gene).&lt;br /&gt;
It is encoded by the [[testis-determining sex gene]] and is itself involved in the sex determination in mammels by being responsible for the gonadogenesis thus the male sexual developement. It is the HMG-box that gives to the protein its ability to bind DNA by its minor groove. &amp;lt;ref&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Properties===&lt;br /&gt;
&lt;br /&gt;
&amp;lt;table style=&amp;quot;width:100%&amp;quot;;border: 3px solid #A0A0A0&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Molecular weight&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Gene&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Length&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;DNA target sequence&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Genes targeted&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Inhibitors&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;/table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==History==&lt;br /&gt;
&lt;br /&gt;
After centuries of unfounded theories mainly based on environmental factors, the first molecular theory concerning the sex determination appeared in 1891. At this time, the german biologist Hermann Henking was studying sperm formation in wasps. As a chromosome which was not present in all the wasps looked different from the others, he suspected it to play a role in sex determination and called it the &amp;quot;X chromosome&amp;quot;.&lt;br /&gt;
Ten years later, Clarence Erwin McClung saw that this chromosome behaved differently during the meiosis and was only present in half the sperm cells of grasshoppers. As the main characteristic that varies in 50/50 proportions among zygotes is the sex, McClung suspected the X chromosome to be implicated in sexual development. &lt;br /&gt;
In 1905, Nettie Stevens discovered the &amp;quot;Y chromosome&amp;quot; (and the female XX and male XY patterns) while she was counting the chromosomes of beetles under the microscope&amp;lt;ref&amp;gt;Sumner, A. T. Sex Chromosomes and Sex Determination. Chromosomes: Organization and Function, 97-108. [http://www.nature.com/scitable/nated/topicpage/Sex-Chromosomes-and-Sex-Determination-44565]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
During the next decades, a few theories were in competition. In 1921, Calvin Bridges&#039;s works on &#039;&#039;Drosophila melanogaster&#039;&#039; seemed to reveal that male characters acquisition is due to a genic balance between the genes contained in the X chromosome and those contained in the autosomes&amp;lt;ref&amp;gt;PMID: 17769897&amp;lt;/ref&amp;gt;.&lt;br /&gt;
In 1930, Ronald Fisher introduced the first Y-based control of sex theory by proposing two different models : either all the genes responsible for the male characters are located on the Y chromosome or there is a Y-located gene which regulates the expression of genes elsewhere in the genome&amp;lt;ref&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt;.&lt;br /&gt;
As Alfred Jost had shown the testosterone produced by the testis is responsible for the entire male phenotype acquisition&amp;lt;ref&amp;gt;PMID: 4805859&amp;lt;/ref&amp;gt;, in 1988, Peter Neville Goodfellow proposed that there is a gene (&#039;&#039;TDF&#039;&#039; in human, &#039;&#039;Tdy&#039;&#039; in mice)  on the Y chromosome which drives the development of the testis.&amp;lt;ref&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt; In 1990, Goodfellow&#039;s hypothesis was validated with the discovery of &#039;&#039;Tdy&#039;&#039;&#039;s localisation. This gene&#039;s product (expressed during the male gonadal development) owns an amino-acid motif showing homology to other known or putative DNA-binding domains. &#039;&#039;Tdy&#039;&#039; is therefore a transcriptional factor&amp;lt;ref&amp;gt;PMID: 2374589&amp;lt;/ref&amp;gt;. The same year, the human &#039;&#039;SRY&#039;&#039; gene (accepted later as the &#039;&#039;TDF&#039;&#039;) was discovered&amp;lt;ref&amp;gt;PMID: 1695712&amp;lt;/ref&amp;gt;. &lt;br /&gt;
Three dimensional structure of the SRY protein was determined in 1995 using NMR spectroscopy&amp;lt;ref&amp;gt;PMID: 7774012&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==SRY gene==&lt;br /&gt;
&lt;br /&gt;
===Generality===&lt;br /&gt;
&lt;br /&gt;
The SRY gene encodes the SRY protein. The SRY protein is a transcriptional factor inducing the male phenotype in embryo. The SRY gene is located on the [https://en.wikipedia.org/wiki/Y_chromosome Y chromosom] in the short arm (p) 11.3 &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/gene/6736]&amp;lt;/ref&amp;gt;. This gene has only one exon containing the HMG domain (DNA-binding high-mobility group box domain). That&#039;s means that SRY mRNA does not have a alternative splicing, so there is one isoform of SRY protein.&amp;lt;ref&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;. Moreover,the human genome contains one copy of the SRY gene, whereas the mouse genome contains 6 copy of this gene. &amp;lt;ref&amp;gt; Sekido R, Lovell-Badge R. Genetic control of testis development. Sex Dev Genet Mol Biol Evol Endocrinol Embryol Pathol Sex Determ Differ. 2013;7(1-3):21–32 &amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Sequence of the SRY gene===&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:90%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #ABE8C9;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
&amp;gt;gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/nuccore]&amp;lt;/ref&amp;gt;&lt;br /&gt;
TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT&lt;br /&gt;
TTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACA&lt;br /&gt;
&amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;ATG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;CAATCATATGCTTCTGCTATGTTAAGCGTATTCAACAGCGATGATTACAGTCCAGCTGTGCAAGAGAAT&lt;br /&gt;
ATTCCCGCTCTCCGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTAAGTATCAGTGTGAAA&lt;br /&gt;
CGGGAGAAAACAGTAAAGGCAACGTCCAGGATAGAGTGAAGCGACCCATGAACGCATTCATCGTGTGGTC&lt;br /&gt;
&#039;&#039;&#039;TCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCAGAGATCAGCAAGCAGCTG&lt;br /&gt;
&#039;&#039;&#039;GGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCATTCTTCCAGGAGGCACAGAAATTACAGG&lt;br /&gt;
&#039;&#039;&#039;CCATGCACAGAGAGAAATACCCGAATTATAAGTATCGA&#039;&#039;&#039;CCTCGTCGGAAGGCGAAGATGCTGCCGAAGAA&lt;br /&gt;
TTGCAGTTTGCTTCCCGCAGATCCCGCTTCGGTACTCTGCAGCGAAGTGCAACTGGACAACAGGTTGTAC&lt;br /&gt;
AGGGATGACTGTACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAACG&lt;br /&gt;
CAGCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTG&amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;TAG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;GACAATCGGGTAACATT&lt;br /&gt;
GGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCACTTTCTTATGTTTAGTTT&lt;br /&gt;
CAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCATTTCA&amp;lt;/small&amp;gt;&amp;lt;/div&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;&#039;legend of bold &#039;&#039;&#039;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;Initiation codon&amp;lt;/FONT&amp;gt;&lt;br /&gt;
&lt;br /&gt;
second: HMG sequence&lt;br /&gt;
&lt;br /&gt;
third: stop codon&lt;br /&gt;
&lt;br /&gt;
===Regulation of the expression of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
In humans, the SRY promoter is found at −408 bp to −95 bp upstream of the ATG initiation codon. Moreover, the SRY gene has enhancers at -727 pb upstream of the ATG initiation codon. The linkage between regulatory proteins and this enhancers have the property to increase the production of SRY protein. These regulatory proteins could be: SF1 (steroidogenic factor 1), SP1  and WT 1 (Wilms tumor). &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
*SF1: this transcriptional factor belong to the family of nuclear hormone receptor and contains a zinc finger. The activation of this protein requires a ligand (hormone).&lt;br /&gt;
&lt;br /&gt;
*SP1: this transciprional factor is a ubiquitous protein binding in site containing rich-GC sequences and implicated in the transcription of many genes. Moreover, this protein contains a zinc finger.&lt;br /&gt;
&lt;br /&gt;
*WT1:this transcriptional factor transactives SRY gene, it contains a zinc finger. &amp;lt;ref&amp;gt;Larney C, Bailey TL, Koopman P. Switching on sex: transcriptional regulation of the testis-determining gene Sry. Dev Camb Engl. 2014 Jun;141(11):2195–205. &amp;lt;/ref&amp;gt; &lt;br /&gt;
&lt;br /&gt;
=== Role of the SRY gene ===&lt;br /&gt;
&lt;br /&gt;
The SRY protein is a transcription factor, which contains nuclear localization domains in N terminal and C terminal. An acetylation on these domains allows to export the protein SRY in the nucleus.  &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The SRY protein activates the SOX9 (SRY-box9) gene &amp;lt;ref&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;., this gene is found in the 17 chromosom in the long arm 24.3 &amp;lt;ref&amp;gt; NCBI [http://www.ncbi.nlm.nih.gov/gene/6662] &amp;lt;/ref&amp;gt; and is implicated in the stimulation of the differentiation of sertori cells. The activation of sox 9 are done with protein SRY and another transcriptional factor: SF1 (steroidogenic factor 1). These transcriptional factors are bind in an enhancers called: TESCO (testis-specific enhancer of Sox9 core element). The fixation of transcriptional factor in enhancer provokes a curvature of DNA (90°C) allowing a stabilisation of the elongation complex on the SOX9 promoter. The SOX 9 protein activates the gene AMH (anti-mullerian hormone)&amp;lt;ref&amp;gt;[http://www.ebi.ac.uk/interpro/entry/IPR006799?q=AMH] &amp;lt;/ref&amp;gt; allows the reduction of the channels of Müller in male. &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==Structure==&lt;br /&gt;
&lt;br /&gt;
===The SRY-HMG domain (HMG-Box)===&lt;br /&gt;
&#039;&#039;&#039;SRY-HMG&#039;&#039;&#039; stands for &#039;&#039;&#039;S&#039;&#039;&#039;ex determining &#039;&#039;&#039;R&#039;&#039;&#039;egion &#039;&#039;&#039;Y&#039;&#039;&#039; - &#039;&#039;&#039;H&#039;&#039;&#039;igh &#039;&#039;&#039;M&#039;&#039;&#039;obility &#039;&#039;&#039;G&#039;&#039;&#039;roup domain.&lt;br /&gt;
It is approximately 80 residues long. It mediates the binding of the protein to the minor groove of DNA. It is the most important part of the SRY protein. Not only because it enable  the protein to bind the DNA but because even a little mutation can cause an inactivation of the protein.&lt;br /&gt;
&lt;br /&gt;
It has a Twisted L shape meaning that it has a long (28Å) and a short (22Å) arm. The HMG Box is made of 3 helices, its N-term and C-term are irregular. The overall structure is stabilized by a hydrophobic core especially at the intersection of the 3 helices where 3 aromatics cycles meet, surrounnded by aliphatic aminoacids.&lt;br /&gt;
&lt;br /&gt;
The interaction between the HMG-Box and DNA is specific and stable. It permits the bend of DNA (?75°). It is mostly hydrophobic interaction. Only one molecule of water interface the Box and the DNA. the complex is stabilized by salt bridges between positive charged residues of the HMG domain and negative charged phosphates.&amp;lt;ref&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[Image:HHMG-bitmap.png|thumb|alt=Image bitmap|Linear structure of hHMG domain]]&lt;br /&gt;
&lt;br /&gt;
The binding of SRY to DNA is specific. The DNA target site is a DNA octamer :&lt;br /&gt;
&lt;br /&gt;
(5&#039;-dGCACAAAC)&lt;br /&gt;
(5&#039;-dGTTTGTGC)&lt;br /&gt;
&lt;br /&gt;
This sequenece is found in the promoters of genes expressed during the testicular development&lt;br /&gt;
The bend of DNA permits the recruitment of different proteins and the build of massives proteins-DNA complexes that could change the expression of different genes. It is the role of a transcription factor.&amp;lt;ref&amp;gt;PMID:11563911&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
Even if the most important function of the HMG box is its capacity of binding and bending DNA, it is also involved in DNA condensation, recombination and DNA repair.&lt;br /&gt;
&lt;br /&gt;
There are 2 kinds of protein that contain a HMG box&lt;br /&gt;
* HMG1 : It is expressed in few cell types. It is found in transcription factors that contain a single HMG box. The bind to a DNA sequence is specific.&lt;br /&gt;
* HMG2 : Are found in all cell types and are abundant in chromatin. This proteins can contain two or more HMG boxes that can nonspecifically bind DNA. &lt;br /&gt;
&lt;br /&gt;
===General structure of SRY===&lt;br /&gt;
The overall structure of SRY is organized aroud the HMG-box.&lt;br /&gt;
3 domains:&lt;br /&gt;
* N-term domain&lt;br /&gt;
* Central domain : DNA binding (HMG box)&lt;br /&gt;
* C-term domain&lt;br /&gt;
&lt;br /&gt;
== Function ==&lt;br /&gt;
&lt;br /&gt;
===Sex determining===&lt;br /&gt;
It acts like a sex determinator thanks to it transcriptionnal activity. It inhibits the developpement of female sex structure in th embryonnic individual.&lt;br /&gt;
&lt;br /&gt;
==Implication - Future for SRY ?==&lt;br /&gt;
&lt;br /&gt;
== Disease ==&lt;br /&gt;
&lt;br /&gt;
=== Swyer syndrome (AKA XY gonadal dysgenis) :===&lt;br /&gt;
&lt;br /&gt;
	If the TDF protein is not able to bind its targeted DNA sequences, the genes responsible for the testis development are not expressed. The patient owning this defective protein will then develop female characters, even though he has a XY karyotype. This phenomenon is known as the « Swyer Syndrome ». &lt;br /&gt;
Different causes can explain this « XY gonadal dysgenis », as it is also called. About thirty mutations (named [http://www.uniprot.org/uniprot/Q05066#sequences &amp;quot;SRXY1&amp;quot;]) in the SRY gene have been shown to drive this phenotype development. It can also be due to crossovers during a meiosis. If a Y chromosome portion carrying the SRY gene is recombined into a X chromosome, a sperm cell will get this abnormal Y chromosome. If it then fecundates, a XY karyotype without any SRY gene will be formed. &lt;br /&gt;
&lt;br /&gt;
=== De La Chapelle syndrome (AKA XX male syndrome) :===&lt;br /&gt;
&lt;br /&gt;
From the meiosis just described would also result an abnormal X chromosome, carrying the SRY gene. If the sperm cell owning this chromosome fecundates an ovule, the resulting newborn will have a XX karyotype but a male phenotype. This is called the « De La Chapelle syndrome ». In this case, the patient can either develop testis or both testis and ovarian tissues. As some epigenetic mechanisms can inactivate the X chromosome carrying SRY, this syndrome keeps most of the patients sterile.&amp;lt;ref&amp;gt;PMID: 4622299&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
== Relevance ==&lt;br /&gt;
&lt;br /&gt;
== Structural highlights ==&lt;br /&gt;
&lt;br /&gt;
This is a sample scene created with SAT to &amp;lt;scene name=&amp;quot;/12/3456/Sample/1&amp;quot;&amp;gt;color&amp;lt;/scene&amp;gt; by Group, and another to make &amp;lt;scene name=&amp;quot;/12/3456/Sample/2&amp;quot;&amp;gt;a transparent representation&amp;lt;/scene&amp;gt; of the protein. You can make your own scenes on SAT starting from scratch or loading and editing one of these sample scenes.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;/StructureSection&amp;gt;&lt;br /&gt;
== References ==&lt;br /&gt;
[http://ghr.nlm.nih.gov/gene/SRY Genetic Home reference]&lt;br /&gt;
&amp;lt;references/&amp;gt;&lt;/div&gt;</summary>
		<author><name>Fantin Mesny</name></author>
	</entry>
	<entry>
		<id>https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2525342</id>
		<title>Sandbox Reserved 1120</title>
		<link rel="alternate" type="text/html" href="https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2525342"/>
		<updated>2016-01-28T09:56:17Z</updated>

		<summary type="html">&lt;p&gt;Fantin Mesny: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{Sandbox_Reserved_ESBS_2015}}&amp;lt;!-- PLEASE ADD YOUR CONTENT BELOW HERE --&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==SRY protein (AKA TDF protein)==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;StructureSection load=&#039;1hry&#039; size=&#039;340&#039; side=&#039;right&#039; caption=&#039;The SRY protein linked to DNA&#039; scene=&#039;&#039;&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The SRY protein is a 204 residues long monomeric polypeptide. It is a &#039;&#039;&#039;transcriptionnal factor&#039;&#039;&#039;, It activates the &#039;&#039;&#039;M&#039;&#039;&#039;üllerian &#039;&#039;&#039;I&#039;&#039;&#039;nhibiting &#039;&#039;&#039;S&#039;&#039;&#039;ubstance (&#039;&#039;&#039;MIS&#039;&#039;&#039; gene).&lt;br /&gt;
It is encoded by the [[testis-determining sex gene]] and is itself involved in the sex determination in mammels by being responsible for the gonadogenesis thus the male sexual developement. It is the HMG-box that gives to the protein its ability to bind DNA by its minor groove. &amp;lt;ref&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Properties===&lt;br /&gt;
&lt;br /&gt;
&amp;lt;table style=&amp;quot;width:100%&amp;quot;;border: 3px solid #A0A0A0&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Molecular weight&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Gene&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Length&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;DNA target sequence&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Genes targeted&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Inhibitors&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;/table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==History==&lt;br /&gt;
&lt;br /&gt;
After centuries of unfounded theories mainly based on environmental factors, the first molecular theory concerning the sex determination appeared in 1891. At this time, the german biologist Hermann Henking was studying sperm formation in wasps. As a chromosome which was not present in all the wasps looked different from the others, he suspected it to play a role in sex determination and called it the &amp;quot;X chromosome&amp;quot;.&lt;br /&gt;
Ten years later, Clarence Erwin McClung saw that this chromosome behaved differently during the meiosis and was only present in half the sperm cells of grasshoppers. As the main characteristic that varies in 50/50 proportions among zygotes is the sex, McClung suspected the X chromosome to be implicated in sexual development. &lt;br /&gt;
In 1905, Nettie Stevens discovered the &amp;quot;Y chromosome&amp;quot; (and the female XX and male XY patterns) while she was counting the chromosomes of beetles under the microscope&amp;lt;ref&amp;gt;Sumner, A. T. Sex Chromosomes and Sex Determination. Chromosomes: Organization and Function, 97-108. [http://www.nature.com/scitable/nated/topicpage/Sex-Chromosomes-and-Sex-Determination-44565]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
During the next decades, a few theories were in competition. In 1921, Calvin Bridges&#039;s works on &#039;&#039;Drosophila melanogaster&#039;&#039; seemed to reveal that male characters acquisition is due to a genic balance between the genes contained in the X chromosome and those contained in the autosomes&amp;lt;ref&amp;gt;PMID: 17769897&amp;lt;/ref&amp;gt;.&lt;br /&gt;
In 1930, Ronald Fisher introduced the first Y-based control of sex theory by proposing two different models : either all the genes responsible for the male characters are located on the Y chromosome or there is a Y-located gene which regulates the expression of genes elsewhere in the genome&amp;lt;ref&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt;.&lt;br /&gt;
As Alfred Jost had shown the testosterone produced by the testis is responsible for the entire male phenotype acquisition&amp;lt;ref&amp;gt;PMID: 4805859&amp;lt;/ref&amp;gt;, in 1988, Peter Neville Goodfellow proposed that there is a gene (&#039;&#039;TDF&#039;&#039; in human, &#039;&#039;Tdy&#039;&#039; in mice)  on the Y chromosome which drives the development of the testis.&amp;lt;ref&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt; In 1990, Goodfellow&#039;s hypothesis was validated with the discovery of &#039;&#039;Tdy&#039;&#039;&#039;s localisation. This gene&#039;s product (expressed during the male gonadal development) owns an amino-acid motif showing homology to other known or putative DNA-binding domains. &#039;&#039;Tdy&#039;&#039; is therefore a transcriptional factor&amp;lt;ref&amp;gt;PMID: 2374589&amp;lt;/ref&amp;gt;. The same year, the human &#039;&#039;SRY&#039;&#039; gene (accepted later as the &#039;&#039;TDF&#039;&#039;) was discovered&amp;lt;ref&amp;gt;PMID: 1695712&amp;lt;/ref&amp;gt;. &lt;br /&gt;
Three dimensional structure of the SRY protein was determined in 1995 using NMR spectroscopy&amp;lt;ref&amp;gt;PMID: 7774012&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==SRY gene==&lt;br /&gt;
&lt;br /&gt;
===Generality===&lt;br /&gt;
&lt;br /&gt;
The SRY gene encodes the SRY protein. The SRY protein is a transcriptional factor inducing the male phenotype in embryo. The SRY gene is located on the [https://en.wikipedia.org/wiki/Y_chromosome Y chromosom] in the short arm (p) 11.3 &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/gene/6736]&amp;lt;/ref&amp;gt;. This gene has only one exon containing the HMG domain (DNA-binding high-mobility group box domain). That&#039;s means that SRY mRNA does not have a alternative splicing, so there is one isoform of SRY protein.&amp;lt;ref&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;. Moreover,the human genome contains one copy of the SRY gene, whereas the mouse genome contains 6 copy of this gene. &amp;lt;ref&amp;gt; Sekido R, Lovell-Badge R. Genetic control of testis development. Sex Dev Genet Mol Biol Evol Endocrinol Embryol Pathol Sex Determ Differ. 2013;7(1-3):21–32 &amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Sequence of the SRY gene===&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:90%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #ABE8C9;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
&amp;gt;gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/nuccore]&amp;lt;/ref&amp;gt;&lt;br /&gt;
TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT&lt;br /&gt;
TTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACA&lt;br /&gt;
&amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;ATG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;CAATCATATGCTTCTGCTATGTTAAGCGTATTCAACAGCGATGATTACAGTCCAGCTGTGCAAGAGAAT&lt;br /&gt;
ATTCCCGCTCTCCGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTAAGTATCAGTGTGAAA&lt;br /&gt;
CGGGAGAAAACAGTAAAGGCAACGTCCA&amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;GGATAGAGTGAAGCGACCCATGAACGCATTCATCGTGTGGTC&lt;br /&gt;
&#039;&#039;&#039;TCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCAGAGATCAGCAAGCAGCTG&lt;br /&gt;
&#039;&#039;&#039;GGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCATTCTTCCAGGAGGCACAGAAATTACAGG&lt;br /&gt;
&#039;&#039;&#039;CCATGCACAGAGAGAAATACCCGAATTATAAGTATCGA&#039;&#039;&#039;CCTCGTCGGAAGGCGAAGATGCTGCCGAAGAA&lt;br /&gt;
TTGCAGTTTGCTTCCCGCAGATCCCGCTTCGGTACTCTGCAGCGAAGTGCAACTGGACAACAGGTTGTAC&lt;br /&gt;
AGGGATGACTGTACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAACG&lt;br /&gt;
CAGCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTG&amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;TAG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;GACAATCGGGTAACATT&lt;br /&gt;
GGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCACTTTCTTATGTTTAGTTT&lt;br /&gt;
CAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCATTTCA&amp;lt;/small&amp;gt;&amp;lt;/div&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;&#039;legend of bold &#039;&#039;&#039;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;Initiation codon&amp;lt;/FONT&amp;gt;&lt;br /&gt;
&lt;br /&gt;
second: HMG sequence&lt;br /&gt;
&lt;br /&gt;
third: stop codon&lt;br /&gt;
&lt;br /&gt;
===Regulation of the expression of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
In humans, the SRY promoter is found at −408 bp to −95 bp upstream of the ATG initiation codon. Moreover, the SRY gene has enhancers at -727 pb upstream of the ATG initiation codon. The linkage between regulatory proteins and this enhancers have the property to increase the production of SRY protein. These regulatory proteins could be: SF1 (steroidogenic factor 1), SP1  and WT 1 (Wilms tumor). &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
*SF1: this transcriptional factor belong to the family of nuclear hormone receptor and contains a zinc finger. The activation of this protein requires a ligand (hormone).&lt;br /&gt;
&lt;br /&gt;
*SP1: this transciprional factor is a ubiquitous protein binding in site containing rich-GC sequences and implicated in the transcription of many genes. Moreover, this protein contains a zinc finger.&lt;br /&gt;
&lt;br /&gt;
*WT1:this transcriptional factor transactives SRY gene, it contains a zinc finger. &amp;lt;ref&amp;gt;Larney C, Bailey TL, Koopman P. Switching on sex: transcriptional regulation of the testis-determining gene Sry. Dev Camb Engl. 2014 Jun;141(11):2195–205. &amp;lt;/ref&amp;gt; &lt;br /&gt;
&lt;br /&gt;
=== Role of the SRY gene ===&lt;br /&gt;
&lt;br /&gt;
The SRY protein is a transcription factor, which contains nuclear localization domains in N terminal and C terminal. An acetylation on these domains allows to export the protein SRY in the nucleus.  &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The SRY protein activates the SOX9 (SRY-box9) gene &amp;lt;ref&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;., this gene is found in the 17 chromosom in the long arm 24.3 &amp;lt;ref&amp;gt; NCBI [http://www.ncbi.nlm.nih.gov/gene/6662] &amp;lt;/ref&amp;gt; and is implicated in the stimulation of the differentiation of sertori cells. The activation of sox 9 are done with protein SRY and another transcriptional factor: SF1 (steroidogenic factor 1). These transcriptional factors are bind in an enhancers called: TESCO (testis-specific enhancer of Sox9 core element). The fixation of transcriptional factor in enhancer provokes a curvature of DNA (90°C) allowing a stabilisation of the elongation complex on the SOX9 promoter. The SOX 9 protein activates the gene AMH (anti-mullerian hormone)&amp;lt;ref&amp;gt;[http://www.ebi.ac.uk/interpro/entry/IPR006799?q=AMH] &amp;lt;/ref&amp;gt; allows the reduction of the channels of Müller in male. &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==Structure==&lt;br /&gt;
&lt;br /&gt;
===The SRY-HMG domain (HMG-Box)===&lt;br /&gt;
&#039;&#039;&#039;SRY-HMG&#039;&#039;&#039; stands for &#039;&#039;&#039;S&#039;&#039;&#039;ex determining &#039;&#039;&#039;R&#039;&#039;&#039;egion &#039;&#039;&#039;Y&#039;&#039;&#039; - &#039;&#039;&#039;H&#039;&#039;&#039;igh &#039;&#039;&#039;M&#039;&#039;&#039;obility &#039;&#039;&#039;G&#039;&#039;&#039;roup domain.&lt;br /&gt;
It is approximately 80 residues long. It mediates the binding of the protein to the minor groove of DNA. It is the most important part of the SRY protein. Not only because it enable  the protein to bind the DNA but because even a little mutation can cause an inactivation of the protein.&lt;br /&gt;
&lt;br /&gt;
It has a Twisted L shape meaning that it has a long (28Å) and a short (22Å) arm. The HMG Box is made of 3 helices, its N-term and C-term are irregular. The overall structure is stabilized by a hydrophobic core especially at the intersection of the 3 helices where 3 aromatics cycles meet, surrounnded by aliphatic aminoacids.&lt;br /&gt;
&lt;br /&gt;
The interaction between the HMG-Box and DNA is specific and stable. It permits the bend of DNA (?75°). It is mostly hydrophobic interaction. Only one molecule of water interface the Box and the DNA. the complex is stabilized by salt bridges between positive charged residues of the HMG domain and negative charged phosphates.&amp;lt;ref&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[Image:HHMG-bitmap.png|thumb|alt=Image bitmap|Linear structure of hHMG domain]]&lt;br /&gt;
&lt;br /&gt;
The binding of SRY to DNA is specific. The DNA target site is a DNA octamer :&lt;br /&gt;
&lt;br /&gt;
(5&#039;-dGCACAAAC)&lt;br /&gt;
(5&#039;-dGTTTGTGC)&lt;br /&gt;
&lt;br /&gt;
This sequenece is found in the promoters of genes expressed during the testicular development&lt;br /&gt;
The bend of DNA permits the recruitment of different proteins and the build of massives proteins-DNA complexes that could change the expression of different genes. It is the role of a transcription factor.&amp;lt;ref&amp;gt;PMID:11563911&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
Even if the most important function of the HMG box is its capacity of binding and bending DNA, it is also involved in DNA condensation, recombination and DNA repair.&lt;br /&gt;
&lt;br /&gt;
There are 2 kinds of protein that contain a HMG box&lt;br /&gt;
* HMG1 : It is expressed in few cell types. It is found in transcription factors that contain a single HMG box. The bind to a DNA sequence is specific.&lt;br /&gt;
* HMG2 : Are found in all cell types and are abundant in chromatin. This proteins can contain two or more HMG boxes that can nonspecifically bind DNA. &lt;br /&gt;
&lt;br /&gt;
===General structure of SRY===&lt;br /&gt;
The overall structure of SRY is organized aroud the HMG-box.&lt;br /&gt;
3 domains:&lt;br /&gt;
* N-term domain&lt;br /&gt;
* Central domain : DNA binding (HMG box)&lt;br /&gt;
* C-term domain&lt;br /&gt;
&lt;br /&gt;
== Function ==&lt;br /&gt;
&lt;br /&gt;
===Sex determining===&lt;br /&gt;
It acts like a sex determinator thanks to it transcriptionnal activity. It inhibits the developpement of female sex structure in th embryonnic individual.&lt;br /&gt;
&lt;br /&gt;
==Implication - Future for SRY ?==&lt;br /&gt;
&lt;br /&gt;
== Disease ==&lt;br /&gt;
&lt;br /&gt;
=== Swyer syndrome (AKA XY gonadal dysgenis) :===&lt;br /&gt;
&lt;br /&gt;
	If the TDF protein is not able to bind its targeted DNA sequences, the genes responsible for the testis development are not expressed. The patient owning this defective protein will then develop female characters, even though he has a XY karyotype. This phenomenon is known as the « Swyer Syndrome ». &lt;br /&gt;
Different causes can explain this « XY gonadal dysgenis », as it is also called. About thirty mutations (named [http://www.uniprot.org/uniprot/Q05066#sequences &amp;quot;SRXY1&amp;quot;]) in the SRY gene have been shown to drive this phenotype development. It can also be due to crossovers during a meiosis. If a Y chromosome portion carrying the SRY gene is recombined into a X chromosome, a sperm cell will get this abnormal Y chromosome. If it then fecundates, a XY karyotype without any SRY gene will be formed. &lt;br /&gt;
&lt;br /&gt;
=== De La Chapelle syndrome (AKA XX male syndrome) :===&lt;br /&gt;
&lt;br /&gt;
From the meiosis just described would also result an abnormal X chromosome, carrying the SRY gene. If the sperm cell owning this chromosome fecundates an ovule, the resulting newborn will have a XX karyotype but a male phenotype. This is called the « De La Chapelle syndrome ». In this case, the patient can either develop testis or both testis and ovarian tissues. As some epigenetic mechanisms can inactivate the X chromosome carrying SRY, this syndrome keeps most of the patients sterile.&amp;lt;ref&amp;gt;PMID: 4622299&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
== Relevance ==&lt;br /&gt;
&lt;br /&gt;
== Structural highlights ==&lt;br /&gt;
&lt;br /&gt;
This is a sample scene created with SAT to &amp;lt;scene name=&amp;quot;/12/3456/Sample/1&amp;quot;&amp;gt;color&amp;lt;/scene&amp;gt; by Group, and another to make &amp;lt;scene name=&amp;quot;/12/3456/Sample/2&amp;quot;&amp;gt;a transparent representation&amp;lt;/scene&amp;gt; of the protein. You can make your own scenes on SAT starting from scratch or loading and editing one of these sample scenes.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;/StructureSection&amp;gt;&lt;br /&gt;
== References ==&lt;br /&gt;
[http://ghr.nlm.nih.gov/gene/SRY Genetic Home reference]&lt;br /&gt;
&amp;lt;references/&amp;gt;&lt;/div&gt;</summary>
		<author><name>Fantin Mesny</name></author>
	</entry>
	<entry>
		<id>https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2525341</id>
		<title>Sandbox Reserved 1120</title>
		<link rel="alternate" type="text/html" href="https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2525341"/>
		<updated>2016-01-28T09:55:20Z</updated>

		<summary type="html">&lt;p&gt;Fantin Mesny: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{Sandbox_Reserved_ESBS_2015}}&amp;lt;!-- PLEASE ADD YOUR CONTENT BELOW HERE --&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==SRY protein (AKA TDF protein)==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;StructureSection load=&#039;1hry&#039; size=&#039;340&#039; side=&#039;right&#039; caption=&#039;The SRY protein linked to DNA&#039; scene=&#039;&#039;&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The SRY protein is a 204 residues long monomeric polypeptide. It is a &#039;&#039;&#039;transcriptionnal factor&#039;&#039;&#039;, It activates the &#039;&#039;&#039;M&#039;&#039;&#039;üllerian &#039;&#039;&#039;I&#039;&#039;&#039;nhibiting &#039;&#039;&#039;S&#039;&#039;&#039;ubstance (&#039;&#039;&#039;MIS&#039;&#039;&#039; gene).&lt;br /&gt;
It is encoded by the [[testis-determining sex gene]] and is itself involved in the sex determination in mammels by being responsible for the gonadogenesis thus the male sexual developement. It is the HMG-box that gives to the protein its ability to bind DNA by its minor groove. &amp;lt;ref&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Properties===&lt;br /&gt;
&lt;br /&gt;
&amp;lt;table style=&amp;quot;width:100%&amp;quot;;border: 3px solid #A0A0A0&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Molecular weight&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Gene&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Length&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;DNA target sequence&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Genes targeted&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Inhibitors&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;/table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==History==&lt;br /&gt;
&lt;br /&gt;
After centuries of unfounded theories mainly based on environmental factors, the first molecular theory concerning the sex determination appeared in 1891. At this time, the german biologist Hermann Henking was studying sperm formation in wasps. As a chromosome which was not present in all the wasps looked different from the others, he suspected it to play a role in sex determination and called it the &amp;quot;X chromosome&amp;quot;.&lt;br /&gt;
Ten years later, Clarence Erwin McClung saw that this chromosome behaved differently during the meiosis and was only present in half the sperm cells of grasshoppers. As the main characteristic that varies in 50/50 proportions among zygotes is the sex, McClung suspected the X chromosome to be implicated in sexual development. &lt;br /&gt;
In 1905, Nettie Stevens discovered the &amp;quot;Y chromosome&amp;quot; (and the female XX and male XY patterns) while she was counting the chromosomes of beetles under the microscope&amp;lt;ref&amp;gt;Sumner, A. T. Sex Chromosomes and Sex Determination. Chromosomes: Organization and Function, 97-108. [http://www.nature.com/scitable/nated/topicpage/Sex-Chromosomes-and-Sex-Determination-44565]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
During the next decades, a few theories were in competition. In 1921, Calvin Bridges&#039;s works on &#039;&#039;Drosophila melanogaster&#039;&#039; seemed to reveal that male characters acquisition is due to a genic balance between the genes contained in the X chromosome and those contained in the autosomes&amp;lt;ref&amp;gt;PMID: 17769897&amp;lt;/ref&amp;gt;.&lt;br /&gt;
In 1930, Ronald Fisher introduced the first Y-based control of sex theory by proposing two different models : either all the genes responsible for the male characters are located on the Y chromosome or there is a Y-located gene which regulates the expression of genes elsewhere in the genome&amp;lt;ref&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt;.&lt;br /&gt;
As Alfred Jost had shown the testosterone produced by the testis is responsible for the entire male phenotype acquisition&amp;lt;ref&amp;gt;PMID: 4805859&amp;lt;/ref&amp;gt;, in 1988, Peter Neville Goodfellow proposed that there is a gene (&#039;&#039;TDF&#039;&#039; in human, &#039;&#039;Tdy&#039;&#039; in mice)  on the Y chromosome which drives the development of the testis.&amp;lt;ref&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt; In 1990, Goodfellow&#039;s hypothesis was validated with the discovery of &#039;&#039;Tdy&#039;&#039;&#039;s localisation. This gene&#039;s product (expressed during the male gonadal development) owns an amino-acid motif showing homology to other known or putative DNA-binding domains. &#039;&#039;Tdy&#039;&#039; is therefore a transcriptional factor&amp;lt;ref&amp;gt;PMID: 2374589&amp;lt;/ref&amp;gt;. The same year, the human &#039;&#039;SRY&#039;&#039; gene (accepted later as the &#039;&#039;TDF&#039;&#039;) was discovered&amp;lt;ref&amp;gt;PMID: 1695712&amp;lt;/ref&amp;gt;. &lt;br /&gt;
Three dimensional structure of the SRY protein was determined in 1995 using NMR spectroscopy&amp;lt;ref&amp;gt;PMID: 7774012&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==SRY gene==&lt;br /&gt;
&lt;br /&gt;
===Generality===&lt;br /&gt;
&lt;br /&gt;
The SRY gene encodes the SRY protein. The SRY protein is a transcriptional factor inducing the male phenotype in embryo. The SRY gene is located on the [https://en.wikipedia.org/wiki/Y_chromosome Y chromosom] in the short arm (p) 11.3 &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/gene/6736]&amp;lt;/ref&amp;gt;. This gene has only one exon containing the HMG domain (DNA-binding high-mobility group box domain). That&#039;s means that SRY mRNA does not have a alternative splicing, so there is one isoform of SRY protein.&amp;lt;ref&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;. Moreover,the human genome contains one copy of the SRY gene, whereas the mouse genome contains 6 copy of this gene. &amp;lt;ref&amp;gt; Sekido R, Lovell-Badge R. Genetic control of testis development. Sex Dev Genet Mol Biol Evol Endocrinol Embryol Pathol Sex Determ Differ. 2013;7(1-3):21–32 &amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Sequence of the SRY gene===&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:90%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #ABE8C9;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
&amp;gt;gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/nuccore]&amp;lt;/ref&amp;gt;&lt;br /&gt;
TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT&lt;br /&gt;
TTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACA&lt;br /&gt;
&amp;lt;FONT color=&amp;quot;green&amp;quot;&amp;gt;&amp;lt;b&amp;gt;ATG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;CAATCATATGCTTCTGCTATGTTAAGCGTATTCAACAGCGATGATTACAGTCCAGCTGTGCAAGAGAAT&lt;br /&gt;
ATTCCCGCTCTCCGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTAAGTATCAGTGTGAAA&lt;br /&gt;
CGGGAGAAAACAGTAAAGGCAACGTCCA&amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;GGATAGAGTGAAGCGACCCATGAACGCATTCATCGTGTGGTC&lt;br /&gt;
&#039;&#039;&#039;TCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCAGAGATCAGCAAGCAGCTG&lt;br /&gt;
&#039;&#039;&#039;GGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCATTCTTCCAGGAGGCACAGAAATTACAGG&lt;br /&gt;
&#039;&#039;&#039;CCATGCACAGAGAGAAATACCCGAATTATAAGTATCGA&#039;&#039;&#039;CCTCGTCGGAAGGCGAAGATGCTGCCGAAGAA&lt;br /&gt;
TTGCAGTTTGCTTCCCGCAGATCCCGCTTCGGTACTCTGCAGCGAAGTGCAACTGGACAACAGGTTGTAC&lt;br /&gt;
AGGGATGACTGTACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAACG&lt;br /&gt;
CAGCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTG&amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;TAG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;GACAATCGGGTAACATT&lt;br /&gt;
GGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCACTTTCTTATGTTTAGTTT&lt;br /&gt;
CAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCATTTCA&lt;br /&gt;
&amp;lt;/small&amp;gt;&amp;lt;/div&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;&#039;legend of bold &#039;&#039;&#039;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;Initiation codon&amp;lt;/FONT&amp;gt;&lt;br /&gt;
&lt;br /&gt;
second: HMG sequence&lt;br /&gt;
&lt;br /&gt;
third: stop codon&lt;br /&gt;
&lt;br /&gt;
===Regulation of the expression of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
In humans, the SRY promoter is found at −408 bp to −95 bp upstream of the ATG initiation codon. Moreover, the SRY gene has enhancers at -727 pb upstream of the ATG initiation codon. The linkage between regulatory proteins and this enhancers have the property to increase the production of SRY protein. These regulatory proteins could be: SF1 (steroidogenic factor 1), SP1  and WT 1 (Wilms tumor). &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
*SF1: this transcriptional factor belong to the family of nuclear hormone receptor and contains a zinc finger. The activation of this protein requires a ligand (hormone).&lt;br /&gt;
&lt;br /&gt;
*SP1: this transciprional factor is a ubiquitous protein binding in site containing rich-GC sequences and implicated in the transcription of many genes. Moreover, this protein contains a zinc finger.&lt;br /&gt;
&lt;br /&gt;
*WT1:this transcriptional factor transactives SRY gene, it contains a zinc finger. &amp;lt;ref&amp;gt;Larney C, Bailey TL, Koopman P. Switching on sex: transcriptional regulation of the testis-determining gene Sry. Dev Camb Engl. 2014 Jun;141(11):2195–205. &amp;lt;/ref&amp;gt; &lt;br /&gt;
&lt;br /&gt;
=== Role of the SRY gene ===&lt;br /&gt;
&lt;br /&gt;
The SRY protein is a transcription factor, which contains nuclear localization domains in N terminal and C terminal. An acetylation on these domains allows to export the protein SRY in the nucleus.  &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The SRY protein activates the SOX9 (SRY-box9) gene &amp;lt;ref&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;., this gene is found in the 17 chromosom in the long arm 24.3 &amp;lt;ref&amp;gt; NCBI [http://www.ncbi.nlm.nih.gov/gene/6662] &amp;lt;/ref&amp;gt; and is implicated in the stimulation of the differentiation of sertori cells. The activation of sox 9 are done with protein SRY and another transcriptional factor: SF1 (steroidogenic factor 1). These transcriptional factors are bind in an enhancers called: TESCO (testis-specific enhancer of Sox9 core element). The fixation of transcriptional factor in enhancer provokes a curvature of DNA (90°C) allowing a stabilisation of the elongation complex on the SOX9 promoter. The SOX 9 protein activates the gene AMH (anti-mullerian hormone)&amp;lt;ref&amp;gt;[http://www.ebi.ac.uk/interpro/entry/IPR006799?q=AMH] &amp;lt;/ref&amp;gt; allows the reduction of the channels of Müller in male. &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==Structure==&lt;br /&gt;
&lt;br /&gt;
===The SRY-HMG domain (HMG-Box)===&lt;br /&gt;
&#039;&#039;&#039;SRY-HMG&#039;&#039;&#039; stands for &#039;&#039;&#039;S&#039;&#039;&#039;ex determining &#039;&#039;&#039;R&#039;&#039;&#039;egion &#039;&#039;&#039;Y&#039;&#039;&#039; - &#039;&#039;&#039;H&#039;&#039;&#039;igh &#039;&#039;&#039;M&#039;&#039;&#039;obility &#039;&#039;&#039;G&#039;&#039;&#039;roup domain.&lt;br /&gt;
It is approximately 80 residues long. It mediates the binding of the protein to the minor groove of DNA. It is the most important part of the SRY protein. Not only because it enable  the protein to bind the DNA but because even a little mutation can cause an inactivation of the protein.&lt;br /&gt;
&lt;br /&gt;
It has a Twisted L shape meaning that it has a long (28Å) and a short (22Å) arm. The HMG Box is made of 3 helices, its N-term and C-term are irregular. The overall structure is stabilized by a hydrophobic core especially at the intersection of the 3 helices where 3 aromatics cycles meet, surrounnded by aliphatic aminoacids.&lt;br /&gt;
&lt;br /&gt;
The interaction between the HMG-Box and DNA is specific and stable. It permits the bend of DNA (?75°). It is mostly hydrophobic interaction. Only one molecule of water interface the Box and the DNA. the complex is stabilized by salt bridges between positive charged residues of the HMG domain and negative charged phosphates.&amp;lt;ref&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[Image:HHMG-bitmap.png|thumb|alt=Image bitmap|Linear structure of hHMG domain]]&lt;br /&gt;
&lt;br /&gt;
The binding of SRY to DNA is specific. The DNA target site is a DNA octamer :&lt;br /&gt;
&lt;br /&gt;
(5&#039;-dGCACAAAC)&lt;br /&gt;
(5&#039;-dGTTTGTGC)&lt;br /&gt;
&lt;br /&gt;
This sequenece is found in the promoters of genes expressed during the testicular development&lt;br /&gt;
The bend of DNA permits the recruitment of different proteins and the build of massives proteins-DNA complexes that could change the expression of different genes. It is the role of a transcription factor.&amp;lt;ref&amp;gt;PMID:11563911&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
Even if the most important function of the HMG box is its capacity of binding and bending DNA, it is also involved in DNA condensation, recombination and DNA repair.&lt;br /&gt;
&lt;br /&gt;
There are 2 kinds of protein that contain a HMG box&lt;br /&gt;
* HMG1 : It is expressed in few cell types. It is found in transcription factors that contain a single HMG box. The bind to a DNA sequence is specific.&lt;br /&gt;
* HMG2 : Are found in all cell types and are abundant in chromatin. This proteins can contain two or more HMG boxes that can nonspecifically bind DNA. &lt;br /&gt;
&lt;br /&gt;
===General structure of SRY===&lt;br /&gt;
The overall structure of SRY is organized aroud the HMG-box.&lt;br /&gt;
3 domains:&lt;br /&gt;
* N-term domain&lt;br /&gt;
* Central domain : DNA binding (HMG box)&lt;br /&gt;
* C-term domain&lt;br /&gt;
&lt;br /&gt;
== Function ==&lt;br /&gt;
&lt;br /&gt;
===Sex determining===&lt;br /&gt;
It acts like a sex determinator thanks to it transcriptionnal activity. It inhibits the developpement of female sex structure in th embryonnic individual.&lt;br /&gt;
&lt;br /&gt;
==Implication - Future for SRY ?==&lt;br /&gt;
&lt;br /&gt;
== Disease ==&lt;br /&gt;
&lt;br /&gt;
=== Swyer syndrome (AKA XY gonadal dysgenis) :===&lt;br /&gt;
&lt;br /&gt;
	If the TDF protein is not able to bind its targeted DNA sequences, the genes responsible for the testis development are not expressed. The patient owning this defective protein will then develop female characters, even though he has a XY karyotype. This phenomenon is known as the « Swyer Syndrome ». &lt;br /&gt;
Different causes can explain this « XY gonadal dysgenis », as it is also called. About thirty mutations (named [http://www.uniprot.org/uniprot/Q05066#sequences &amp;quot;SRXY1&amp;quot;]) in the SRY gene have been shown to drive this phenotype development. It can also be due to crossovers during a meiosis. If a Y chromosome portion carrying the SRY gene is recombined into a X chromosome, a sperm cell will get this abnormal Y chromosome. If it then fecundates, a XY karyotype without any SRY gene will be formed. &lt;br /&gt;
&lt;br /&gt;
=== De La Chapelle syndrome (AKA XX male syndrome) :===&lt;br /&gt;
&lt;br /&gt;
From the meiosis just described would also result an abnormal X chromosome, carrying the SRY gene. If the sperm cell owning this chromosome fecundates an ovule, the resulting newborn will have a XX karyotype but a male phenotype. This is called the « De La Chapelle syndrome ». In this case, the patient can either develop testis or both testis and ovarian tissues. As some epigenetic mechanisms can inactivate the X chromosome carrying SRY, this syndrome keeps most of the patients sterile.&amp;lt;ref&amp;gt;PMID: 4622299&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
== Relevance ==&lt;br /&gt;
&lt;br /&gt;
== Structural highlights ==&lt;br /&gt;
&lt;br /&gt;
This is a sample scene created with SAT to &amp;lt;scene name=&amp;quot;/12/3456/Sample/1&amp;quot;&amp;gt;color&amp;lt;/scene&amp;gt; by Group, and another to make &amp;lt;scene name=&amp;quot;/12/3456/Sample/2&amp;quot;&amp;gt;a transparent representation&amp;lt;/scene&amp;gt; of the protein. You can make your own scenes on SAT starting from scratch or loading and editing one of these sample scenes.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;/StructureSection&amp;gt;&lt;br /&gt;
== References ==&lt;br /&gt;
[http://ghr.nlm.nih.gov/gene/SRY Genetic Home reference]&lt;br /&gt;
&amp;lt;references/&amp;gt;&lt;/div&gt;</summary>
		<author><name>Fantin Mesny</name></author>
	</entry>
	<entry>
		<id>https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2525340</id>
		<title>Sandbox Reserved 1120</title>
		<link rel="alternate" type="text/html" href="https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2525340"/>
		<updated>2016-01-28T09:52:03Z</updated>

		<summary type="html">&lt;p&gt;Fantin Mesny: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{Sandbox_Reserved_ESBS_2015}}&amp;lt;!-- PLEASE ADD YOUR CONTENT BELOW HERE --&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==SRY protein (AKA TDF protein)==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;StructureSection load=&#039;1hry&#039; size=&#039;340&#039; side=&#039;right&#039; caption=&#039;The SRY protein linked to DNA&#039; scene=&#039;&#039;&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The SRY protein is a 204 residues long monomeric polypeptide. It is a &#039;&#039;&#039;transcriptionnal factor&#039;&#039;&#039;, It activates the &#039;&#039;&#039;M&#039;&#039;&#039;üllerian &#039;&#039;&#039;I&#039;&#039;&#039;nhibiting &#039;&#039;&#039;S&#039;&#039;&#039;ubstance (&#039;&#039;&#039;MIS&#039;&#039;&#039; gene).&lt;br /&gt;
It is encoded by the [[testis-determining sex gene]] and is itself involved in the sex determination in mammels by being responsible for the gonadogenesis thus the male sexual developement. It is the HMG-box that gives to the protein its ability to bind DNA by its minor groove. &amp;lt;ref&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Properties===&lt;br /&gt;
&lt;br /&gt;
&amp;lt;table style=&amp;quot;width:100%&amp;quot;;border: 3px solid #A0A0A0&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Molecular weight&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Gene&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Length&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;DNA target sequence&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Genes targeted&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Inhibitors&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;/table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==History==&lt;br /&gt;
&lt;br /&gt;
After centuries of unfounded theories mainly based on environmental factors, the first molecular theory concerning the sex determination appeared in 1891. At this time, the german biologist Hermann Henking was studying sperm formation in wasps. As a chromosome which was not present in all the wasps looked different from the others, he suspected it to play a role in sex determination and called it the &amp;quot;X chromosome&amp;quot;.&lt;br /&gt;
Ten years later, Clarence Erwin McClung saw that this chromosome behaved differently during the meiosis and was only present in half the sperm cells of grasshoppers. As the main characteristic that varies in 50/50 proportions among zygotes is the sex, McClung suspected the X chromosome to be implicated in sexual development. &lt;br /&gt;
In 1905, Nettie Stevens discovered the &amp;quot;Y chromosome&amp;quot; (and the female XX and male XY patterns) while she was counting the chromosomes of beetles under the microscope&amp;lt;ref&amp;gt;Sumner, A. T. Sex Chromosomes and Sex Determination. Chromosomes: Organization and Function, 97-108. [http://www.nature.com/scitable/nated/topicpage/Sex-Chromosomes-and-Sex-Determination-44565]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
During the next decades, a few theories were in competition. In 1921, Calvin Bridges&#039;s works on &#039;&#039;Drosophila melanogaster&#039;&#039; seemed to reveal that male characters acquisition is due to a genic balance between the genes contained in the X chromosome and those contained in the autosomes&amp;lt;ref&amp;gt;PMID: 17769897&amp;lt;/ref&amp;gt;.&lt;br /&gt;
In 1930, Ronald Fisher introduced the first Y-based control of sex theory by proposing two different models : either all the genes responsible for the male characters are located on the Y chromosome or there is a Y-located gene which regulates the expression of genes elsewhere in the genome&amp;lt;ref&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt;.&lt;br /&gt;
As Alfred Jost had shown the testosterone produced by the testis is responsible for the entire male phenotype acquisition&amp;lt;ref&amp;gt;PMID: 4805859&amp;lt;/ref&amp;gt;, in 1988, Peter Neville Goodfellow proposed that there is a gene (&#039;&#039;TDF&#039;&#039; in human, &#039;&#039;Tdy&#039;&#039; in mice)  on the Y chromosome which drives the development of the testis.&amp;lt;ref&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt; In 1990, Goodfellow&#039;s hypothesis was validated with the discovery of &#039;&#039;Tdy&#039;&#039;&#039;s localisation. This gene&#039;s product (expressed during the male gonadal development) owns an amino-acid motif showing homology to other known or putative DNA-binding domains. &#039;&#039;Tdy&#039;&#039; is therefore a transcriptional factor&amp;lt;ref&amp;gt;PMID: 2374589&amp;lt;/ref&amp;gt;. The same year, the human &#039;&#039;SRY&#039;&#039; gene (accepted later as the &#039;&#039;TDF&#039;&#039;) was discovered&amp;lt;ref&amp;gt;PMID: 1695712&amp;lt;/ref&amp;gt;. &lt;br /&gt;
Three dimensional structure of the SRY protein was determined in 1995 using NMR spectroscopy&amp;lt;ref&amp;gt;PMID: 7774012&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==SRY gene==&lt;br /&gt;
&lt;br /&gt;
===Generality===&lt;br /&gt;
&lt;br /&gt;
The SRY gene encodes the SRY protein. The SRY protein is a transcriptional factor inducing the male phenotype in embryo. The SRY gene is located on the [https://en.wikipedia.org/wiki/Y_chromosome Y chromosom] in the short arm (p) 11.3 &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/gene/6736]&amp;lt;/ref&amp;gt;. This gene has only one exon containing the HMG domain (DNA-binding high-mobility group box domain). That&#039;s means that SRY mRNA does not have a alternative splicing, so there is one isoform of SRY protein.&amp;lt;ref&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;. Moreover,the human genome contains one copy of the SRY gene, whereas the mouse genome contains 6 copy of this gene. &amp;lt;ref&amp;gt; Sekido R, Lovell-Badge R. Genetic control of testis development. Sex Dev Genet Mol Biol Evol Endocrinol Embryol Pathol Sex Determ Differ. 2013;7(1-3):21–32 &amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Sequence of the SRY gene===&lt;br /&gt;
&amp;lt;center&amp;gt;&amp;lt;div style=&amp;quot;width:90%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #ABE8C9;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
&amp;gt;gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/nuccore]&amp;lt;/ref&amp;gt;&lt;br /&gt;
TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT&lt;br /&gt;
TTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACA&lt;br /&gt;
&amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;&amp;lt;b&amp;gt;ATG&amp;lt;/b&amp;gt;&amp;lt;/FONT&amp;gt;CAATCATATGCTTCTGCTATGTTAAGCGTATTCAACAGCGATGATTACAGTCCAGCTGTGCAAGAGAAT&lt;br /&gt;
ATTCCCGCTCTCCGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTAAGTATCAGTGTGAAA&lt;br /&gt;
CGGGAGAAAACAGTAAAGGCAACGTCCA&#039;&#039;&#039;GGATAGAGTGAAGCGACCCATGAACGCATTCATCGTGTGGTC&lt;br /&gt;
&#039;&#039;&#039;TCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCAGAGATCAGCAAGCAGCTG&lt;br /&gt;
&#039;&#039;&#039;GGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCATTCTTCCAGGAGGCACAGAAATTACAGG&lt;br /&gt;
&#039;&#039;&#039;CCATGCACAGAGAGAAATACCCGAATTATAAGTATCGA&#039;&#039;&#039;CCTCGTCGGAAGGCGAAGATGCTGCCGAAGAA&lt;br /&gt;
TTGCAGTTTGCTTCCCGCAGATCCCGCTTCGGTACTCTGCAGCGAAGTGCAACTGGACAACAGGTTGTAC&lt;br /&gt;
AGGGATGACTGTACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAACG&lt;br /&gt;
CAGCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTG&#039;&#039;&#039;TAG&#039;&#039;&#039;GACAATCGGGTAACATT&lt;br /&gt;
GGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCACTTTCTTATGTTTAGTTT&lt;br /&gt;
CAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCATTTCA&lt;br /&gt;
&amp;lt;/small&amp;gt;&amp;lt;/div&amp;gt;&amp;lt;/center&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;&#039;legend of bold &#039;&#039;&#039;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;FONT color=&amp;quot;red&amp;quot;&amp;gt;Initiation codon&amp;lt;/FONT&amp;gt;&lt;br /&gt;
&lt;br /&gt;
second: HMG sequence&lt;br /&gt;
&lt;br /&gt;
third: stop codon&lt;br /&gt;
&lt;br /&gt;
===Regulation of the expression of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
In humans, the SRY promoter is found at −408 bp to −95 bp upstream of the ATG initiation codon. Moreover, the SRY gene has enhancers at -727 pb upstream of the ATG initiation codon. The linkage between regulatory proteins and this enhancers have the property to increase the production of SRY protein. These regulatory proteins could be: SF1 (steroidogenic factor 1), SP1  and WT 1 (Wilms tumor). &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
*SF1: this transcriptional factor belong to the family of nuclear hormone receptor and contains a zinc finger. The activation of this protein requires a ligand (hormone).&lt;br /&gt;
&lt;br /&gt;
*SP1: this transciprional factor is a ubiquitous protein binding in site containing rich-GC sequences and implicated in the transcription of many genes. Moreover, this protein contains a zinc finger.&lt;br /&gt;
&lt;br /&gt;
*WT1:this transcriptional factor transactives SRY gene, it contains a zinc finger. &amp;lt;ref&amp;gt;Larney C, Bailey TL, Koopman P. Switching on sex: transcriptional regulation of the testis-determining gene Sry. Dev Camb Engl. 2014 Jun;141(11):2195–205. &amp;lt;/ref&amp;gt; &lt;br /&gt;
&lt;br /&gt;
=== Role of the SRY gene ===&lt;br /&gt;
&lt;br /&gt;
The SRY protein is a transcription factor, which contains nuclear localization domains in N terminal and C terminal. An acetylation on these domains allows to export the protein SRY in the nucleus.  &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The SRY protein activates the SOX9 (SRY-box9) gene &amp;lt;ref&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;., this gene is found in the 17 chromosom in the long arm 24.3 &amp;lt;ref&amp;gt; NCBI [http://www.ncbi.nlm.nih.gov/gene/6662] &amp;lt;/ref&amp;gt; and is implicated in the stimulation of the differentiation of sertori cells. The activation of sox 9 are done with protein SRY and another transcriptional factor: SF1 (steroidogenic factor 1). These transcriptional factors are bind in an enhancers called: TESCO (testis-specific enhancer of Sox9 core element). The fixation of transcriptional factor in enhancer provokes a curvature of DNA (90°C) allowing a stabilisation of the elongation complex on the SOX9 promoter. The SOX 9 protein activates the gene AMH (anti-mullerian hormone)&amp;lt;ref&amp;gt;[http://www.ebi.ac.uk/interpro/entry/IPR006799?q=AMH] &amp;lt;/ref&amp;gt; allows the reduction of the channels of Müller in male. &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==Structure==&lt;br /&gt;
&lt;br /&gt;
===The SRY-HMG domain (HMG-Box)===&lt;br /&gt;
&#039;&#039;&#039;SRY-HMG&#039;&#039;&#039; stands for &#039;&#039;&#039;S&#039;&#039;&#039;ex determining &#039;&#039;&#039;R&#039;&#039;&#039;egion &#039;&#039;&#039;Y&#039;&#039;&#039; - &#039;&#039;&#039;H&#039;&#039;&#039;igh &#039;&#039;&#039;M&#039;&#039;&#039;obility &#039;&#039;&#039;G&#039;&#039;&#039;roup domain.&lt;br /&gt;
It is approximately 80 residues long. It mediates the binding of the protein to the minor groove of DNA. It is the most important part of the SRY protein. Not only because it enable  the protein to bind the DNA but because even a little mutation can cause an inactivation of the protein.&lt;br /&gt;
&lt;br /&gt;
It has a Twisted L shape meaning that it has a long (28Å) and a short (22Å) arm. The HMG Box is made of 3 helices, its N-term and C-term are irregular. The overall structure is stabilized by a hydrophobic core especially at the intersection of the 3 helices where 3 aromatics cycles meet, surrounnded by aliphatic aminoacids.&lt;br /&gt;
&lt;br /&gt;
The interaction between the HMG-Box and DNA is specific and stable. It permits the bend of DNA (?75°). It is mostly hydrophobic interaction. Only one molecule of water interface the Box and the DNA. the complex is stabilized by salt bridges between positive charged residues of the HMG domain and negative charged phosphates.&amp;lt;ref&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[Image:HHMG-bitmap.png|thumb|alt=Image bitmap|Linear structure of hHMG domain]]&lt;br /&gt;
&lt;br /&gt;
The binding of SRY to DNA is specific. The DNA target site is a DNA octamer :&lt;br /&gt;
&lt;br /&gt;
(5&#039;-dGCACAAAC)&lt;br /&gt;
(5&#039;-dGTTTGTGC)&lt;br /&gt;
&lt;br /&gt;
This sequenece is found in the promoters of genes expressed during the testicular development&lt;br /&gt;
The bend of DNA permits the recruitment of different proteins and the build of massives proteins-DNA complexes that could change the expression of different genes. It is the role of a transcription factor.&amp;lt;ref&amp;gt;PMID:11563911&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
Even if the most important function of the HMG box is its capacity of binding and bending DNA, it is also involved in DNA condensation, recombination and DNA repair.&lt;br /&gt;
&lt;br /&gt;
There are 2 kinds of protein that contain a HMG box&lt;br /&gt;
* HMG1 : It is expressed in few cell types. It is found in transcription factors that contain a single HMG box. The bind to a DNA sequence is specific.&lt;br /&gt;
* HMG2 : Are found in all cell types and are abundant in chromatin. This proteins can contain two or more HMG boxes that can nonspecifically bind DNA. &lt;br /&gt;
&lt;br /&gt;
===General structure of SRY===&lt;br /&gt;
The overall structure of SRY is organized aroud the HMG-box.&lt;br /&gt;
3 domains:&lt;br /&gt;
* N-term domain&lt;br /&gt;
* Central domain : DNA binding (HMG box)&lt;br /&gt;
* C-term domain&lt;br /&gt;
&lt;br /&gt;
== Function ==&lt;br /&gt;
&lt;br /&gt;
===Sex determining===&lt;br /&gt;
It acts like a sex determinator thanks to it transcriptionnal activity. It inhibits the developpement of female sex structure in th embryonnic individual.&lt;br /&gt;
&lt;br /&gt;
==Implication - Future for SRY ?==&lt;br /&gt;
&lt;br /&gt;
== Disease ==&lt;br /&gt;
&lt;br /&gt;
=== Swyer syndrome (AKA XY gonadal dysgenis) :===&lt;br /&gt;
&lt;br /&gt;
	If the TDF protein is not able to bind its targeted DNA sequences, the genes responsible for the testis development are not expressed. The patient owning this defective protein will then develop female characters, even though he has a XY karyotype. This phenomenon is known as the « Swyer Syndrome ». &lt;br /&gt;
Different causes can explain this « XY gonadal dysgenis », as it is also called. About thirty mutations (named [http://www.uniprot.org/uniprot/Q05066#sequences &amp;quot;SRXY1&amp;quot;]) in the SRY gene have been shown to drive this phenotype development. It can also be due to crossovers during a meiosis. If a Y chromosome portion carrying the SRY gene is recombined into a X chromosome, a sperm cell will get this abnormal Y chromosome. If it then fecundates, a XY karyotype without any SRY gene will be formed. &lt;br /&gt;
&lt;br /&gt;
=== De La Chapelle syndrome (AKA XX male syndrome) :===&lt;br /&gt;
&lt;br /&gt;
From the meiosis just described would also result an abnormal X chromosome, carrying the SRY gene. If the sperm cell owning this chromosome fecundates an ovule, the resulting newborn will have a XX karyotype but a male phenotype. This is called the « De La Chapelle syndrome ». In this case, the patient can either develop testis or both testis and ovarian tissues. As some epigenetic mechanisms can inactivate the X chromosome carrying SRY, this syndrome keeps most of the patients sterile.&amp;lt;ref&amp;gt;PMID: 4622299&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
== Relevance ==&lt;br /&gt;
&lt;br /&gt;
== Structural highlights ==&lt;br /&gt;
&lt;br /&gt;
This is a sample scene created with SAT to &amp;lt;scene name=&amp;quot;/12/3456/Sample/1&amp;quot;&amp;gt;color&amp;lt;/scene&amp;gt; by Group, and another to make &amp;lt;scene name=&amp;quot;/12/3456/Sample/2&amp;quot;&amp;gt;a transparent representation&amp;lt;/scene&amp;gt; of the protein. You can make your own scenes on SAT starting from scratch or loading and editing one of these sample scenes.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;/StructureSection&amp;gt;&lt;br /&gt;
== References ==&lt;br /&gt;
[http://ghr.nlm.nih.gov/gene/SRY Genetic Home reference]&lt;br /&gt;
&amp;lt;references/&amp;gt;&lt;/div&gt;</summary>
		<author><name>Fantin Mesny</name></author>
	</entry>
	<entry>
		<id>https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2525335</id>
		<title>Sandbox Reserved 1120</title>
		<link rel="alternate" type="text/html" href="https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2525335"/>
		<updated>2016-01-28T09:46:57Z</updated>

		<summary type="html">&lt;p&gt;Fantin Mesny: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{Sandbox_Reserved_ESBS_2015}}&amp;lt;!-- PLEASE ADD YOUR CONTENT BELOW HERE --&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==SRY protein (AKA TDF protein)==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;StructureSection load=&#039;1hry&#039; size=&#039;340&#039; side=&#039;right&#039; caption=&#039;The SRY protein linked to DNA&#039; scene=&#039;&#039;&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The SRY protein is a 204 residues long monomeric polypeptide. It is a &#039;&#039;&#039;transcriptionnal factor&#039;&#039;&#039;, It activates the &#039;&#039;&#039;M&#039;&#039;&#039;üllerian &#039;&#039;&#039;I&#039;&#039;&#039;nhibiting &#039;&#039;&#039;S&#039;&#039;&#039;ubstance (&#039;&#039;&#039;MIS&#039;&#039;&#039; gene).&lt;br /&gt;
It is encoded by the [[testis-determining sex gene]] and is itself involved in the sex determination in mammels by being responsible for the gonadogenesis thus the male sexual developement. It is the HMG-box that gives to the protein its ability to bind DNA by its minor groove. &amp;lt;ref&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Properties===&lt;br /&gt;
&lt;br /&gt;
&amp;lt;table style=&amp;quot;width:100%&amp;quot;;border: 3px solid #A0A0A0&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Molecular weight&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Gene&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Length&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;DNA target sequence&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Genes targeted&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Inhibitors&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;/table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==History==&lt;br /&gt;
&lt;br /&gt;
After centuries of unfounded theories mainly based on environmental factors, the first molecular theory concerning the sex determination appeared in 1891. At this time, the german biologist Hermann Henking was studying sperm formation in wasps. As a chromosome which was not present in all the wasps looked different from the others, he suspected it to play a role in sex determination and called it the &amp;quot;X chromosome&amp;quot;.&lt;br /&gt;
Ten years later, Clarence Erwin McClung saw that this chromosome behaved differently during the meiosis and was only present in half the sperm cells of grasshoppers. As the main characteristic that varies in 50/50 proportions among zygotes is the sex, McClung suspected the X chromosome to be implicated in sexual development. &lt;br /&gt;
In 1905, Nettie Stevens discovered the &amp;quot;Y chromosome&amp;quot; (and the female XX and male XY patterns) while she was counting the chromosomes of beetles under the microscope&amp;lt;ref&amp;gt;Sumner, A. T. Sex Chromosomes and Sex Determination. Chromosomes: Organization and Function, 97-108. [http://www.nature.com/scitable/nated/topicpage/Sex-Chromosomes-and-Sex-Determination-44565]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
During the next decades, a few theories were in competition. In 1921, Calvin Bridges&#039;s works on &#039;&#039;Drosophila melanogaster&#039;&#039; seemed to reveal that male characters acquisition is due to a genic balance between the genes contained in the X chromosome and those contained in the autosomes&amp;lt;ref&amp;gt;PMID: 17769897&amp;lt;/ref&amp;gt;.&lt;br /&gt;
In 1930, Ronald Fisher introduced the first Y-based control of sex theory by proposing two different models : either all the genes responsible for the male characters are located on the Y chromosome or there is a Y-located gene which regulates the expression of genes elsewhere in the genome&amp;lt;ref&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt;.&lt;br /&gt;
As Alfred Jost had shown the testosterone produced by the testis is responsible for the entire male phenotype acquisition&amp;lt;ref&amp;gt;PMID: 4805859&amp;lt;/ref&amp;gt;, in 1988, Peter Neville Goodfellow proposed that there is a gene (&#039;&#039;TDF&#039;&#039; in human, &#039;&#039;Tdy&#039;&#039; in mice)  on the Y chromosome which drives the development of the testis.&amp;lt;ref&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt; In 1990, Goodfellow&#039;s hypothesis was validated with the discovery of &#039;&#039;Tdy&#039;&#039;&#039;s localisation. This gene&#039;s product (expressed during the male gonadal development) owns an amino-acid motif showing homology to other known or putative DNA-binding domains. &#039;&#039;Tdy&#039;&#039; is therefore a transcriptional factor&amp;lt;ref&amp;gt;PMID: 2374589&amp;lt;/ref&amp;gt;. The same year, the human &#039;&#039;SRY&#039;&#039; gene (accepted later as the &#039;&#039;TDF&#039;&#039;) was discovered&amp;lt;ref&amp;gt;PMID: 1695712&amp;lt;/ref&amp;gt;. &lt;br /&gt;
Three dimensional structure of the SRY protein was determined in 1995 using NMR spectroscopy&amp;lt;ref&amp;gt;PMID: 7774012&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==SRY gene==&lt;br /&gt;
&lt;br /&gt;
===Generality===&lt;br /&gt;
&lt;br /&gt;
The SRY gene encodes the SRY protein. The SRY protein is a transcriptional factor inducing the male phenotype in embryo. The SRY gene is located on the [https://en.wikipedia.org/wiki/Y_chromosome Y chromosom] in the short arm (p) 11.3 &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/gene/6736]&amp;lt;/ref&amp;gt;. This gene has only one exon containing the HMG domain (DNA-binding high-mobility group box domain). That&#039;s means that SRY mRNA does not have a alternative splicing, so there is one isoform of SRY protein.&amp;lt;ref&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;. Moreover,the human genome contains one copy of the SRY gene, whereas the mouse genome contains 6 copy of this gene. &amp;lt;ref&amp;gt; Sekido R, Lovell-Badge R. Genetic control of testis development. Sex Dev Genet Mol Biol Evol Endocrinol Embryol Pathol Sex Determ Differ. 2013;7(1-3):21–32 &amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Sequence of the SRY gene===&lt;br /&gt;
&amp;lt;div style=&amp;quot;width:90%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #ABE8C9;&amp;quot;&amp;gt;&amp;lt;small&amp;gt;&lt;br /&gt;
&amp;gt;gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/nuccore]&amp;lt;/ref&amp;gt;&lt;br /&gt;
TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT&lt;br /&gt;
TTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACA&lt;br /&gt;
&#039;&#039;&#039;ATG&#039;&#039;&#039;CAATCATATGCTTCTGCTATGTTAAGCGTATTCAACAGCGATGATTACAGTCCAGCTGTGCAAGAGAAT&lt;br /&gt;
ATTCCCGCTCTCCGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTAAGTATCAGTGTGAAA&lt;br /&gt;
CGGGAGAAAACAGTAAAGGCAACGTCCA&#039;&#039;&#039;GGATAGAGTGAAGCGACCCATGAACGCATTCATCGTGTGGTC&lt;br /&gt;
&#039;&#039;&#039;TCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCAGAGATCAGCAAGCAGCTG&lt;br /&gt;
&#039;&#039;&#039;GGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCATTCTTCCAGGAGGCACAGAAATTACAGG&lt;br /&gt;
&#039;&#039;&#039;CCATGCACAGAGAGAAATACCCGAATTATAAGTATCGA&#039;&#039;&#039;CCTCGTCGGAAGGCGAAGATGCTGCCGAAGAA&lt;br /&gt;
TTGCAGTTTGCTTCCCGCAGATCCCGCTTCGGTACTCTGCAGCGAAGTGCAACTGGACAACAGGTTGTAC&lt;br /&gt;
AGGGATGACTGTACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAACG&lt;br /&gt;
CAGCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTG&#039;&#039;&#039;TAG&#039;&#039;&#039;GACAATCGGGTAACATT&lt;br /&gt;
GGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCACTTTCTTATGTTTAGTTT&lt;br /&gt;
CAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCATTTCA&lt;br /&gt;
&amp;lt;/small&amp;gt;&amp;lt;/div&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;&#039;legend of bold &#039;&#039;&#039;&lt;br /&gt;
&lt;br /&gt;
first: initiation codon&lt;br /&gt;
&lt;br /&gt;
second: HMG sequence&lt;br /&gt;
&lt;br /&gt;
third: stop codon&lt;br /&gt;
&lt;br /&gt;
===Regulation of the expression of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
In humans, the SRY promoter is found at −408 bp to −95 bp upstream of the ATG initiation codon. Moreover, the SRY gene has enhancers at -727 pb upstream of the ATG initiation codon. The linkage between regulatory proteins and this enhancers have the property to increase the production of SRY protein. These regulatory proteins could be: SF1 (steroidogenic factor 1), SP1  and WT 1 (Wilms tumor). &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
*SF1: this transcriptional factor belong to the family of nuclear hormone receptor and contains a zinc finger. The activation of this protein requires a ligand (hormone).&lt;br /&gt;
&lt;br /&gt;
*SP1: this transciprional factor is a ubiquitous protein binding in site containing rich-GC sequences and implicated in the transcription of many genes. Moreover, this protein contains a zinc finger.&lt;br /&gt;
&lt;br /&gt;
*WT1:this transcriptional factor transactives SRY gene, it contains a zinc finger. &amp;lt;ref&amp;gt;Larney C, Bailey TL, Koopman P. Switching on sex: transcriptional regulation of the testis-determining gene Sry. Dev Camb Engl. 2014 Jun;141(11):2195–205. &amp;lt;/ref&amp;gt; &lt;br /&gt;
&lt;br /&gt;
=== Role of the SRY gene ===&lt;br /&gt;
&lt;br /&gt;
The SRY protein is a transcription factor, which contains nuclear localization domains in N terminal and C terminal. An acetylation on these domains allows to export the protein SRY in the nucleus.  &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The SRY protein activates the SOX9 (SRY-box9) gene &amp;lt;ref&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;., this gene is found in the 17 chromosom in the long arm 24.3 &amp;lt;ref&amp;gt; NCBI [http://www.ncbi.nlm.nih.gov/gene/6662] &amp;lt;/ref&amp;gt; and is implicated in the stimulation of the differentiation of sertori cells. The activation of sox 9 are done with protein SRY and another transcriptional factor: SF1 (steroidogenic factor 1). These transcriptional factors are bind in an enhancers called: TESCO (testis-specific enhancer of Sox9 core element). The fixation of transcriptional factor in enhancer provokes a curvature of DNA (90°C) allowing a stabilisation of the elongation complex on the SOX9 promoter. The SOX 9 protein activates the gene AMH (anti-mullerian hormone)&amp;lt;ref&amp;gt;[http://www.ebi.ac.uk/interpro/entry/IPR006799?q=AMH] &amp;lt;/ref&amp;gt; allows the reduction of the channels of Müller in male. &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==Structure==&lt;br /&gt;
&lt;br /&gt;
===The SRY-HMG domain (HMG-Box)===&lt;br /&gt;
&#039;&#039;&#039;SRY-HMG&#039;&#039;&#039; stands for &#039;&#039;&#039;S&#039;&#039;&#039;ex determining &#039;&#039;&#039;R&#039;&#039;&#039;egion &#039;&#039;&#039;Y&#039;&#039;&#039; - &#039;&#039;&#039;H&#039;&#039;&#039;igh &#039;&#039;&#039;M&#039;&#039;&#039;obility &#039;&#039;&#039;G&#039;&#039;&#039;roup domain.&lt;br /&gt;
It is approximately 80 residues long. It mediates the binding of the protein to the minor groove of DNA. It is the most important part of the SRY protein. Not only because it enable  the protein to bind the DNA but because even a little mutation can cause an inactivation of the protein.&lt;br /&gt;
&lt;br /&gt;
It has a Twisted L shape meaning that it has a long (28Å) and a short (22Å) arm. The HMG Box is made of 3 helices, its N-term and C-term are irregular. The overall structure is stabilized by a hydrophobic core especially at the intersection of the 3 helices where 3 aromatics cycles meet, surrounnded by aliphatic aminoacids.&lt;br /&gt;
&lt;br /&gt;
The interaction between the HMG-Box and DNA is specific and stable. It permits the bend of DNA (?75°). It is mostly hydrophobic interaction. Only one molecule of water interface the Box and the DNA. the complex is stabilized by salt bridges between positive charged residues of the HMG domain and negative charged phosphates.&amp;lt;ref&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[Image:HHMG-bitmap.png|thumb|alt=Image bitmap|Linear structure of hHMG domain]]&lt;br /&gt;
&lt;br /&gt;
The binding of SRY to DNA is specific. The DNA target site is a DNA octamer :&lt;br /&gt;
&lt;br /&gt;
(5&#039;-dGCACAAAC)&lt;br /&gt;
(5&#039;-dGTTTGTGC)&lt;br /&gt;
&lt;br /&gt;
This sequenece is found in the promoters of genes expressed during the testicular development&lt;br /&gt;
The bend of DNA permits the recruitment of different proteins and the build of massives proteins-DNA complexes that could change the expression of different genes. It is the role of a transcription factor.&amp;lt;ref&amp;gt;PMID:11563911&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
Even if the most important function of the HMG box is its capacity of binding and bending DNA, it is also involved in DNA condensation, recombination and DNA repair.&lt;br /&gt;
&lt;br /&gt;
There are 2 kinds of protein that contain a HMG box&lt;br /&gt;
* HMG1 : It is expressed in few cell types. It is found in transcription factors that contain a single HMG box. The bind to a DNA sequence is specific.&lt;br /&gt;
* HMG2 : Are found in all cell types and are abundant in chromatin. This proteins can contain two or more HMG boxes that can nonspecifically bind DNA. &lt;br /&gt;
&lt;br /&gt;
===General structure of SRY===&lt;br /&gt;
The overall structure of SRY is organized aroud the HMG-box.&lt;br /&gt;
3 domains:&lt;br /&gt;
* N-term domain&lt;br /&gt;
* Central domain : DNA binding (HMG box)&lt;br /&gt;
* C-term domain&lt;br /&gt;
&lt;br /&gt;
== Function ==&lt;br /&gt;
&lt;br /&gt;
===Sex determining===&lt;br /&gt;
It acts like a sex determinator thanks to it transcriptionnal activity. It inhibits the developpement of female sex structure in th embryonnic individual.&lt;br /&gt;
&lt;br /&gt;
==Implication - Future for SRY ?==&lt;br /&gt;
&lt;br /&gt;
== Disease ==&lt;br /&gt;
&lt;br /&gt;
=== Swyer syndrome (AKA XY gonadal dysgenis) :===&lt;br /&gt;
&lt;br /&gt;
	If the TDF protein is not able to bind its targeted DNA sequences, the genes responsible for the testis development are not expressed. The patient owning this defective protein will then develop female characters, even though he has a XY karyotype. This phenomenon is known as the « Swyer Syndrome ». &lt;br /&gt;
Different causes can explain this « XY gonadal dysgenis », as it is also called. About thirty mutations (named [http://www.uniprot.org/uniprot/Q05066#sequences &amp;quot;SRXY1&amp;quot;]) in the SRY gene have been shown to drive this phenotype development. It can also be due to crossovers during a meiosis. If a Y chromosome portion carrying the SRY gene is recombined into a X chromosome, a sperm cell will get this abnormal Y chromosome. If it then fecundates, a XY karyotype without any SRY gene will be formed. &lt;br /&gt;
&lt;br /&gt;
=== De La Chapelle syndrome (AKA XX male syndrome) :===&lt;br /&gt;
&lt;br /&gt;
From the meiosis just described would also result an abnormal X chromosome, carrying the SRY gene. If the sperm cell owning this chromosome fecundates an ovule, the resulting newborn will have a XX karyotype but a male phenotype. This is called the « De La Chapelle syndrome ». In this case, the patient can either develop testis or both testis and ovarian tissues. As some epigenetic mechanisms can inactivate the X chromosome carrying SRY, this syndrome keeps most of the patients sterile.&amp;lt;ref&amp;gt;PMID: 4622299&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
== Relevance ==&lt;br /&gt;
&lt;br /&gt;
== Structural highlights ==&lt;br /&gt;
&lt;br /&gt;
This is a sample scene created with SAT to &amp;lt;scene name=&amp;quot;/12/3456/Sample/1&amp;quot;&amp;gt;color&amp;lt;/scene&amp;gt; by Group, and another to make &amp;lt;scene name=&amp;quot;/12/3456/Sample/2&amp;quot;&amp;gt;a transparent representation&amp;lt;/scene&amp;gt; of the protein. You can make your own scenes on SAT starting from scratch or loading and editing one of these sample scenes.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;/StructureSection&amp;gt;&lt;br /&gt;
== References ==&lt;br /&gt;
[http://ghr.nlm.nih.gov/gene/SRY Genetic Home reference]&lt;br /&gt;
&amp;lt;references/&amp;gt;&lt;/div&gt;</summary>
		<author><name>Fantin Mesny</name></author>
	</entry>
	<entry>
		<id>https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2525331</id>
		<title>Sandbox Reserved 1120</title>
		<link rel="alternate" type="text/html" href="https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2525331"/>
		<updated>2016-01-28T09:44:11Z</updated>

		<summary type="html">&lt;p&gt;Fantin Mesny: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{Sandbox_Reserved_ESBS_2015}}&amp;lt;!-- PLEASE ADD YOUR CONTENT BELOW HERE --&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==SRY protein (AKA TDF protein)==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;StructureSection load=&#039;1hry&#039; size=&#039;340&#039; side=&#039;right&#039; caption=&#039;The SRY protein linked to DNA&#039; scene=&#039;&#039;&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The SRY protein is a 204 residues long monomeric polypeptide. It is a &#039;&#039;&#039;transcriptionnal factor&#039;&#039;&#039;, It activates the &#039;&#039;&#039;M&#039;&#039;&#039;üllerian &#039;&#039;&#039;I&#039;&#039;&#039;nhibiting &#039;&#039;&#039;S&#039;&#039;&#039;ubstance (&#039;&#039;&#039;MIS&#039;&#039;&#039; gene).&lt;br /&gt;
It is encoded by the [[testis-determining sex gene]] and is itself involved in the sex determination in mammels by being responsible for the gonadogenesis thus the male sexual developement. It is the HMG-box that gives to the protein its ability to bind DNA by its minor groove. &amp;lt;ref&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Properties===&lt;br /&gt;
&lt;br /&gt;
&amp;lt;table style=&amp;quot;width:100%&amp;quot;;border: 3px solid #A0A0A0&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Molecular weight&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Gene&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Length&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;DNA target sequence&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Genes targeted&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Inhibitors&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;/table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==History==&lt;br /&gt;
&lt;br /&gt;
After centuries of unfounded theories mainly based on environmental factors, the first molecular theory concerning the sex determination appeared in 1891. At this time, the german biologist Hermann Henking was studying sperm formation in wasps. As a chromosome which was not present in all the wasps looked different from the others, he suspected it to play a role in sex determination and called it the &amp;quot;X chromosome&amp;quot;.&lt;br /&gt;
Ten years later, Clarence Erwin McClung saw that this chromosome behaved differently during the meiosis and was only present in half the sperm cells of grasshoppers. As the main characteristic that varies in 50/50 proportions among zygotes is the sex, McClung suspected the X chromosome to be implicated in sexual development. &lt;br /&gt;
In 1905, Nettie Stevens discovered the &amp;quot;Y chromosome&amp;quot; (and the female XX and male XY patterns) while she was counting the chromosomes of beetles under the microscope&amp;lt;ref&amp;gt;Sumner, A. T. Sex Chromosomes and Sex Determination. Chromosomes: Organization and Function, 97-108. [http://www.nature.com/scitable/nated/topicpage/Sex-Chromosomes-and-Sex-Determination-44565]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
During the next decades, a few theories were in competition. In 1921, Calvin Bridges&#039;s works on &#039;&#039;Drosophila melanogaster&#039;&#039; seemed to reveal that male characters acquisition is due to a genic balance between the genes contained in the X chromosome and those contained in the autosomes&amp;lt;ref&amp;gt;PMID: 17769897&amp;lt;/ref&amp;gt;.&lt;br /&gt;
In 1930, Ronald Fisher introduced the first Y-based control of sex theory by proposing two different models : either all the genes responsible for the male characters are located on the Y chromosome or there is a Y-located gene which regulates the expression of genes elsewhere in the genome&amp;lt;ref&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt;.&lt;br /&gt;
As Alfred Jost had shown the testosterone produced by the testis is responsible for the entire male phenotype acquisition&amp;lt;ref&amp;gt;PMID: 4805859&amp;lt;/ref&amp;gt;, in 1988, Peter Neville Goodfellow proposed that there is a gene (&#039;&#039;TDF&#039;&#039; in human, &#039;&#039;Tdy&#039;&#039; in mice)  on the Y chromosome which drives the development of the testis.&amp;lt;ref&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt; In 1990, Goodfellow&#039;s hypothesis was validated with the discovery of &#039;&#039;Tdy&#039;&#039;&#039;s localisation. This gene&#039;s product (expressed during the male gonadal development) owns an amino-acid motif showing homology to other known or putative DNA-binding domains. &#039;&#039;Tdy&#039;&#039; is therefore a transcriptional factor&amp;lt;ref&amp;gt;PMID: 2374589&amp;lt;/ref&amp;gt;. The same year, the human &#039;&#039;SRY&#039;&#039; gene (accepted later as the &#039;&#039;TDF&#039;&#039;) was discovered&amp;lt;ref&amp;gt;PMID: 1695712&amp;lt;/ref&amp;gt;. &lt;br /&gt;
Three dimensional structure of the SRY protein was determined in 1995 using NMR spectroscopy&amp;lt;ref&amp;gt;PMID: 7774012&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==SRY gene==&lt;br /&gt;
&lt;br /&gt;
===Generality===&lt;br /&gt;
&lt;br /&gt;
The SRY gene encodes the SRY protein. The SRY protein is a transcriptional factor inducing the male phenotype in embryo. The SRY gene is located on the [https://en.wikipedia.org/wiki/Y_chromosome Y chromosom] in the short arm (p) 11.3 &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/gene/6736]&amp;lt;/ref&amp;gt;. This gene has only one exon containing the HMG domain (DNA-binding high-mobility group box domain). That&#039;s means that SRY mRNA does not have a alternative splicing, so there is one isoform of SRY protein.&amp;lt;ref&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;. Moreover,the human genome contains one copy of the SRY gene, whereas the mouse genome contains 6 copy of this gene. &amp;lt;ref&amp;gt; Sekido R, Lovell-Badge R. Genetic control of testis development. Sex Dev Genet Mol Biol Evol Endocrinol Embryol Pathol Sex Determ Differ. 2013;7(1-3):21–32 &amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Sequence of the SRY gene===&lt;br /&gt;
&amp;lt;div style=&amp;quot;width:100%; padding-top: 10px; padding-bottom: 10px;border: 3px dashed #A0A0A0; text-align: center;background: #ABE8C9;&amp;quot;&amp;gt;&lt;br /&gt;
&amp;gt;gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/nuccore]&amp;lt;/ref&amp;gt;&lt;br /&gt;
TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT&lt;br /&gt;
TTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACA&lt;br /&gt;
&#039;&#039;&#039;ATG&#039;&#039;&#039;CAATCATATGCTTCTGCTATGTTAAGCGTATTCAACAGCGATGATTACAGTCCAGCTGTGCAAGAGAAT&lt;br /&gt;
ATTCCCGCTCTCCGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTAAGTATCAGTGTGAAA&lt;br /&gt;
CGGGAGAAAACAGTAAAGGCAACGTCCA&#039;&#039;&#039;GGATAGAGTGAAGCGACCCATGAACGCATTCATCGTGTGGTC&lt;br /&gt;
&#039;&#039;&#039;TCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCAGAGATCAGCAAGCAGCTG&lt;br /&gt;
&#039;&#039;&#039;GGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCATTCTTCCAGGAGGCACAGAAATTACAGG&lt;br /&gt;
&#039;&#039;&#039;CCATGCACAGAGAGAAATACCCGAATTATAAGTATCGA&#039;&#039;&#039;CCTCGTCGGAAGGCGAAGATGCTGCCGAAGAA&lt;br /&gt;
TTGCAGTTTGCTTCCCGCAGATCCCGCTTCGGTACTCTGCAGCGAAGTGCAACTGGACAACAGGTTGTAC&lt;br /&gt;
AGGGATGACTGTACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAACG&lt;br /&gt;
CAGCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTG&#039;&#039;&#039;TAG&#039;&#039;&#039;GACAATCGGGTAACATT&lt;br /&gt;
GGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCACTTTCTTATGTTTAGTTT&lt;br /&gt;
CAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCATTTCA&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;&#039;legend of bold &#039;&#039;&#039;&lt;br /&gt;
&lt;br /&gt;
first: initiation codon&lt;br /&gt;
&lt;br /&gt;
second: HMG sequence&lt;br /&gt;
&lt;br /&gt;
third: stop codon&lt;br /&gt;
&lt;br /&gt;
===Regulation of the expression of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
In humans, the SRY promoter is found at −408 bp to −95 bp upstream of the ATG initiation codon. Moreover, the SRY gene has enhancers at -727 pb upstream of the ATG initiation codon. The linkage between regulatory proteins and this enhancers have the property to increase the production of SRY protein. These regulatory proteins could be: SF1 (steroidogenic factor 1), SP1  and WT 1 (Wilms tumor). &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
*SF1: this transcriptional factor belong to the family of nuclear hormone receptor and contains a zinc finger. The activation of this protein requires a ligand (hormone).&lt;br /&gt;
&lt;br /&gt;
*SP1: this transciprional factor is a ubiquitous protein binding in site containing rich-GC sequences and implicated in the transcription of many genes. Moreover, this protein contains a zinc finger.&lt;br /&gt;
&lt;br /&gt;
*WT1:this transcriptional factor transactives SRY gene, it contains a zinc finger. &amp;lt;ref&amp;gt;Larney C, Bailey TL, Koopman P. Switching on sex: transcriptional regulation of the testis-determining gene Sry. Dev Camb Engl. 2014 Jun;141(11):2195–205. &amp;lt;/ref&amp;gt; &lt;br /&gt;
&lt;br /&gt;
=== Role of the SRY gene ===&lt;br /&gt;
&lt;br /&gt;
The SRY protein is a transcription factor, which contains nuclear localization domains in N terminal and C terminal. An acetylation on these domains allows to export the protein SRY in the nucleus.  &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The SRY protein activates the SOX9 (SRY-box9) gene &amp;lt;ref&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;., this gene is found in the 17 chromosom in the long arm 24.3 &amp;lt;ref&amp;gt; NCBI [http://www.ncbi.nlm.nih.gov/gene/6662] &amp;lt;/ref&amp;gt; and is implicated in the stimulation of the differentiation of sertori cells. The activation of sox 9 are done with protein SRY and another transcriptional factor: SF1 (steroidogenic factor 1). These transcriptional factors are bind in an enhancers called: TESCO (testis-specific enhancer of Sox9 core element). The fixation of transcriptional factor in enhancer provokes a curvature of DNA (90°C) allowing a stabilisation of the elongation complex on the SOX9 promoter. The SOX 9 protein activates the gene AMH (anti-mullerian hormone)&amp;lt;ref&amp;gt;[http://www.ebi.ac.uk/interpro/entry/IPR006799?q=AMH] &amp;lt;/ref&amp;gt; allows the reduction of the channels of Müller in male. &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==Structure==&lt;br /&gt;
&lt;br /&gt;
===The SRY-HMG domain (HMG-Box)===&lt;br /&gt;
&#039;&#039;&#039;SRY-HMG&#039;&#039;&#039; stands for &#039;&#039;&#039;S&#039;&#039;&#039;ex determining &#039;&#039;&#039;R&#039;&#039;&#039;egion &#039;&#039;&#039;Y&#039;&#039;&#039; - &#039;&#039;&#039;H&#039;&#039;&#039;igh &#039;&#039;&#039;M&#039;&#039;&#039;obility &#039;&#039;&#039;G&#039;&#039;&#039;roup domain.&lt;br /&gt;
It is approximately 80 residues long. It mediates the binding of the protein to the minor groove of DNA. It is the most important part of the SRY protein. Not only because it enable  the protein to bind the DNA but because even a little mutation can cause an inactivation of the protein.&lt;br /&gt;
&lt;br /&gt;
It has a Twisted L shape meaning that it has a long (28Å) and a short (22Å) arm. The HMG Box is made of 3 helices, its N-term and C-term are irregular. The overall structure is stabilized by a hydrophobic core especially at the intersection of the 3 helices where 3 aromatics cycles meet, surrounnded by aliphatic aminoacids.&lt;br /&gt;
&lt;br /&gt;
The interaction between the HMG-Box and DNA is specific and stable. It permits the bend of DNA (?75°). It is mostly hydrophobic interaction. Only one molecule of water interface the Box and the DNA. the complex is stabilized by salt bridges between positive charged residues of the HMG domain and negative charged phosphates.&amp;lt;ref&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[Image:HHMG-bitmap.png|thumb|alt=Image bitmap|Linear structure of hHMG domain]]&lt;br /&gt;
&lt;br /&gt;
The binding of SRY to DNA is specific. The DNA target site is a DNA octamer :&lt;br /&gt;
&lt;br /&gt;
(5&#039;-dGCACAAAC)&lt;br /&gt;
(5&#039;-dGTTTGTGC)&lt;br /&gt;
&lt;br /&gt;
This sequenece is found in the promoters of genes expressed during the testicular development&lt;br /&gt;
The bend of DNA permits the recruitment of different proteins and the build of massives proteins-DNA complexes that could change the expression of different genes. It is the role of a transcription factor.&amp;lt;ref&amp;gt;PMID:11563911&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
Even if the most important function of the HMG box is its capacity of binding and bending DNA, it is also involved in DNA condensation, recombination and DNA repair.&lt;br /&gt;
&lt;br /&gt;
There are 2 kinds of protein that contain a HMG box&lt;br /&gt;
* HMG1 : It is expressed in few cell types. It is found in transcription factors that contain a single HMG box. The bind to a DNA sequence is specific.&lt;br /&gt;
* HMG2 : Are found in all cell types and are abundant in chromatin. This proteins can contain two or more HMG boxes that can nonspecifically bind DNA. &lt;br /&gt;
&lt;br /&gt;
===General structure of SRY===&lt;br /&gt;
The overall structure of SRY is organized aroud the HMG-box.&lt;br /&gt;
3 domains:&lt;br /&gt;
* N-term domain&lt;br /&gt;
* Central domain : DNA binding (HMG box)&lt;br /&gt;
* C-term domain&lt;br /&gt;
&lt;br /&gt;
== Function ==&lt;br /&gt;
&lt;br /&gt;
===Sex determining===&lt;br /&gt;
It acts like a sex determinator thanks to it transcriptionnal activity. It inhibits the developpement of female sex structure in th embryonnic individual.&lt;br /&gt;
&lt;br /&gt;
==Implication - Future for SRY ?==&lt;br /&gt;
&lt;br /&gt;
== Disease ==&lt;br /&gt;
&lt;br /&gt;
=== Swyer syndrome (AKA XY gonadal dysgenis) :===&lt;br /&gt;
&lt;br /&gt;
	If the TDF protein is not able to bind its targeted DNA sequences, the genes responsible for the testis development are not expressed. The patient owning this defective protein will then develop female characters, even though he has a XY karyotype. This phenomenon is known as the « Swyer Syndrome ». &lt;br /&gt;
Different causes can explain this « XY gonadal dysgenis », as it is also called. About thirty mutations (named [http://www.uniprot.org/uniprot/Q05066#sequences &amp;quot;SRXY1&amp;quot;]) in the SRY gene have been shown to drive this phenotype development. It can also be due to crossovers during a meiosis. If a Y chromosome portion carrying the SRY gene is recombined into a X chromosome, a sperm cell will get this abnormal Y chromosome. If it then fecundates, a XY karyotype without any SRY gene will be formed. &lt;br /&gt;
&lt;br /&gt;
=== De La Chapelle syndrome (AKA XX male syndrome) :===&lt;br /&gt;
&lt;br /&gt;
From the meiosis just described would also result an abnormal X chromosome, carrying the SRY gene. If the sperm cell owning this chromosome fecundates an ovule, the resulting newborn will have a XX karyotype but a male phenotype. This is called the « De La Chapelle syndrome ». In this case, the patient can either develop testis or both testis and ovarian tissues. As some epigenetic mechanisms can inactivate the X chromosome carrying SRY, this syndrome keeps most of the patients sterile.&amp;lt;ref&amp;gt;PMID: 4622299&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
== Relevance ==&lt;br /&gt;
&lt;br /&gt;
== Structural highlights ==&lt;br /&gt;
&lt;br /&gt;
This is a sample scene created with SAT to &amp;lt;scene name=&amp;quot;/12/3456/Sample/1&amp;quot;&amp;gt;color&amp;lt;/scene&amp;gt; by Group, and another to make &amp;lt;scene name=&amp;quot;/12/3456/Sample/2&amp;quot;&amp;gt;a transparent representation&amp;lt;/scene&amp;gt; of the protein. You can make your own scenes on SAT starting from scratch or loading and editing one of these sample scenes.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;/StructureSection&amp;gt;&lt;br /&gt;
== References ==&lt;br /&gt;
[http://ghr.nlm.nih.gov/gene/SRY Genetic Home reference]&lt;br /&gt;
&amp;lt;references/&amp;gt;&lt;/div&gt;</summary>
		<author><name>Fantin Mesny</name></author>
	</entry>
	<entry>
		<id>https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2525330</id>
		<title>Sandbox Reserved 1120</title>
		<link rel="alternate" type="text/html" href="https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2525330"/>
		<updated>2016-01-28T09:42:36Z</updated>

		<summary type="html">&lt;p&gt;Fantin Mesny: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{Sandbox_Reserved_ESBS_2015}}&amp;lt;!-- PLEASE ADD YOUR CONTENT BELOW HERE --&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==SRY protein (AKA TDF protein)==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;StructureSection load=&#039;1hry&#039; size=&#039;340&#039; side=&#039;right&#039; caption=&#039;The SRY protein linked to DNA&#039; scene=&#039;&#039;&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The SRY protein is a 204 residues long monomeric polypeptide. It is a &#039;&#039;&#039;transcriptionnal factor&#039;&#039;&#039;, It activates the &#039;&#039;&#039;M&#039;&#039;&#039;üllerian &#039;&#039;&#039;I&#039;&#039;&#039;nhibiting &#039;&#039;&#039;S&#039;&#039;&#039;ubstance (&#039;&#039;&#039;MIS&#039;&#039;&#039; gene).&lt;br /&gt;
It is encoded by the [[testis-determining sex gene]] and is itself involved in the sex determination in mammels by being responsible for the gonadogenesis thus the male sexual developement. It is the HMG-box that gives to the protein its ability to bind DNA by its minor groove. &amp;lt;ref&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Properties===&lt;br /&gt;
&lt;br /&gt;
&amp;lt;table style=&amp;quot;width:100%&amp;quot;;border: 3px solid #A0A0A0&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Molecular weight&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Gene&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Length&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;DNA target sequence&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Genes targeted&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Inhibitors&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;/table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==History==&lt;br /&gt;
&lt;br /&gt;
After centuries of unfounded theories mainly based on environmental factors, the first molecular theory concerning the sex determination appeared in 1891. At this time, the german biologist Hermann Henking was studying sperm formation in wasps. As a chromosome which was not present in all the wasps looked different from the others, he suspected it to play a role in sex determination and called it the &amp;quot;X chromosome&amp;quot;.&lt;br /&gt;
Ten years later, Clarence Erwin McClung saw that this chromosome behaved differently during the meiosis and was only present in half the sperm cells of grasshoppers. As the main characteristic that varies in 50/50 proportions among zygotes is the sex, McClung suspected the X chromosome to be implicated in sexual development. &lt;br /&gt;
In 1905, Nettie Stevens discovered the &amp;quot;Y chromosome&amp;quot; (and the female XX and male XY patterns) while she was counting the chromosomes of beetles under the microscope&amp;lt;ref&amp;gt;Sumner, A. T. Sex Chromosomes and Sex Determination. Chromosomes: Organization and Function, 97-108. [http://www.nature.com/scitable/nated/topicpage/Sex-Chromosomes-and-Sex-Determination-44565]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
During the next decades, a few theories were in competition. In 1921, Calvin Bridges&#039;s works on &#039;&#039;Drosophila melanogaster&#039;&#039; seemed to reveal that male characters acquisition is due to a genic balance between the genes contained in the X chromosome and those contained in the autosomes&amp;lt;ref&amp;gt;PMID: 17769897&amp;lt;/ref&amp;gt;.&lt;br /&gt;
In 1930, Ronald Fisher introduced the first Y-based control of sex theory by proposing two different models : either all the genes responsible for the male characters are located on the Y chromosome or there is a Y-located gene which regulates the expression of genes elsewhere in the genome&amp;lt;ref&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt;.&lt;br /&gt;
As Alfred Jost had shown the testosterone produced by the testis is responsible for the entire male phenotype acquisition&amp;lt;ref&amp;gt;PMID: 4805859&amp;lt;/ref&amp;gt;, in 1988, Peter Neville Goodfellow proposed that there is a gene (&#039;&#039;TDF&#039;&#039; in human, &#039;&#039;Tdy&#039;&#039; in mice)  on the Y chromosome which drives the development of the testis.&amp;lt;ref&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt; In 1990, Goodfellow&#039;s hypothesis was validated with the discovery of &#039;&#039;Tdy&#039;&#039;&#039;s localisation. This gene&#039;s product (expressed during the male gonadal development) owns an amino-acid motif showing homology to other known or putative DNA-binding domains. &#039;&#039;Tdy&#039;&#039; is therefore a transcriptional factor&amp;lt;ref&amp;gt;PMID: 2374589&amp;lt;/ref&amp;gt;. The same year, the human &#039;&#039;SRY&#039;&#039; gene (accepted later as the &#039;&#039;TDF&#039;&#039;) was discovered&amp;lt;ref&amp;gt;PMID: 1695712&amp;lt;/ref&amp;gt;. &lt;br /&gt;
Three dimensional structure of the SRY protein was determined in 1995 using NMR spectroscopy&amp;lt;ref&amp;gt;PMID: 7774012&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==SRY gene==&lt;br /&gt;
&lt;br /&gt;
===Generality===&lt;br /&gt;
&lt;br /&gt;
The SRY gene encodes the SRY protein. The SRY protein is a transcriptional factor inducing the male phenotype in embryo. The SRY gene is located on the [https://en.wikipedia.org/wiki/Y_chromosome Y chromosom] in the short arm (p) 11.3 &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/gene/6736]&amp;lt;/ref&amp;gt;. This gene has only one exon containing the HMG domain (DNA-binding high-mobility group box domain). That&#039;s means that SRY mRNA does not have a alternative splicing, so there is one isoform of SRY protein.&amp;lt;ref&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;. Moreover,the human genome contains one copy of the SRY gene, whereas the mouse genome contains 6 copy of this gene. &amp;lt;ref&amp;gt; Sekido R, Lovell-Badge R. Genetic control of testis development. Sex Dev Genet Mol Biol Evol Endocrinol Embryol Pathol Sex Determ Differ. 2013;7(1-3):21–32 &amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Sequence of the SRY gene===&lt;br /&gt;
&amp;lt;div style=&amp;quot;width:100%; padding-top: 50px; padding-bottom: 50px;border: 3px solid #A0A0A0; text-align: center;background: #ABE8C9;&amp;quot;&amp;gt;&lt;br /&gt;
&amp;gt;gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/nuccore]&amp;lt;/ref&amp;gt;&lt;br /&gt;
TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT&lt;br /&gt;
TTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACA&lt;br /&gt;
&#039;&#039;&#039;ATG&#039;&#039;&#039;CAATCATATGCTTCTGCTATGTTAAGCGTATTCAACAGCGATGATTACAGTCCAGCTGTGCAAGAGAAT&lt;br /&gt;
ATTCCCGCTCTCCGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTAAGTATCAGTGTGAAA&lt;br /&gt;
CGGGAGAAAACAGTAAAGGCAACGTCCA&#039;&#039;&#039;GGATAGAGTGAAGCGACCCATGAACGCATTCATCGTGTGGTC&lt;br /&gt;
&#039;&#039;&#039;TCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCAGAGATCAGCAAGCAGCTG&lt;br /&gt;
&#039;&#039;&#039;GGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCATTCTTCCAGGAGGCACAGAAATTACAGG&lt;br /&gt;
&#039;&#039;&#039;CCATGCACAGAGAGAAATACCCGAATTATAAGTATCGA&#039;&#039;&#039;CCTCGTCGGAAGGCGAAGATGCTGCCGAAGAA&lt;br /&gt;
TTGCAGTTTGCTTCCCGCAGATCCCGCTTCGGTACTCTGCAGCGAAGTGCAACTGGACAACAGGTTGTAC&lt;br /&gt;
AGGGATGACTGTACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAACG&lt;br /&gt;
CAGCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTG&#039;&#039;&#039;TAG&#039;&#039;&#039;GACAATCGGGTAACATT&lt;br /&gt;
GGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCACTTTCTTATGTTTAGTTT&lt;br /&gt;
CAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCATTTCA&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;&#039;legend of bold &#039;&#039;&#039;&lt;br /&gt;
&lt;br /&gt;
first: initiation codon&lt;br /&gt;
&lt;br /&gt;
second: HMG sequence&lt;br /&gt;
&lt;br /&gt;
third: stop codon&lt;br /&gt;
&lt;br /&gt;
===Regulation of the expression of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
In humans, the SRY promoter is found at −408 bp to −95 bp upstream of the ATG initiation codon. Moreover, the SRY gene has enhancers at -727 pb upstream of the ATG initiation codon. The linkage between regulatory proteins and this enhancers have the property to increase the production of SRY protein. These regulatory proteins could be: SF1 (steroidogenic factor 1), SP1  and WT 1 (Wilms tumor). &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
*SF1: this transcriptional factor belong to the family of nuclear hormone receptor and contains a zinc finger. The activation of this protein requires a ligand (hormone).&lt;br /&gt;
&lt;br /&gt;
*SP1: this transciprional factor is a ubiquitous protein binding in site containing rich-GC sequences and implicated in the transcription of many genes. Moreover, this protein contains a zinc finger.&lt;br /&gt;
&lt;br /&gt;
*WT1:this transcriptional factor transactives SRY gene, it contains a zinc finger. &amp;lt;ref&amp;gt;Larney C, Bailey TL, Koopman P. Switching on sex: transcriptional regulation of the testis-determining gene Sry. Dev Camb Engl. 2014 Jun;141(11):2195–205. &amp;lt;/ref&amp;gt; &lt;br /&gt;
&lt;br /&gt;
=== Role of the SRY gene ===&lt;br /&gt;
&lt;br /&gt;
The SRY protein is a transcription factor, which contains nuclear localization domains in N terminal and C terminal. An acetylation on these domains allows to export the protein SRY in the nucleus.  &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The SRY protein activates the SOX9 (SRY-box9) gene &amp;lt;ref&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;., this gene is found in the 17 chromosom in the long arm 24.3 &amp;lt;ref&amp;gt; NCBI [http://www.ncbi.nlm.nih.gov/gene/6662] &amp;lt;/ref&amp;gt; and is implicated in the stimulation of the differentiation of sertori cells. The activation of sox 9 are done with protein SRY and another transcriptional factor: SF1 (steroidogenic factor 1). These transcriptional factors are bind in an enhancers called: TESCO (testis-specific enhancer of Sox9 core element). The fixation of transcriptional factor in enhancer provokes a curvature of DNA (90°C) allowing a stabilisation of the elongation complex on the SOX9 promoter. The SOX 9 protein activates the gene AMH (anti-mullerian hormone)&amp;lt;ref&amp;gt;[http://www.ebi.ac.uk/interpro/entry/IPR006799?q=AMH] &amp;lt;/ref&amp;gt; allows the reduction of the channels of Müller in male. &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==Structure==&lt;br /&gt;
&lt;br /&gt;
===The SRY-HMG domain (HMG-Box)===&lt;br /&gt;
&#039;&#039;&#039;SRY-HMG&#039;&#039;&#039; stands for &#039;&#039;&#039;S&#039;&#039;&#039;ex determining &#039;&#039;&#039;R&#039;&#039;&#039;egion &#039;&#039;&#039;Y&#039;&#039;&#039; - &#039;&#039;&#039;H&#039;&#039;&#039;igh &#039;&#039;&#039;M&#039;&#039;&#039;obility &#039;&#039;&#039;G&#039;&#039;&#039;roup domain.&lt;br /&gt;
It is approximately 80 residues long. It mediates the binding of the protein to the minor groove of DNA. It is the most important part of the SRY protein. Not only because it enable  the protein to bind the DNA but because even a little mutation can cause an inactivation of the protein.&lt;br /&gt;
&lt;br /&gt;
It has a Twisted L shape meaning that it has a long (28Å) and a short (22Å) arm. The HMG Box is made of 3 helices, its N-term and C-term are irregular. The overall structure is stabilized by a hydrophobic core especially at the intersection of the 3 helices where 3 aromatics cycles meet, surrounnded by aliphatic aminoacids.&lt;br /&gt;
&lt;br /&gt;
The interaction between the HMG-Box and DNA is specific and stable. It permits the bend of DNA (?75°). It is mostly hydrophobic interaction. Only one molecule of water interface the Box and the DNA. the complex is stabilized by salt bridges between positive charged residues of the HMG domain and negative charged phosphates.&amp;lt;ref&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[Image:HHMG-bitmap.png|thumb|alt=Image bitmap|Linear structure of hHMG domain]]&lt;br /&gt;
&lt;br /&gt;
The binding of SRY to DNA is specific. The DNA target site is a DNA octamer :&lt;br /&gt;
&lt;br /&gt;
(5&#039;-dGCACAAAC)&lt;br /&gt;
(5&#039;-dGTTTGTGC)&lt;br /&gt;
&lt;br /&gt;
This sequenece is found in the promoters of genes expressed during the testicular development&lt;br /&gt;
The bend of DNA permits the recruitment of different proteins and the build of massives proteins-DNA complexes that could change the expression of different genes. It is the role of a transcription factor.&amp;lt;ref&amp;gt;PMID:11563911&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
Even if the most important function of the HMG box is its capacity of binding and bending DNA, it is also involved in DNA condensation, recombination and DNA repair.&lt;br /&gt;
&lt;br /&gt;
There are 2 kinds of protein that contain a HMG box&lt;br /&gt;
* HMG1 : It is expressed in few cell types. It is found in transcription factors that contain a single HMG box. The bind to a DNA sequence is specific.&lt;br /&gt;
* HMG2 : Are found in all cell types and are abundant in chromatin. This proteins can contain two or more HMG boxes that can nonspecifically bind DNA. &lt;br /&gt;
&lt;br /&gt;
===General structure of SRY===&lt;br /&gt;
The overall structure of SRY is organized aroud the HMG-box.&lt;br /&gt;
3 domains:&lt;br /&gt;
* N-term domain&lt;br /&gt;
* Central domain : DNA binding (HMG box)&lt;br /&gt;
* C-term domain&lt;br /&gt;
&lt;br /&gt;
== Function ==&lt;br /&gt;
&lt;br /&gt;
===Sex determining===&lt;br /&gt;
It acts like a sex determinator thanks to it transcriptionnal activity. It inhibits the developpement of female sex structure in th embryonnic individual.&lt;br /&gt;
&lt;br /&gt;
==Implication - Future for SRY ?==&lt;br /&gt;
&lt;br /&gt;
== Disease ==&lt;br /&gt;
&lt;br /&gt;
=== Swyer syndrome (AKA XY gonadal dysgenis) :===&lt;br /&gt;
&lt;br /&gt;
	If the TDF protein is not able to bind its targeted DNA sequences, the genes responsible for the testis development are not expressed. The patient owning this defective protein will then develop female characters, even though he has a XY karyotype. This phenomenon is known as the « Swyer Syndrome ». &lt;br /&gt;
Different causes can explain this « XY gonadal dysgenis », as it is also called. About thirty mutations (named [http://www.uniprot.org/uniprot/Q05066#sequences &amp;quot;SRXY1&amp;quot;]) in the SRY gene have been shown to drive this phenotype development. It can also be due to crossovers during a meiosis. If a Y chromosome portion carrying the SRY gene is recombined into a X chromosome, a sperm cell will get this abnormal Y chromosome. If it then fecundates, a XY karyotype without any SRY gene will be formed. &lt;br /&gt;
&lt;br /&gt;
=== De La Chapelle syndrome (AKA XX male syndrome) :===&lt;br /&gt;
&lt;br /&gt;
From the meiosis just described would also result an abnormal X chromosome, carrying the SRY gene. If the sperm cell owning this chromosome fecundates an ovule, the resulting newborn will have a XX karyotype but a male phenotype. This is called the « De La Chapelle syndrome ». In this case, the patient can either develop testis or both testis and ovarian tissues. As some epigenetic mechanisms can inactivate the X chromosome carrying SRY, this syndrome keeps most of the patients sterile.&amp;lt;ref&amp;gt;PMID: 4622299&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
== Relevance ==&lt;br /&gt;
&lt;br /&gt;
== Structural highlights ==&lt;br /&gt;
&lt;br /&gt;
This is a sample scene created with SAT to &amp;lt;scene name=&amp;quot;/12/3456/Sample/1&amp;quot;&amp;gt;color&amp;lt;/scene&amp;gt; by Group, and another to make &amp;lt;scene name=&amp;quot;/12/3456/Sample/2&amp;quot;&amp;gt;a transparent representation&amp;lt;/scene&amp;gt; of the protein. You can make your own scenes on SAT starting from scratch or loading and editing one of these sample scenes.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;/StructureSection&amp;gt;&lt;br /&gt;
== References ==&lt;br /&gt;
[http://ghr.nlm.nih.gov/gene/SRY Genetic Home reference]&lt;br /&gt;
&amp;lt;references/&amp;gt;&lt;/div&gt;</summary>
		<author><name>Fantin Mesny</name></author>
	</entry>
	<entry>
		<id>https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2525328</id>
		<title>Sandbox Reserved 1120</title>
		<link rel="alternate" type="text/html" href="https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2525328"/>
		<updated>2016-01-28T09:39:50Z</updated>

		<summary type="html">&lt;p&gt;Fantin Mesny: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{Sandbox_Reserved_ESBS_2015}}&amp;lt;!-- PLEASE ADD YOUR CONTENT BELOW HERE --&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==SRY protein (AKA TDF protein)==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;StructureSection load=&#039;1hry&#039; size=&#039;340&#039; side=&#039;right&#039; caption=&#039;The SRY protein linked to DNA&#039; scene=&#039;&#039;&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The SRY protein is a 204 residues long monomeric polypeptide. It is a &#039;&#039;&#039;transcriptionnal factor&#039;&#039;&#039;, It activates the &#039;&#039;&#039;M&#039;&#039;&#039;üllerian &#039;&#039;&#039;I&#039;&#039;&#039;nhibiting &#039;&#039;&#039;S&#039;&#039;&#039;ubstance (&#039;&#039;&#039;MIS&#039;&#039;&#039; gene).&lt;br /&gt;
It is encoded by the [[testis-determining sex gene]] and is itself involved in the sex determination in mammels by being responsible for the gonadogenesis thus the male sexual developement. It is the HMG-box that gives to the protein its ability to bind DNA by its minor groove. &amp;lt;ref&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Properties===&lt;br /&gt;
&lt;br /&gt;
&amp;lt;table style=&amp;quot;width:100%&amp;quot;&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Molecular weight&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Gene&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Length&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;DNA target sequence&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Genes targeted&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Inhibitors&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;/table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==History==&lt;br /&gt;
&lt;br /&gt;
After centuries of unfounded theories mainly based on environmental factors, the first molecular theory concerning the sex determination appeared in 1891. At this time, the german biologist Hermann Henking was studying sperm formation in wasps. As a chromosome which was not present in all the wasps looked different from the others, he suspected it to play a role in sex determination and called it the &amp;quot;X chromosome&amp;quot;.&lt;br /&gt;
Ten years later, Clarence Erwin McClung saw that this chromosome behaved differently during the meiosis and was only present in half the sperm cells of grasshoppers. As the main characteristic that varies in 50/50 proportions among zygotes is the sex, McClung suspected the X chromosome to be implicated in sexual development. &lt;br /&gt;
In 1905, Nettie Stevens discovered the &amp;quot;Y chromosome&amp;quot; (and the female XX and male XY patterns) while she was counting the chromosomes of beetles under the microscope&amp;lt;ref&amp;gt;Sumner, A. T. Sex Chromosomes and Sex Determination. Chromosomes: Organization and Function, 97-108. [http://www.nature.com/scitable/nated/topicpage/Sex-Chromosomes-and-Sex-Determination-44565]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
During the next decades, a few theories were in competition. In 1921, Calvin Bridges&#039;s works on &#039;&#039;Drosophila melanogaster&#039;&#039; seemed to reveal that male characters acquisition is due to a genic balance between the genes contained in the X chromosome and those contained in the autosomes&amp;lt;ref&amp;gt;PMID: 17769897&amp;lt;/ref&amp;gt;.&lt;br /&gt;
In 1930, Ronald Fisher introduced the first Y-based control of sex theory by proposing two different models : either all the genes responsible for the male characters are located on the Y chromosome or there is a Y-located gene which regulates the expression of genes elsewhere in the genome&amp;lt;ref&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt;.&lt;br /&gt;
As Alfred Jost had shown the testosterone produced by the testis is responsible for the entire male phenotype acquisition&amp;lt;ref&amp;gt;PMID: 4805859&amp;lt;/ref&amp;gt;, in 1988, Peter Neville Goodfellow proposed that there is a gene (&#039;&#039;TDF&#039;&#039; in human, &#039;&#039;Tdy&#039;&#039; in mice)  on the Y chromosome which drives the development of the testis.&amp;lt;ref&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt; In 1990, Goodfellow&#039;s hypothesis was validated with the discovery of &#039;&#039;Tdy&#039;&#039;&#039;s localisation. This gene&#039;s product (expressed during the male gonadal development) owns an amino-acid motif showing homology to other known or putative DNA-binding domains. &#039;&#039;Tdy&#039;&#039; is therefore a transcriptional factor&amp;lt;ref&amp;gt;PMID: 2374589&amp;lt;/ref&amp;gt;. The same year, the human &#039;&#039;SRY&#039;&#039; gene (accepted later as the &#039;&#039;TDF&#039;&#039;) was discovered&amp;lt;ref&amp;gt;PMID: 1695712&amp;lt;/ref&amp;gt;. &lt;br /&gt;
Three dimensional structure of the SRY protein was determined in 1995 using NMR spectroscopy&amp;lt;ref&amp;gt;PMID: 7774012&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==SRY gene==&lt;br /&gt;
&lt;br /&gt;
===Generality===&lt;br /&gt;
&lt;br /&gt;
The SRY gene encodes the SRY protein. The SRY protein is a transcriptional factor inducing the male phenotype in embryo. The SRY gene is located on the [https://en.wikipedia.org/wiki/Y_chromosome Y chromosom] in the short arm (p) 11.3 &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/gene/6736]&amp;lt;/ref&amp;gt;. This gene has only one exon containing the HMG domain (DNA-binding high-mobility group box domain). That&#039;s means that SRY mRNA does not have a alternative splicing, so there is one isoform of SRY protein.&amp;lt;ref&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;. Moreover,the human genome contains one copy of the SRY gene, whereas the mouse genome contains 6 copy of this gene. &amp;lt;ref&amp;gt; Sekido R, Lovell-Badge R. Genetic control of testis development. Sex Dev Genet Mol Biol Evol Endocrinol Embryol Pathol Sex Determ Differ. 2013;7(1-3):21–32 &amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Sequence of the SRY gene===&lt;br /&gt;
&amp;lt;div style=&amp;quot;width: 200px; padding-top: 50px; padding-bottom: 50px;border: 3px solid #A0A0A0; text-align: center;background: #C0C0C0;&amp;quot;&amp;gt;&lt;br /&gt;
&amp;gt;gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/nuccore]&amp;lt;/ref&amp;gt;&lt;br /&gt;
TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT&lt;br /&gt;
TTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACA&lt;br /&gt;
&#039;&#039;&#039;ATG&#039;&#039;&#039;CAATCATATGCTTCTGCTATGTTAAGCGTATTCAACAGCGATGATTACAGTCCAGCTGTGCAAGAGAAT&lt;br /&gt;
ATTCCCGCTCTCCGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTAAGTATCAGTGTGAAA&lt;br /&gt;
CGGGAGAAAACAGTAAAGGCAACGTCCA&#039;&#039;&#039;GGATAGAGTGAAGCGACCCATGAACGCATTCATCGTGTGGTC&lt;br /&gt;
&#039;&#039;&#039;TCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCAGAGATCAGCAAGCAGCTG&lt;br /&gt;
&#039;&#039;&#039;GGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCATTCTTCCAGGAGGCACAGAAATTACAGG&lt;br /&gt;
&#039;&#039;&#039;CCATGCACAGAGAGAAATACCCGAATTATAAGTATCGA&#039;&#039;&#039;CCTCGTCGGAAGGCGAAGATGCTGCCGAAGAA&lt;br /&gt;
TTGCAGTTTGCTTCCCGCAGATCCCGCTTCGGTACTCTGCAGCGAAGTGCAACTGGACAACAGGTTGTAC&lt;br /&gt;
AGGGATGACTGTACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAACG&lt;br /&gt;
CAGCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTG&#039;&#039;&#039;TAG&#039;&#039;&#039;GACAATCGGGTAACATT&lt;br /&gt;
GGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCACTTTCTTATGTTTAGTTT&lt;br /&gt;
CAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCATTTCA&lt;br /&gt;
&amp;lt;/div&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;&#039;legend of bold &#039;&#039;&#039;&lt;br /&gt;
&lt;br /&gt;
first: initiation codon&lt;br /&gt;
&lt;br /&gt;
second: HMG sequence&lt;br /&gt;
&lt;br /&gt;
third: stop codon&lt;br /&gt;
&lt;br /&gt;
===Regulation of the expression of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
In humans, the SRY promoter is found at −408 bp to −95 bp upstream of the ATG initiation codon. Moreover, the SRY gene has enhancers at -727 pb upstream of the ATG initiation codon. The linkage between regulatory proteins and this enhancers have the property to increase the production of SRY protein. These regulatory proteins could be: SF1 (steroidogenic factor 1), SP1  and WT 1 (Wilms tumor). &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
*SF1: this transcriptional factor belong to the family of nuclear hormone receptor and contains a zinc finger. The activation of this protein requires a ligand (hormone).&lt;br /&gt;
&lt;br /&gt;
*SP1: this transciprional factor is a ubiquitous protein binding in site containing rich-GC sequences and implicated in the transcription of many genes. Moreover, this protein contains a zinc finger.&lt;br /&gt;
&lt;br /&gt;
*WT1:this transcriptional factor transactives SRY gene, it contains a zinc finger. &amp;lt;ref&amp;gt;Larney C, Bailey TL, Koopman P. Switching on sex: transcriptional regulation of the testis-determining gene Sry. Dev Camb Engl. 2014 Jun;141(11):2195–205. &amp;lt;/ref&amp;gt; &lt;br /&gt;
&lt;br /&gt;
=== Role of the SRY gene ===&lt;br /&gt;
&lt;br /&gt;
The SRY protein is a transcription factor, which contains nuclear localization domains in N terminal and C terminal. An acetylation on these domains allows to export the protein SRY in the nucleus.  &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The SRY protein activates the SOX9 (SRY-box9) gene &amp;lt;ref&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;., this gene is found in the 17 chromosom in the long arm 24.3 &amp;lt;ref&amp;gt; NCBI [http://www.ncbi.nlm.nih.gov/gene/6662] &amp;lt;/ref&amp;gt; and is implicated in the stimulation of the differentiation of sertori cells. The activation of sox 9 are done with protein SRY and another transcriptional factor: SF1 (steroidogenic factor 1). These transcriptional factors are bind in an enhancers called: TESCO (testis-specific enhancer of Sox9 core element). The fixation of transcriptional factor in enhancer provokes a curvature of DNA (90°C) allowing a stabilisation of the elongation complex on the SOX9 promoter. The SOX 9 protein activates the gene AMH (anti-mullerian hormone)&amp;lt;ref&amp;gt;[http://www.ebi.ac.uk/interpro/entry/IPR006799?q=AMH] &amp;lt;/ref&amp;gt; allows the reduction of the channels of Müller in male. &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==Structure==&lt;br /&gt;
&lt;br /&gt;
===The SRY-HMG domain (HMG-Box)===&lt;br /&gt;
&#039;&#039;&#039;SRY-HMG&#039;&#039;&#039; stands for &#039;&#039;&#039;S&#039;&#039;&#039;ex determining &#039;&#039;&#039;R&#039;&#039;&#039;egion &#039;&#039;&#039;Y&#039;&#039;&#039; - &#039;&#039;&#039;H&#039;&#039;&#039;igh &#039;&#039;&#039;M&#039;&#039;&#039;obility &#039;&#039;&#039;G&#039;&#039;&#039;roup domain.&lt;br /&gt;
It is approximately 80 residues long. It mediates the binding of the protein to the minor groove of DNA. It is the most important part of the SRY protein. Not only because it enable  the protein to bind the DNA but because even a little mutation can cause an inactivation of the protein.&lt;br /&gt;
&lt;br /&gt;
It has a Twisted L shape meaning that it has a long (28Å) and a short (22Å) arm. The HMG Box is made of 3 helices, its N-term and C-term are irregular. The overall structure is stabilized by a hydrophobic core especially at the intersection of the 3 helices where 3 aromatics cycles meet, surrounnded by aliphatic aminoacids.&lt;br /&gt;
&lt;br /&gt;
The interaction between the HMG-Box and DNA is specific and stable. It permits the bend of DNA (?75°). It is mostly hydrophobic interaction. Only one molecule of water interface the Box and the DNA. the complex is stabilized by salt bridges between positive charged residues of the HMG domain and negative charged phosphates.&amp;lt;ref&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[Image:HHMG-bitmap.png|thumb|alt=Image bitmap|Linear structure of hHMG domain]]&lt;br /&gt;
&lt;br /&gt;
The binding of SRY to DNA is specific. The DNA target site is a DNA octamer :&lt;br /&gt;
&lt;br /&gt;
(5&#039;-dGCACAAAC)&lt;br /&gt;
(5&#039;-dGTTTGTGC)&lt;br /&gt;
&lt;br /&gt;
This sequenece is found in the promoters of genes expressed during the testicular development&lt;br /&gt;
The bend of DNA permits the recruitment of different proteins and the build of massives proteins-DNA complexes that could change the expression of different genes. It is the role of a transcription factor.&amp;lt;ref&amp;gt;PMID:11563911&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
Even if the most important function of the HMG box is its capacity of binding and bending DNA, it is also involved in DNA condensation, recombination and DNA repair.&lt;br /&gt;
&lt;br /&gt;
There are 2 kinds of protein that contain a HMG box&lt;br /&gt;
* HMG1 : It is expressed in few cell types. It is found in transcription factors that contain a single HMG box. The bind to a DNA sequence is specific.&lt;br /&gt;
* HMG2 : Are found in all cell types and are abundant in chromatin. This proteins can contain two or more HMG boxes that can nonspecifically bind DNA. &lt;br /&gt;
&lt;br /&gt;
===General structure of SRY===&lt;br /&gt;
The overall structure of SRY is organized aroud the HMG-box.&lt;br /&gt;
3 domains:&lt;br /&gt;
* N-term domain&lt;br /&gt;
* Central domain : DNA binding (HMG box)&lt;br /&gt;
* C-term domain&lt;br /&gt;
&lt;br /&gt;
== Function ==&lt;br /&gt;
&lt;br /&gt;
===Sex determining===&lt;br /&gt;
It acts like a sex determinator thanks to it transcriptionnal activity. It inhibits the developpement of female sex structure in th embryonnic individual.&lt;br /&gt;
&lt;br /&gt;
==Implication - Future for SRY ?==&lt;br /&gt;
&lt;br /&gt;
== Disease ==&lt;br /&gt;
&lt;br /&gt;
=== Swyer syndrome (AKA XY gonadal dysgenis) :===&lt;br /&gt;
&lt;br /&gt;
	If the TDF protein is not able to bind its targeted DNA sequences, the genes responsible for the testis development are not expressed. The patient owning this defective protein will then develop female characters, even though he has a XY karyotype. This phenomenon is known as the « Swyer Syndrome ». &lt;br /&gt;
Different causes can explain this « XY gonadal dysgenis », as it is also called. About thirty mutations (named [http://www.uniprot.org/uniprot/Q05066#sequences &amp;quot;SRXY1&amp;quot;]) in the SRY gene have been shown to drive this phenotype development. It can also be due to crossovers during a meiosis. If a Y chromosome portion carrying the SRY gene is recombined into a X chromosome, a sperm cell will get this abnormal Y chromosome. If it then fecundates, a XY karyotype without any SRY gene will be formed. &lt;br /&gt;
&lt;br /&gt;
=== De La Chapelle syndrome (AKA XX male syndrome) :===&lt;br /&gt;
&lt;br /&gt;
From the meiosis just described would also result an abnormal X chromosome, carrying the SRY gene. If the sperm cell owning this chromosome fecundates an ovule, the resulting newborn will have a XX karyotype but a male phenotype. This is called the « De La Chapelle syndrome ». In this case, the patient can either develop testis or both testis and ovarian tissues. As some epigenetic mechanisms can inactivate the X chromosome carrying SRY, this syndrome keeps most of the patients sterile.&amp;lt;ref&amp;gt;PMID: 4622299&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
== Relevance ==&lt;br /&gt;
&lt;br /&gt;
== Structural highlights ==&lt;br /&gt;
&lt;br /&gt;
This is a sample scene created with SAT to &amp;lt;scene name=&amp;quot;/12/3456/Sample/1&amp;quot;&amp;gt;color&amp;lt;/scene&amp;gt; by Group, and another to make &amp;lt;scene name=&amp;quot;/12/3456/Sample/2&amp;quot;&amp;gt;a transparent representation&amp;lt;/scene&amp;gt; of the protein. You can make your own scenes on SAT starting from scratch or loading and editing one of these sample scenes.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;/StructureSection&amp;gt;&lt;br /&gt;
== References ==&lt;br /&gt;
[http://ghr.nlm.nih.gov/gene/SRY Genetic Home reference]&lt;br /&gt;
&amp;lt;references/&amp;gt;&lt;/div&gt;</summary>
		<author><name>Fantin Mesny</name></author>
	</entry>
	<entry>
		<id>https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2525325</id>
		<title>Sandbox Reserved 1120</title>
		<link rel="alternate" type="text/html" href="https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2525325"/>
		<updated>2016-01-28T09:35:03Z</updated>

		<summary type="html">&lt;p&gt;Fantin Mesny: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{Sandbox_Reserved_ESBS_2015}}&amp;lt;!-- PLEASE ADD YOUR CONTENT BELOW HERE --&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==SRY protein (AKA TDF protein)==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;StructureSection load=&#039;1hry&#039; size=&#039;340&#039; side=&#039;right&#039; caption=&#039;The SRY protein linked to DNA&#039; scene=&#039;&#039;&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The SRY protein is a 204 residues long monomeric polypeptide. It is a &#039;&#039;&#039;transcriptionnal factor&#039;&#039;&#039;, It activates the &#039;&#039;&#039;M&#039;&#039;&#039;üllerian &#039;&#039;&#039;I&#039;&#039;&#039;nhibiting &#039;&#039;&#039;S&#039;&#039;&#039;ubstance (&#039;&#039;&#039;MIS&#039;&#039;&#039; gene).&lt;br /&gt;
It is encoded by the [[testis-determining sex gene]] and is itself involved in the sex determination in mammels by being responsible for the gonadogenesis thus the male sexual developement. It is the HMG-box that gives to the protein its ability to bind DNA by its minor groove. &amp;lt;ref&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Properties===&lt;br /&gt;
&lt;br /&gt;
&amp;lt;table style=&amp;quot;width:100%&amp;quot;&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Molecular weight&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Gene&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Length&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;DNA target sequence&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Genes targeted&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Inhibitors&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;/table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==History==&lt;br /&gt;
&lt;br /&gt;
After centuries of unfounded theories mainly based on environmental factors, the first molecular theory concerning the sex determination appeared in 1891. At this time, the german biologist Hermann Henking was studying sperm formation in wasps. As a chromosome which was not present in all the wasps looked different from the others, he suspected it to play a role in sex determination and called it the &amp;quot;X chromosome&amp;quot;.&lt;br /&gt;
Ten years later, Clarence Erwin McClung saw that this chromosome behaved differently during the meiosis and was only present in half the sperm cells of grasshoppers. As the main characteristic that varies in 50/50 proportions among zygotes is the sex, McClung suspected the X chromosome to be implicated in sexual development. &lt;br /&gt;
In 1905, Nettie Stevens discovered the &amp;quot;Y chromosome&amp;quot; (and the female XX and male XY patterns) while she was counting the chromosomes of beetles under the microscope&amp;lt;ref&amp;gt;Sumner, A. T. Sex Chromosomes and Sex Determination. Chromosomes: Organization and Function, 97-108. [http://www.nature.com/scitable/nated/topicpage/Sex-Chromosomes-and-Sex-Determination-44565]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
During the next decades, a few theories were in competition. In 1921, Calvin Bridges&#039;s works on &#039;&#039;Drosophila melanogaster&#039;&#039; seemed to reveal that male characters acquisition is due to a genic balance between the genes contained in the X chromosome and those contained in the autosomes&amp;lt;ref&amp;gt;PMID: 17769897&amp;lt;/ref&amp;gt;.&lt;br /&gt;
In 1930, Ronald Fisher introduced the first Y-based control of sex theory by proposing two different models : either all the genes responsible for the male characters are located on the Y chromosome or there is a Y-located gene which regulates the expression of genes elsewhere in the genome&amp;lt;ref&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt;.&lt;br /&gt;
As Alfred Jost had shown the testosterone produced by the testis is responsible for the entire male phenotype acquisition&amp;lt;ref&amp;gt;PMID: 4805859&amp;lt;/ref&amp;gt;, in 1988, Peter Neville Goodfellow proposed that there is a gene (&#039;&#039;TDF&#039;&#039; in human, &#039;&#039;Tdy&#039;&#039; in mice)  on the Y chromosome which drives the development of the testis.&amp;lt;ref&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt; In 1990, Goodfellow&#039;s hypothesis was validated with the discovery of &#039;&#039;Tdy&#039;&#039;&#039;s localisation. This gene&#039;s product (expressed during the male gonadal development) owns an amino-acid motif showing homology to other known or putative DNA-binding domains. &#039;&#039;Tdy&#039;&#039; is therefore a transcriptional factor&amp;lt;ref&amp;gt;PMID: 2374589&amp;lt;/ref&amp;gt;. The same year, the human &#039;&#039;SRY&#039;&#039; gene (accepted later as the &#039;&#039;TDF&#039;&#039;) was discovered&amp;lt;ref&amp;gt;PMID: 1695712&amp;lt;/ref&amp;gt;. &lt;br /&gt;
Three dimensional structure of the SRY protein was determined in 1995 using NMR spectroscopy&amp;lt;ref&amp;gt;PMID: 7774012&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==SRY gene==&lt;br /&gt;
&lt;br /&gt;
===Generality===&lt;br /&gt;
&lt;br /&gt;
The SRY gene encodes the SRY protein. The SRY protein is a transcriptional factor inducing the male phenotype in embryo. The SRY gene is located on the [https://en.wikipedia.org/wiki/Y_chromosome Y chromosom] in the short arm (p) 11.3 &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/gene/6736]&amp;lt;/ref&amp;gt;. This gene has only one exon containing the HMG domain (DNA-binding high-mobility group box domain). That&#039;s means that SRY mRNA does not have a alternative splicing, so there is one isoform of SRY protein.&amp;lt;ref&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;. Moreover,the human genome contains one copy of the SRY gene, whereas the mouse genome contains 6 copy of this gene. &amp;lt;ref&amp;gt; Sekido R, Lovell-Badge R. Genetic control of testis development. Sex Dev Genet Mol Biol Evol Endocrinol Embryol Pathol Sex Determ Differ. 2013;7(1-3):21–32 &amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Sequence of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
&amp;gt;gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/nuccore]&amp;lt;/ref&amp;gt;&lt;br /&gt;
TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT&lt;br /&gt;
TTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACA&lt;br /&gt;
&#039;&#039;&#039;ATG&#039;&#039;&#039;CAATCATATGCTTCTGCTATGTTAAGCGTATTCAACAGCGATGATTACAGTCCAGCTGTGCAAGAGAAT&lt;br /&gt;
ATTCCCGCTCTCCGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTAAGTATCAGTGTGAAA&lt;br /&gt;
CGGGAGAAAACAGTAAAGGCAACGTCCA&#039;&#039;&#039;GGATAGAGTGAAGCGACCCATGAACGCATTCATCGTGTGGTC&lt;br /&gt;
&#039;&#039;&#039;TCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCAGAGATCAGCAAGCAGCTG&lt;br /&gt;
&#039;&#039;&#039;GGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCATTCTTCCAGGAGGCACAGAAATTACAGG&lt;br /&gt;
&#039;&#039;&#039;CCATGCACAGAGAGAAATACCCGAATTATAAGTATCGA&#039;&#039;&#039;CCTCGTCGGAAGGCGAAGATGCTGCCGAAGAA&lt;br /&gt;
TTGCAGTTTGCTTCCCGCAGATCCCGCTTCGGTACTCTGCAGCGAAGTGCAACTGGACAACAGGTTGTAC&lt;br /&gt;
AGGGATGACTGTACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAACG&lt;br /&gt;
CAGCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTG&#039;&#039;&#039;TAG&#039;&#039;&#039;GACAATCGGGTAACATT&lt;br /&gt;
GGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCACTTTCTTATGTTTAGTTT&lt;br /&gt;
CAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCATTTCA&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;&#039;legend of bold &#039;&#039;&#039;&lt;br /&gt;
&lt;br /&gt;
first: initiation codon&lt;br /&gt;
&lt;br /&gt;
second: HMG sequence&lt;br /&gt;
&lt;br /&gt;
third: stop codon&lt;br /&gt;
&lt;br /&gt;
===Regulation of the expression of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
In humans, the SRY promoter is found at −408 bp to −95 bp upstream of the ATG initiation codon. Moreover, the SRY gene has enhancers at -727 pb upstream of the ATG initiation codon. The linkage between regulatory proteins and this enhancers have the property to increase the production of SRY protein. These regulatory proteins could be: SF1 (steroidogenic factor 1), SP1  and WT 1 (Wilms tumor). &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
*SF1: this transcriptional factor belong to the family of nuclear hormone receptor and contains a zinc finger. The activation of this protein requires a ligand (hormone).&lt;br /&gt;
&lt;br /&gt;
*SP1: this transciprional factor is a ubiquitous protein binding in site containing rich-GC sequences and implicated in the transcription of many genes. Moreover, this protein contains a zinc finger.&lt;br /&gt;
&lt;br /&gt;
*WT1:this transcriptional factor transactives SRY gene, it contains a zinc finger. &amp;lt;ref&amp;gt;Larney C, Bailey TL, Koopman P. Switching on sex: transcriptional regulation of the testis-determining gene Sry. Dev Camb Engl. 2014 Jun;141(11):2195–205. &amp;lt;/ref&amp;gt; &lt;br /&gt;
&lt;br /&gt;
=== Role of the SRY gene ===&lt;br /&gt;
&lt;br /&gt;
The SRY protein is a transcription factor, which contains nuclear localization domains in N terminal and C terminal. An acetylation on these domains allows to export the protein SRY in the nucleus.  &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The SRY protein activates the SOX9 (SRY-box9) gene &amp;lt;ref&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;., this gene is found in the 17 chromosom in the long arm 24.3 &amp;lt;ref&amp;gt; NCBI [http://www.ncbi.nlm.nih.gov/gene/6662] &amp;lt;/ref&amp;gt; and is implicated in the stimulation of the differentiation of sertori cells. The activation of sox 9 are done with protein SRY and another transcriptional factor: SF1 (steroidogenic factor 1). These transcriptional factors are bind in an enhancers called: TESCO (testis-specific enhancer of Sox9 core element). The fixation of transcriptional factor in enhancer provokes a curvature of DNA (90°C) allowing a stabilisation of the elongation complex on the SOX9 promoter. The SOX 9 protein activates the gene AMH (anti-mullerian hormone)&amp;lt;ref&amp;gt;[http://www.ebi.ac.uk/interpro/entry/IPR006799?q=AMH] &amp;lt;/ref&amp;gt; allows the reduction of the channels of Müller in male. &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==Structure==&lt;br /&gt;
&lt;br /&gt;
===The SRY-HMG domain (HMG-Box)===&lt;br /&gt;
&#039;&#039;&#039;SRY-HMG&#039;&#039;&#039; stands for &#039;&#039;&#039;S&#039;&#039;&#039;ex determining &#039;&#039;&#039;R&#039;&#039;&#039;egion &#039;&#039;&#039;Y&#039;&#039;&#039; - &#039;&#039;&#039;H&#039;&#039;&#039;igh &#039;&#039;&#039;M&#039;&#039;&#039;obility &#039;&#039;&#039;G&#039;&#039;&#039;roup domain.&lt;br /&gt;
It is approximately 80 residues long. It mediates the binding of the protein to the minor groove of DNA. It is the most important part of the SRY protein. Not only because it enable  the protein to bind the DNA but because even a little mutation can cause an inactivation of the protein.&lt;br /&gt;
&lt;br /&gt;
It has a Twisted L shape meaning that it has a long (28Å) and a short (22Å) arm. The HMG Box is made of 3 helices, its N-term and C-term are irregular. The overall structure is stabilized by a hydrophobic core especially at the intersection of the 3 helices where 3 aromatics cycles meet, surrounnded by aliphatic aminoacids.&lt;br /&gt;
&lt;br /&gt;
The interaction between the HMG-Box and DNA is specific and stable. It permits the bend of DNA (?75°). It is mostly hydrophobic interaction. Only one molecule of water interface the Box and the DNA. the complex is stabilized by salt bridges between positive charged residues of the HMG domain and negative charged phosphates.&amp;lt;ref&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[Media:HHMG-SRY.pdf]]&lt;br /&gt;
&lt;br /&gt;
The binding of SRY to DNA is specific. The DNA target site is a DNA octamer :&lt;br /&gt;
&lt;br /&gt;
(5&#039;-dGCACAAAC)&lt;br /&gt;
(5&#039;-dGTTTGTGC)&lt;br /&gt;
&lt;br /&gt;
This sequenece is found in the promoters of genes expressed during the testicular development&lt;br /&gt;
The bend of DNA permits the recruitment of different proteins and the build of massives proteins-DNA complexes that could change the expression of different genes. It is the role of a transcription factor.&amp;lt;ref&amp;gt;PMID:11563911&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
Even if the most important function of the HMG box is its capacity of binding and bending DNA, it is also involved in DNA condensation, recombination and DNA repair.&lt;br /&gt;
&lt;br /&gt;
There are 2 kinds of protein that contain a HMG box&lt;br /&gt;
* HMG1 : It is expressed in few cell types. It is found in transcription factors that contain a single HMG box. The bind to a DNA sequence is specific.&lt;br /&gt;
* HMG2 : Are found in all cell types and are abundant in chromatin. This proteins can contain two or more HMG boxes that can nonspecifically bind DNA. &lt;br /&gt;
&lt;br /&gt;
===General structure of SRY===&lt;br /&gt;
The overall structure of SRY is organized aroud the HMG-box.&lt;br /&gt;
3 domains:&lt;br /&gt;
* N-term domain&lt;br /&gt;
* Central domain : DNA binding (HMG box)&lt;br /&gt;
* C-term domain&lt;br /&gt;
&lt;br /&gt;
== Function ==&lt;br /&gt;
&lt;br /&gt;
===Sex determining===&lt;br /&gt;
It acts like a sex determinator thanks to it transcriptionnal activity. It inhibits the developpement of female sex structure in th embryonnic individual.&lt;br /&gt;
&lt;br /&gt;
==Implication - Future for SRY ?==&lt;br /&gt;
&lt;br /&gt;
== Disease ==&lt;br /&gt;
&lt;br /&gt;
=== Swyer syndrome (AKA XY gonadal dysgenis) :===&lt;br /&gt;
&lt;br /&gt;
	If the TDF protein is not able to bind its targeted DNA sequences, the genes responsible for the testis development are not expressed. The patient owning this defective protein will then develop female characters, even though he has a XY karyotype. This phenomenon is known as the « Swyer Syndrome ». &lt;br /&gt;
Different causes can explain this « XY gonadal dysgenis », as it is also called. About thirty mutations (named [http://www.uniprot.org/uniprot/Q05066#sequences &amp;quot;SRXY1&amp;quot;]) in the SRY gene have been shown to drive this phenotype development. It can also be due to crossovers during a meiosis. If a Y chromosome portion carrying the SRY gene is recombined into a X chromosome, a sperm cell will get this abnormal Y chromosome. If it then fecundates, a XY karyotype without any SRY gene will be formed. &lt;br /&gt;
&lt;br /&gt;
=== De La Chapelle syndrome (AKA XX male syndrome) :===&lt;br /&gt;
&lt;br /&gt;
From the meiosis just described would also result an abnormal X chromosome, carrying the SRY gene. If the sperm cell owning this chromosome fecundates an ovule, the resulting newborn will have a XX karyotype but a male phenotype. This is called the « De La Chapelle syndrome ». In this case, the patient can either develop testis or both testis and ovarian tissues. As some epigenetic mechanisms can inactivate the X chromosome carrying SRY, this syndrome keeps most of the patients sterile.&amp;lt;ref&amp;gt;PMID: 4622299&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
== Relevance ==&lt;br /&gt;
&lt;br /&gt;
== Structural highlights ==&lt;br /&gt;
&lt;br /&gt;
This is a sample scene created with SAT to &amp;lt;scene name=&amp;quot;/12/3456/Sample/1&amp;quot;&amp;gt;color&amp;lt;/scene&amp;gt; by Group, and another to make &amp;lt;scene name=&amp;quot;/12/3456/Sample/2&amp;quot;&amp;gt;a transparent representation&amp;lt;/scene&amp;gt; of the protein. You can make your own scenes on SAT starting from scratch or loading and editing one of these sample scenes.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;/StructureSection&amp;gt;&lt;br /&gt;
== References ==&lt;br /&gt;
[http://ghr.nlm.nih.gov/gene/SRY Genetic Home reference]&lt;br /&gt;
&amp;lt;references/&amp;gt;&lt;/div&gt;</summary>
		<author><name>Fantin Mesny</name></author>
	</entry>
	<entry>
		<id>https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2525320</id>
		<title>Sandbox Reserved 1120</title>
		<link rel="alternate" type="text/html" href="https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2525320"/>
		<updated>2016-01-28T09:32:38Z</updated>

		<summary type="html">&lt;p&gt;Fantin Mesny: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{Sandbox_Reserved_ESBS_2015}}&amp;lt;!-- PLEASE ADD YOUR CONTENT BELOW HERE --&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==SRY protein (AKA TDF protein)==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;StructureSection load=&#039;1hry&#039; size=&#039;340&#039; side=&#039;right&#039; caption=&#039;The SRY protein linked to DNA&#039; scene=&#039;&#039;&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The SRY protein is a 204 residues long monomeric polypeptide. It is a &#039;&#039;&#039;transcriptionnal factor&#039;&#039;&#039;, It activates the &#039;&#039;&#039;M&#039;&#039;&#039;üllerian &#039;&#039;&#039;I&#039;&#039;&#039;nhibiting &#039;&#039;&#039;S&#039;&#039;&#039;ubstance (&#039;&#039;&#039;MIS&#039;&#039;&#039; gene).&lt;br /&gt;
It is encoded by the [[testis-determining sex gene]] and is itself involved in the sex determination in mammels by being responsible for the gonadogenesis thus the male sexual developement. It is the HMG-box that gives to the protein its ability to bind DNA by its minor groove. &amp;lt;ref&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Properties===&lt;br /&gt;
&lt;br /&gt;
&amp;lt;table border=&amp;quot;1&amp;quot;&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td color=&amp;quot;blue&amp;quot;&amp;gt;Molecular weight&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Gene&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Length&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;DNA target sequence&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Genes targeted&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Inhibitors&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;/table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==History==&lt;br /&gt;
&lt;br /&gt;
After centuries of unfounded theories mainly based on environmental factors, the first molecular theory concerning the sex determination appeared in 1891. At this time, the german biologist Hermann Henking was studying sperm formation in wasps. As a chromosome which was not present in all the wasps looked different from the others, he suspected it to play a role in sex determination and called it the &amp;quot;X chromosome&amp;quot;.&lt;br /&gt;
Ten years later, Clarence Erwin McClung saw that this chromosome behaved differently during the meiosis and was only present in half the sperm cells of grasshoppers. As the main characteristic that varies in 50/50 proportions among zygotes is the sex, McClung suspected the X chromosome to be implicated in sexual development. &lt;br /&gt;
In 1905, Nettie Stevens discovered the &amp;quot;Y chromosome&amp;quot; (and the female XX and male XY patterns) while she was counting the chromosomes of beetles under the microscope&amp;lt;ref&amp;gt;Sumner, A. T. Sex Chromosomes and Sex Determination. Chromosomes: Organization and Function, 97-108. [http://www.nature.com/scitable/nated/topicpage/Sex-Chromosomes-and-Sex-Determination-44565]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
During the next decades, a few theories were in competition. In 1921, Calvin Bridges&#039;s works on &#039;&#039;Drosophila melanogaster&#039;&#039; seemed to reveal that male characters acquisition is due to a genic balance between the genes contained in the X chromosome and those contained in the autosomes&amp;lt;ref&amp;gt;PMID: 17769897&amp;lt;/ref&amp;gt;.&lt;br /&gt;
In 1930, Ronald Fisher introduced the first Y-based control of sex theory by proposing two different models : either all the genes responsible for the male characters are located on the Y chromosome or there is a Y-located gene which regulates the expression of genes elsewhere in the genome&amp;lt;ref&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt;.&lt;br /&gt;
As Alfred Jost had shown the testosterone produced by the testis is responsible for the entire male phenotype acquisition&amp;lt;ref&amp;gt;PMID: 4805859&amp;lt;/ref&amp;gt;, in 1988, Peter Neville Goodfellow proposed that there is a gene (&#039;&#039;TDF&#039;&#039; in human, &#039;&#039;Tdy&#039;&#039; in mice)  on the Y chromosome which drives the development of the testis.&amp;lt;ref&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt; In 1990, Goodfellow&#039;s hypothesis was validated with the discovery of &#039;&#039;Tdy&#039;&#039;&#039;s localisation. This gene&#039;s product (expressed during the male gonadal development) owns an amino-acid motif showing homology to other known or putative DNA-binding domains. &#039;&#039;Tdy&#039;&#039; is therefore a transcriptional factor&amp;lt;ref&amp;gt;PMID: 2374589&amp;lt;/ref&amp;gt;. The same year, the human &#039;&#039;SRY&#039;&#039; gene (accepted later as the &#039;&#039;TDF&#039;&#039;) was discovered&amp;lt;ref&amp;gt;PMID: 1695712&amp;lt;/ref&amp;gt;. &lt;br /&gt;
Three dimensional structure of the SRY protein was determined in 1995 using NMR spectroscopy&amp;lt;ref&amp;gt;PMID: 7774012&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==SRY gene==&lt;br /&gt;
&lt;br /&gt;
===Generality===&lt;br /&gt;
&lt;br /&gt;
The SRY gene encodes the SRY protein. The SRY protein is a transcriptional factor inducing the male phenotype in embryo. The SRY gene is located on the [https://en.wikipedia.org/wiki/Y_chromosome Y chromosom] in the short arm (p) 11.3 &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/gene/6736]&amp;lt;/ref&amp;gt;. This gene has only one exon containing the HMG domain (DNA-binding high-mobility group box domain). That&#039;s means that SRY mRNA does not have a alternative splicing, so there is one isoform of SRY protein.&amp;lt;ref&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;. Moreover,the human genome contains one copy of the SRY gene, whereas the mouse genome contains 6 copy of this gene. &amp;lt;ref&amp;gt; Sekido R, Lovell-Badge R. Genetic control of testis development. Sex Dev Genet Mol Biol Evol Endocrinol Embryol Pathol Sex Determ Differ. 2013;7(1-3):21–32 &amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Sequence of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
&amp;gt;gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/nuccore]&amp;lt;/ref&amp;gt;&lt;br /&gt;
TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT&lt;br /&gt;
TTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACA&lt;br /&gt;
&#039;&#039;&#039;ATG&#039;&#039;&#039;CAATCATATGCTTCTGCTATGTTAAGCGTATTCAACAGCGATGATTACAGTCCAGCTGTGCAAGAGAAT&lt;br /&gt;
ATTCCCGCTCTCCGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTAAGTATCAGTGTGAAA&lt;br /&gt;
CGGGAGAAAACAGTAAAGGCAACGTCCA&#039;&#039;&#039;GGATAGAGTGAAGCGACCCATGAACGCATTCATCGTGTGGTC&lt;br /&gt;
&#039;&#039;&#039;TCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCAGAGATCAGCAAGCAGCTG&lt;br /&gt;
&#039;&#039;&#039;GGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCATTCTTCCAGGAGGCACAGAAATTACAGG&lt;br /&gt;
&#039;&#039;&#039;CCATGCACAGAGAGAAATACCCGAATTATAAGTATCGA&#039;&#039;&#039;CCTCGTCGGAAGGCGAAGATGCTGCCGAAGAA&lt;br /&gt;
TTGCAGTTTGCTTCCCGCAGATCCCGCTTCGGTACTCTGCAGCGAAGTGCAACTGGACAACAGGTTGTAC&lt;br /&gt;
AGGGATGACTGTACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAACG&lt;br /&gt;
CAGCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTG&#039;&#039;&#039;TAG&#039;&#039;&#039;GACAATCGGGTAACATT&lt;br /&gt;
GGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCACTTTCTTATGTTTAGTTT&lt;br /&gt;
CAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCATTTCA&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;&#039;legend of bold &#039;&#039;&#039;&lt;br /&gt;
&lt;br /&gt;
first: initiation codon&lt;br /&gt;
&lt;br /&gt;
second: HMG sequence&lt;br /&gt;
&lt;br /&gt;
third: stop codon&lt;br /&gt;
&lt;br /&gt;
===Regulation of the expression of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
In humans, the SRY promoter is found at −408 bp to −95 bp upstream of the ATG initiation codon. Moreover, the SRY gene has enhancers at -727 pb upstream of the ATG initiation codon. The linkage between regulatory proteins and this enhancers have the property to increase the production of SRY protein. These regulatory proteins could be: SF1 (steroidogenic factor 1), SP1  and WT 1 (Wilms tumor). &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
*SF1: this transcriptional factor belong to the family of nuclear hormone receptor and contains a zinc finger. The activation of this protein requires a ligand (hormone).&lt;br /&gt;
&lt;br /&gt;
*SP1: this transciprional factor is a ubiquitous protein binding in site containing rich-GC sequences and implicated in the transcription of many genes. Moreover, this protein contains a zinc finger.&lt;br /&gt;
&lt;br /&gt;
*WT1:this transcriptional factor transactives SRY gene, it contains a zinc finger. &amp;lt;ref&amp;gt;Larney C, Bailey TL, Koopman P. Switching on sex: transcriptional regulation of the testis-determining gene Sry. Dev Camb Engl. 2014 Jun;141(11):2195–205. &amp;lt;/ref&amp;gt; &lt;br /&gt;
&lt;br /&gt;
=== Role of the SRY gene ===&lt;br /&gt;
&lt;br /&gt;
The SRY protein is a transcription factor, which contains nuclear localization domains in N terminal and C terminal. An acetylation on these domains allows to export the protein SRY in the nucleus.  &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The SRY protein activates the SOX9 (SRY-box9) gene &amp;lt;ref&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;., this gene is found in the 17 chromosom in the long arm 24.3 &amp;lt;ref&amp;gt; NCBI [http://www.ncbi.nlm.nih.gov/gene/6662] &amp;lt;/ref&amp;gt; and is implicated in the stimulation of the differentiation of sertori cells. The activation of sox 9 are done with protein SRY and another transcriptional factor: SF1 (steroidogenic factor 1). These transcriptional factors are bind in an enhancers called: TESCO (testis-specific enhancer of Sox9 core element). The fixation of transcriptional factor in enhancer provokes a curvature of DNA (90°C) allowing a stabilisation of the elongation complex on the SOX9 promoter. The SOX 9 protein activates the gene AMH (anti-mullerian hormone)&amp;lt;ref&amp;gt;[http://www.ebi.ac.uk/interpro/entry/IPR006799?q=AMH] &amp;lt;/ref&amp;gt; allows the reduction of the channels of Müller in male. &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==Structure==&lt;br /&gt;
&lt;br /&gt;
===The SRY-HMG domain (HMG-Box)===&lt;br /&gt;
&#039;&#039;&#039;SRY-HMG&#039;&#039;&#039; stands for &#039;&#039;&#039;S&#039;&#039;&#039;ex determining &#039;&#039;&#039;R&#039;&#039;&#039;egion &#039;&#039;&#039;Y&#039;&#039;&#039; - &#039;&#039;&#039;H&#039;&#039;&#039;igh &#039;&#039;&#039;M&#039;&#039;&#039;obility &#039;&#039;&#039;G&#039;&#039;&#039;roup domain.&lt;br /&gt;
It is approximately 80 residues long. It mediates the binding of the protein to the minor groove of DNA. It is the most important part of the SRY protein. Not only because it enable  the protein to bind the DNA but because even a little mutation can cause an inactivation of the protein.&lt;br /&gt;
&lt;br /&gt;
It has a Twisted L shape meaning that it has a long (28Å) and a short (22Å) arm. The HMG Box is made of 3 helices, its N-term and C-term are irregular. The overall structure is stabilized by a hydrophobic core especially at the intersection of the 3 helices where 3 aromatics cycles meet, surrounnded by aliphatic aminoacids.&lt;br /&gt;
&lt;br /&gt;
The interaction between the HMG-Box and DNA is specific and stable. It permits the bend of DNA (?75°). It is mostly hydrophobic interaction. Only one molecule of water interface the Box and the DNA. the complex is stabilized by salt bridges between positive charged residues of the HMG domain and negative charged phosphates.&amp;lt;ref&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[Media:HHMG-SRY.pdf]]&lt;br /&gt;
&lt;br /&gt;
The binding of SRY to DNA is specific. The DNA target site is a DNA octamer :&lt;br /&gt;
&lt;br /&gt;
(5&#039;-dGCACAAAC)&lt;br /&gt;
(5&#039;-dGTTTGTGC)&lt;br /&gt;
&lt;br /&gt;
This sequenece is found in the promoters of genes expressed during the testicular development&lt;br /&gt;
The bend of DNA permits the recruitment of different proteins and the build of massives proteins-DNA complexes that could change the expression of different genes. It is the role of a transcription factor.&amp;lt;ref&amp;gt;PMID:11563911&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
Even if the most important function of the HMG box is its capacity of binding and bending DNA, it is also involved in DNA condensation, recombination and DNA repair.&lt;br /&gt;
&lt;br /&gt;
There are 2 kinds of protein that contain a HMG box&lt;br /&gt;
* HMG1 : It is expressed in few cell types. It is found in transcription factors that contain a single HMG box. The bind to a DNA sequence is specific.&lt;br /&gt;
* HMG2 : Are found in all cell types and are abundant in chromatin. This proteins can contain two or more HMG boxes that can nonspecifically bind DNA. &lt;br /&gt;
&lt;br /&gt;
===General structure of SRY===&lt;br /&gt;
The overall structure of SRY is organized aroud the HMG-box.&lt;br /&gt;
3 domains:&lt;br /&gt;
* N-term domain&lt;br /&gt;
* Central domain : DNA binding (HMG box)&lt;br /&gt;
* C-term domain&lt;br /&gt;
&lt;br /&gt;
== Function ==&lt;br /&gt;
&lt;br /&gt;
===Sex determining===&lt;br /&gt;
It acts like a sex determinator thanks to it transcriptionnal activity. It inhibits the developpement of female sex structure in th embryonnic individual.&lt;br /&gt;
&lt;br /&gt;
==Implication - Future for SRY ?==&lt;br /&gt;
&lt;br /&gt;
== Disease ==&lt;br /&gt;
&lt;br /&gt;
=== Swyer syndrome (AKA XY gonadal dysgenis) :===&lt;br /&gt;
&lt;br /&gt;
	If the TDF protein is not able to bind its targeted DNA sequences, the genes responsible for the testis development are not expressed. The patient owning this defective protein will then develop female characters, even though he has a XY karyotype. This phenomenon is known as the « Swyer Syndrome ». &lt;br /&gt;
Different causes can explain this « XY gonadal dysgenis », as it is also called. About thirty mutations (named [http://www.uniprot.org/uniprot/Q05066#sequences &amp;quot;SRXY1&amp;quot;]) in the SRY gene have been shown to drive this phenotype development. It can also be due to crossovers during a meiosis. If a Y chromosome portion carrying the SRY gene is recombined into a X chromosome, a sperm cell will get this abnormal Y chromosome. If it then fecundates, a XY karyotype without any SRY gene will be formed. &lt;br /&gt;
&lt;br /&gt;
=== De La Chapelle syndrome (AKA XX male syndrome) :===&lt;br /&gt;
&lt;br /&gt;
From the meiosis just described would also result an abnormal X chromosome, carrying the SRY gene. If the sperm cell owning this chromosome fecundates an ovule, the resulting newborn will have a XX karyotype but a male phenotype. This is called the « De La Chapelle syndrome ». In this case, the patient can either develop testis or both testis and ovarian tissues. As some epigenetic mechanisms can inactivate the X chromosome carrying SRY, this syndrome keeps most of the patients sterile.&amp;lt;ref&amp;gt;PMID: 4622299&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
== Relevance ==&lt;br /&gt;
&lt;br /&gt;
== Structural highlights ==&lt;br /&gt;
&lt;br /&gt;
This is a sample scene created with SAT to &amp;lt;scene name=&amp;quot;/12/3456/Sample/1&amp;quot;&amp;gt;color&amp;lt;/scene&amp;gt; by Group, and another to make &amp;lt;scene name=&amp;quot;/12/3456/Sample/2&amp;quot;&amp;gt;a transparent representation&amp;lt;/scene&amp;gt; of the protein. You can make your own scenes on SAT starting from scratch or loading and editing one of these sample scenes.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;/StructureSection&amp;gt;&lt;br /&gt;
== References ==&lt;br /&gt;
[http://ghr.nlm.nih.gov/gene/SRY Genetic Home reference]&lt;br /&gt;
&amp;lt;references/&amp;gt;&lt;/div&gt;</summary>
		<author><name>Fantin Mesny</name></author>
	</entry>
	<entry>
		<id>https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2525316</id>
		<title>Sandbox Reserved 1120</title>
		<link rel="alternate" type="text/html" href="https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2525316"/>
		<updated>2016-01-28T09:25:26Z</updated>

		<summary type="html">&lt;p&gt;Fantin Mesny: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{Sandbox_Reserved_ESBS_2015}}&amp;lt;!-- PLEASE ADD YOUR CONTENT BELOW HERE --&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==SRY protein (AKA TDF protein)==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;StructureSection load=&#039;1hry&#039; size=&#039;340&#039; side=&#039;right&#039; caption=&#039;The SRY protein linked to DNA&#039; scene=&#039;&#039;&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The SRY protein is a 204 residues long monomeric polypeptide. It is a &#039;&#039;&#039;transcriptionnal factor&#039;&#039;&#039;, It activates the &#039;&#039;&#039;M&#039;&#039;&#039;üllerian &#039;&#039;&#039;I&#039;&#039;&#039;nhibiting &#039;&#039;&#039;S&#039;&#039;&#039;ubstance (&#039;&#039;&#039;MIS&#039;&#039;&#039; gene).&lt;br /&gt;
It is encoded by the [[testis-determining sex gene]] and is itself involved in the sex determination in mammels by being responsible for the gonadogenesis thus the male sexual developement. It is the HMG-box that gives to the protein its ability to bind DNA by its minor groove. &amp;lt;ref&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Properties===&lt;br /&gt;
&lt;br /&gt;
&amp;lt;table border=&amp;quot;1&amp;quot;&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Molecular weight&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Gene&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Length&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;DNA target sequence&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Genes targeted&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Inhibitors&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;/table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==History==&lt;br /&gt;
&lt;br /&gt;
After centuries of unfounded theories mainly based on environmental factors, the first molecular theory concerning the sex determination appeared in 1891. At this time, the german biologist Hermann Henking was studying sperm formation in wasps. As a chromosome which was not present in all the wasps looked different from the others, he suspected it to play a role in sex determination and called it the &amp;quot;X chromosome&amp;quot;.&lt;br /&gt;
Ten years later, Clarence Erwin McClung saw that this chromosome behaved differently during the meiosis and was only present in half the sperm cells of grasshoppers. As the main characteristic that varies in 50/50 proportions among zygotes is the sex, McClung suspected the X chromosome to be implicated in sexual development. &lt;br /&gt;
In 1905, Nettie Stevens discovered the &amp;quot;Y chromosome&amp;quot; (and the female XX and male XY patterns) while she was counting the chromosomes of beetles under the microscope&amp;lt;ref&amp;gt;Sumner, A. T. Sex Chromosomes and Sex Determination. Chromosomes: Organization and Function, 97-108. [http://www.nature.com/scitable/nated/topicpage/Sex-Chromosomes-and-Sex-Determination-44565]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
During the next decades, a few theories were in competition. In 1921, Calvin Bridges&#039;s works on &#039;&#039;Drosophila melanogaster&#039;&#039; seemed to reveal that male characters acquisition is due to a genic balance between the genes contained in the X chromosome and those contained in the autosomes&amp;lt;ref&amp;gt;PMID: 17769897&amp;lt;/ref&amp;gt;.&lt;br /&gt;
In 1930, Ronald Fisher introduced the first Y-based control of sex theory by proposing two different models : either all the genes responsible for the male characters are located on the Y chromosome or there is a Y-located gene which regulates the expression of genes elsewhere in the genome&amp;lt;ref&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt;.&lt;br /&gt;
As Alfred Jost had shown the testosterone produced by the testis is responsible for the entire male phenotype acquisition&amp;lt;ref&amp;gt;PMID: 4805859&amp;lt;/ref&amp;gt;, in 1988, Peter Neville Goodfellow proposed that there is a gene (&#039;&#039;TDF&#039;&#039; in human, &#039;&#039;Tdy&#039;&#039; in mice)  on the Y chromosome which drives the development of the testis.&amp;lt;ref&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt; In 1990, Goodfellow&#039;s hypothesis was validated with the discovery of &#039;&#039;Tdy&#039;&#039;&#039;s localisation. This gene&#039;s product (expressed during the male gonadal development) owns an amino-acid motif showing homology to other known or putative DNA-binding domains. &#039;&#039;Tdy&#039;&#039; is therefore a transcriptional factor&amp;lt;ref&amp;gt;PMID: 2374589&amp;lt;/ref&amp;gt;. The same year, the human &#039;&#039;SRY&#039;&#039; gene (accepted later as the &#039;&#039;TDF&#039;&#039;) was discovered&amp;lt;ref&amp;gt;PMID: 1695712&amp;lt;/ref&amp;gt;. &lt;br /&gt;
Three dimensional structure of the SRY protein was determined in 1995 using NMR spectroscopy&amp;lt;ref&amp;gt;PMID: 7774012&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==SRY gene==&lt;br /&gt;
&lt;br /&gt;
===Generality===&lt;br /&gt;
&lt;br /&gt;
The SRY gene encodes the SRY protein. The SRY protein is a transcriptional factor inducing the male phenotype in embryo. The SRY gene is located on the [https://en.wikipedia.org/wiki/Y_chromosome Y chromosom] in the short arm (p) 11.3 &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/gene/6736]&amp;lt;/ref&amp;gt;. This gene has only one exon containing the HMG domain (DNA-binding high-mobility group box domain). That&#039;s means that SRY mRNA does not have a alternative splicing, so there is one isoform of SRY protein.&amp;lt;ref&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;. Moreover,the human genome contains one copy of the SRY gene, whereas the mouse genome contains 6 copy of this gene. &amp;lt;ref&amp;gt; Sekido R, Lovell-Badge R. Genetic control of testis development. Sex Dev Genet Mol Biol Evol Endocrinol Embryol Pathol Sex Determ Differ. 2013;7(1-3):21–32 &amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Sequence of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
&amp;gt;gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/nuccore]&amp;lt;/ref&amp;gt;&lt;br /&gt;
TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT&lt;br /&gt;
TTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACA&lt;br /&gt;
&#039;&#039;&#039;ATG&#039;&#039;&#039;CAATCATATGCTTCTGCTATGTTAAGCGTATTCAACAGCGATGATTACAGTCCAGCTGTGCAAGAGAAT&lt;br /&gt;
ATTCCCGCTCTCCGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTAAGTATCAGTGTGAAA&lt;br /&gt;
CGGGAGAAAACAGTAAAGGCAACGTCCA&#039;&#039;&#039;GGATAGAGTGAAGCGACCCATGAACGCATTCATCGTGTGGTC&lt;br /&gt;
&#039;&#039;&#039;TCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCAGAGATCAGCAAGCAGCTG&lt;br /&gt;
&#039;&#039;&#039;GGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCATTCTTCCAGGAGGCACAGAAATTACAGG&lt;br /&gt;
&#039;&#039;&#039;CCATGCACAGAGAGAAATACCCGAATTATAAGTATCGA&#039;&#039;&#039;CCTCGTCGGAAGGCGAAGATGCTGCCGAAGAA&lt;br /&gt;
TTGCAGTTTGCTTCCCGCAGATCCCGCTTCGGTACTCTGCAGCGAAGTGCAACTGGACAACAGGTTGTAC&lt;br /&gt;
AGGGATGACTGTACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAACG&lt;br /&gt;
CAGCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTG&#039;&#039;&#039;TAG&#039;&#039;&#039;GACAATCGGGTAACATT&lt;br /&gt;
GGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCACTTTCTTATGTTTAGTTT&lt;br /&gt;
CAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCATTTCA&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;&#039;legend of bold &#039;&#039;&#039;&lt;br /&gt;
&lt;br /&gt;
first: initiation codon&lt;br /&gt;
&lt;br /&gt;
second: HMG sequence&lt;br /&gt;
&lt;br /&gt;
third: stop codon&lt;br /&gt;
&lt;br /&gt;
===Regulation of the expression of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
In humans, the SRY promoter is found at −408 bp to −95 bp upstream of the ATG initiation codon. Moreover, the SRY gene has enhancers at -727 pb upstream of the ATG initiation codon. The linkage between regulatory proteins and this enhancers have the property to increase the production of SRY protein. These regulatory proteins could be: SF1 (steroidogenic factor 1), SP1  and WT 1 (Wilms tumor). &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
*SF1: this transcriptional factor belong to the family of nuclear hormone receptor and contains a zinc finger. The activation of this protein requires a ligand (hormone).&lt;br /&gt;
&lt;br /&gt;
*SP1: this transciprional factor is a ubiquitous protein binding in site containing rich-GC sequences and implicated in the transcription of many genes. Moreover, this protein contains a zinc finger.&lt;br /&gt;
&lt;br /&gt;
*WT1:this transcriptional factor transactives SRY gene, it contains a zinc finger. &amp;lt;ref&amp;gt;Larney C, Bailey TL, Koopman P. Switching on sex: transcriptional regulation of the testis-determining gene Sry. Dev Camb Engl. 2014 Jun;141(11):2195–205. &amp;lt;/ref&amp;gt; &lt;br /&gt;
&lt;br /&gt;
=== Role of the SRY gene ===&lt;br /&gt;
&lt;br /&gt;
The SRY protein is a transcription factor, which contains nuclear localization domains in N terminal and C terminal. An acetylation on these domains allows to export the protein SRY in the nucleus.  &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The SRY protein activates the SOX9 (SRY-box9) gene &amp;lt;ref&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;., this gene is found in the 17 chromosom in the long arm 24.3 &amp;lt;ref&amp;gt; NCBI [http://www.ncbi.nlm.nih.gov/gene/6662] &amp;lt;/ref&amp;gt; and is implicated in the stimulation of the differentiation of sertori cells. The activation of sox 9 are done with protein SRY and another transcriptional factor: SF1 (steroidogenic factor 1). These transcriptional factors are bind in an enhancers called: TESCO (testis-specific enhancer of Sox9 core element). The fixation of transcriptional factor in enhancer provokes a curvature of DNA (90°C) allowing a stabilisation of the elongation complex on the SOX9 promoter. The SOX 9 protein activates the gene AMH (anti-mullerian hormone)&amp;lt;ref&amp;gt;[http://www.ebi.ac.uk/interpro/entry/IPR006799?q=AMH] &amp;lt;/ref&amp;gt; allows the reduction of the channels of Müller in male. &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==Structure==&lt;br /&gt;
&lt;br /&gt;
===The SRY-HMG domain (HMG-Box)===&lt;br /&gt;
&#039;&#039;&#039;SRY-HMG&#039;&#039;&#039; stands for &#039;&#039;&#039;S&#039;&#039;&#039;ex determining &#039;&#039;&#039;R&#039;&#039;&#039;egion &#039;&#039;&#039;Y&#039;&#039;&#039; - &#039;&#039;&#039;H&#039;&#039;&#039;igh &#039;&#039;&#039;M&#039;&#039;&#039;obility &#039;&#039;&#039;G&#039;&#039;&#039;roup domain.&lt;br /&gt;
It is approximately 80 residues long. It mediates the binding of the protein to the minor groove of DNA. It is the most important part of the SRY protein. Not only because it enable  the protein to bind the DNA but because even a little mutation can cause an inactivation of the protein.&lt;br /&gt;
&lt;br /&gt;
It has a Twisted L shape meaning that it has a long (28Å) and a short (22Å) arm. The HMG Box is made of 3 helices, its N-term and C-term are irregular. The overall structure is stabilized by a hydrophobic core especially at the intersection of the 3 helices where 3 aromatics cycles meet, surrounnded by aliphatic aminoacids.&lt;br /&gt;
&lt;br /&gt;
The interaction between the HMG-Box and DNA is specific and stable. It permits the bend of DNA (?75°). It is mostly hydrophobic interaction. Only one molecule of water interface the Box and the DNA. the complex is stabilized by salt bridges between positive charged residues of the HMG domain and negative charged phosphates.&amp;lt;ref&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[Media:HHMG-SRY.pdf]]&lt;br /&gt;
&lt;br /&gt;
The binding of SRY to DNA is specific. The DNA target site is a DNA octamer :&lt;br /&gt;
&lt;br /&gt;
(5&#039;-dGCACAAAC)&lt;br /&gt;
(5&#039;-dGTTTGTGC)&lt;br /&gt;
&lt;br /&gt;
This sequenece is found in the promoters of genes expressed during the testicular development&lt;br /&gt;
The bend of DNA permits the recruitment of different proteins and the build of massives proteins-DNA complexes that could change the expression of different genes. It is the role of a transcription factor.&amp;lt;ref&amp;gt;PMID:11563911&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
Even if the most important function of the HMG box is its capacity of binding and bending DNA, it is also involved in DNA condensation, recombination and DNA repair.&lt;br /&gt;
&lt;br /&gt;
There are 2 kinds of protein that contain a HMG box&lt;br /&gt;
* HMG1 : It is expressed in few cell types. It is found in transcription factors that contain a single HMG box. The bind to a DNA sequence is specific.&lt;br /&gt;
* HMG2 : Are found in all cell types and are abundant in chromatin. This proteins can contain two or more HMG boxes that can nonspecifically bind DNA. &lt;br /&gt;
&lt;br /&gt;
===General structure of SRY===&lt;br /&gt;
The overall structure of SRY is organized aroud the HMG-box.&lt;br /&gt;
3 domains:&lt;br /&gt;
* N-term domain&lt;br /&gt;
* Central domain : DNA binding (HMG box)&lt;br /&gt;
* C-term domain&lt;br /&gt;
&lt;br /&gt;
== Function ==&lt;br /&gt;
&lt;br /&gt;
===Sex determining===&lt;br /&gt;
It acts like a sex determinator thanks to it transcriptionnal activity. It inhibits the developpement of female sex structure in th embryonnic individual.&lt;br /&gt;
&lt;br /&gt;
==Implication - Future for SRY ?==&lt;br /&gt;
&lt;br /&gt;
== Disease ==&lt;br /&gt;
&lt;br /&gt;
=== Swyer syndrome (AKA XY gonadal dysgenis) :===&lt;br /&gt;
&lt;br /&gt;
	If the TDF protein is not able to bind its targeted DNA sequences, the genes responsible for the testis development are not expressed. The patient owning this defective protein will then develop female characters, even though he has a XY karyotype. This phenomenon is known as the « Swyer Syndrome ». &lt;br /&gt;
Different causes can explain this « XY gonadal dysgenis », as it is also called. About thirty mutations (named [http://www.uniprot.org/uniprot/Q05066#sequences &amp;quot;SRXY1&amp;quot;]) in the SRY gene have been shown to drive this phenotype development. It can also be due to crossovers during a meiosis. If a Y chromosome portion carrying the SRY gene is recombined into a X chromosome, a sperm cell will get this abnormal Y chromosome. If it then fecundates, a XY karyotype without any SRY gene will be formed. &lt;br /&gt;
&lt;br /&gt;
=== De La Chapelle syndrome (AKA XX male syndrome) :===&lt;br /&gt;
&lt;br /&gt;
From the meiosis just described would also result an abnormal X chromosome, carrying the SRY gene. If the sperm cell owning this chromosome fecundates an ovule, the resulting newborn will have a XX karyotype but a male phenotype. This is called the « De La Chapelle syndrome ». In this case, the patient can either develop testis or both testis and ovarian tissues. As some epigenetic mechanisms can inactivate the X chromosome carrying SRY, this syndrome keeps most of the patients sterile.&amp;lt;ref&amp;gt;PMID: 4622299&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
== Relevance ==&lt;br /&gt;
&lt;br /&gt;
== Structural highlights ==&lt;br /&gt;
&lt;br /&gt;
This is a sample scene created with SAT to &amp;lt;scene name=&amp;quot;/12/3456/Sample/1&amp;quot;&amp;gt;color&amp;lt;/scene&amp;gt; by Group, and another to make &amp;lt;scene name=&amp;quot;/12/3456/Sample/2&amp;quot;&amp;gt;a transparent representation&amp;lt;/scene&amp;gt; of the protein. You can make your own scenes on SAT starting from scratch or loading and editing one of these sample scenes.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;/StructureSection&amp;gt;&lt;br /&gt;
== References ==&lt;br /&gt;
[http://ghr.nlm.nih.gov/gene/SRY Genetic Home reference]&lt;br /&gt;
&amp;lt;references/&amp;gt;&lt;/div&gt;</summary>
		<author><name>Fantin Mesny</name></author>
	</entry>
	<entry>
		<id>https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2525314</id>
		<title>Sandbox Reserved 1120</title>
		<link rel="alternate" type="text/html" href="https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2525314"/>
		<updated>2016-01-28T09:23:31Z</updated>

		<summary type="html">&lt;p&gt;Fantin Mesny: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{Sandbox_Reserved_ESBS_2015}}&amp;lt;!-- PLEASE ADD YOUR CONTENT BELOW HERE --&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==SRY protein (AKA TDF protein)==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;StructureSection load=&#039;1hry&#039; size=&#039;340&#039; side=&#039;right&#039; caption=&#039;The SRY protein linked to DNA&#039; scene=&#039;&#039;&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The SRY protein is a 204 residues long monomeric polypeptide. It is a &#039;&#039;&#039;transcriptionnal factor&#039;&#039;&#039;, It activates the &#039;&#039;&#039;M&#039;&#039;&#039;üllerian &#039;&#039;&#039;I&#039;&#039;&#039;nhibiting &#039;&#039;&#039;S&#039;&#039;&#039;ubstance (&#039;&#039;&#039;MIS&#039;&#039;&#039; gene).&lt;br /&gt;
It is encoded by the [[testis-determining sex gene]] and is itself involved in the sex determination in mammels by being responsible for the gonadogenesis thus the male sexual developement. It is the HMG-box that gives to the protein its ability to bind DNA by its minor groove. &amp;lt;ref&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Properties===&lt;br /&gt;
&lt;br /&gt;
&amp;lt;table&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Molecular weight&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Gene&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Length&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;DNA target sequence&amp;lt;/td&amp;gt;XXX&amp;lt;td&amp;gt;&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Genes targeted&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;tr&amp;gt;&amp;lt;td&amp;gt;Inhibitors&amp;lt;/td&amp;gt;&amp;lt;td&amp;gt;XXX&amp;lt;/td&amp;gt;&amp;lt;/tr&amp;gt;&lt;br /&gt;
&amp;lt;/table&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==History==&lt;br /&gt;
&lt;br /&gt;
After centuries of unfounded theories mainly based on environmental factors, the first molecular theory concerning the sex determination appeared in 1891. At this time, the german biologist Hermann Henking was studying sperm formation in wasps. As a chromosome which was not present in all the wasps looked different from the others, he suspected it to play a role in sex determination and called it the &amp;quot;X chromosome&amp;quot;.&lt;br /&gt;
Ten years later, Clarence Erwin McClung saw that this chromosome behaved differently during the meiosis and was only present in half the sperm cells of grasshoppers. As the main characteristic that varies in 50/50 proportions among zygotes is the sex, McClung suspected the X chromosome to be implicated in sexual development. &lt;br /&gt;
In 1905, Nettie Stevens discovered the &amp;quot;Y chromosome&amp;quot; (and the female XX and male XY patterns) while she was counting the chromosomes of beetles under the microscope&amp;lt;ref&amp;gt;Sumner, A. T. Sex Chromosomes and Sex Determination. Chromosomes: Organization and Function, 97-108. [http://www.nature.com/scitable/nated/topicpage/Sex-Chromosomes-and-Sex-Determination-44565]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
During the next decades, a few theories were in competition. In 1921, Calvin Bridges&#039;s works on &#039;&#039;Drosophila melanogaster&#039;&#039; seemed to reveal that male characters acquisition is due to a genic balance between the genes contained in the X chromosome and those contained in the autosomes&amp;lt;ref&amp;gt;PMID: 17769897&amp;lt;/ref&amp;gt;.&lt;br /&gt;
In 1930, Ronald Fisher introduced the first Y-based control of sex theory by proposing two different models : either all the genes responsible for the male characters are located on the Y chromosome or there is a Y-located gene which regulates the expression of genes elsewhere in the genome&amp;lt;ref&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt;.&lt;br /&gt;
As Alfred Jost had shown the testosterone produced by the testis is responsible for the entire male phenotype acquisition&amp;lt;ref&amp;gt;PMID: 4805859&amp;lt;/ref&amp;gt;, in 1988, Peter Neville Goodfellow proposed that there is a gene (&#039;&#039;TDF&#039;&#039; in human, &#039;&#039;Tdy&#039;&#039; in mice)  on the Y chromosome which drives the development of the testis.&amp;lt;ref&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt; In 1990, Goodfellow&#039;s hypothesis was validated with the discovery of &#039;&#039;Tdy&#039;&#039;&#039;s localisation. This gene&#039;s product (expressed during the male gonadal development) owns an amino-acid motif showing homology to other known or putative DNA-binding domains. &#039;&#039;Tdy&#039;&#039; is therefore a transcriptional factor&amp;lt;ref&amp;gt;PMID: 2374589&amp;lt;/ref&amp;gt;. The same year, the human &#039;&#039;SRY&#039;&#039; gene (accepted later as the &#039;&#039;TDF&#039;&#039;) was discovered&amp;lt;ref&amp;gt;PMID: 1695712&amp;lt;/ref&amp;gt;. &lt;br /&gt;
Three dimensional structure of the SRY protein was determined in 1995 using NMR spectroscopy&amp;lt;ref&amp;gt;PMID: 7774012&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==SRY gene==&lt;br /&gt;
&lt;br /&gt;
===Generality===&lt;br /&gt;
&lt;br /&gt;
The SRY gene encodes the SRY protein. The SRY protein is a transcriptional factor inducing the male phenotype in embryo. The SRY gene is located on the [https://en.wikipedia.org/wiki/Y_chromosome Y chromosom] in the short arm (p) 11.3 &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/gene/6736]&amp;lt;/ref&amp;gt;. This gene has only one exon containing the HMG domain (DNA-binding high-mobility group box domain). That&#039;s means that SRY mRNA does not have a alternative splicing, so there is one isoform of SRY protein.&amp;lt;ref&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;. Moreover,the human genome contains one copy of the SRY gene, whereas the mouse genome contains 6 copy of this gene. &amp;lt;ref&amp;gt; Sekido R, Lovell-Badge R. Genetic control of testis development. Sex Dev Genet Mol Biol Evol Endocrinol Embryol Pathol Sex Determ Differ. 2013;7(1-3):21–32 &amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Sequence of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
&amp;gt;gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/nuccore]&amp;lt;/ref&amp;gt;&lt;br /&gt;
TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT&lt;br /&gt;
TTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACA&lt;br /&gt;
&#039;&#039;&#039;ATG&#039;&#039;&#039;CAATCATATGCTTCTGCTATGTTAAGCGTATTCAACAGCGATGATTACAGTCCAGCTGTGCAAGAGAAT&lt;br /&gt;
ATTCCCGCTCTCCGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTAAGTATCAGTGTGAAA&lt;br /&gt;
CGGGAGAAAACAGTAAAGGCAACGTCCA&#039;&#039;&#039;GGATAGAGTGAAGCGACCCATGAACGCATTCATCGTGTGGTC&lt;br /&gt;
&#039;&#039;&#039;TCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCAGAGATCAGCAAGCAGCTG&lt;br /&gt;
&#039;&#039;&#039;GGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCATTCTTCCAGGAGGCACAGAAATTACAGG&lt;br /&gt;
&#039;&#039;&#039;CCATGCACAGAGAGAAATACCCGAATTATAAGTATCGA&#039;&#039;&#039;CCTCGTCGGAAGGCGAAGATGCTGCCGAAGAA&lt;br /&gt;
TTGCAGTTTGCTTCCCGCAGATCCCGCTTCGGTACTCTGCAGCGAAGTGCAACTGGACAACAGGTTGTAC&lt;br /&gt;
AGGGATGACTGTACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAACG&lt;br /&gt;
CAGCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTG&#039;&#039;&#039;TAG&#039;&#039;&#039;GACAATCGGGTAACATT&lt;br /&gt;
GGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCACTTTCTTATGTTTAGTTT&lt;br /&gt;
CAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCATTTCA&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;&#039;legend of bold &#039;&#039;&#039;&lt;br /&gt;
&lt;br /&gt;
first: initiation codon&lt;br /&gt;
&lt;br /&gt;
second: HMG sequence&lt;br /&gt;
&lt;br /&gt;
third: stop codon&lt;br /&gt;
&lt;br /&gt;
===Regulation of the expression of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
In humans, the SRY promoter is found at −408 bp to −95 bp upstream of the ATG initiation codon. Moreover, the SRY gene has enhancers at -727 pb upstream of the ATG initiation codon. The linkage between regulatory proteins and this enhancers have the property to increase the production of SRY protein. These regulatory proteins could be: SF1 (steroidogenic factor 1), SP1  and WT 1 (Wilms tumor). &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
*SF1: this transcriptional factor belong to the family of nuclear hormone receptor and contains a zinc finger. The activation of this protein requires a ligand (hormone).&lt;br /&gt;
&lt;br /&gt;
*SP1: this transciprional factor is a ubiquitous protein binding in site containing rich-GC sequences and implicated in the transcription of many genes. Moreover, this protein contains a zinc finger.&lt;br /&gt;
&lt;br /&gt;
*WT1:this transcriptional factor transactives SRY gene, it contains a zinc finger. &amp;lt;ref&amp;gt;Larney C, Bailey TL, Koopman P. Switching on sex: transcriptional regulation of the testis-determining gene Sry. Dev Camb Engl. 2014 Jun;141(11):2195–205. &amp;lt;/ref&amp;gt; &lt;br /&gt;
&lt;br /&gt;
=== Role of the SRY gene ===&lt;br /&gt;
&lt;br /&gt;
The SRY protein is a transcription factor, which contains nuclear localization domains in N terminal and C terminal. An acetylation on these domains allows to export the protein SRY in the nucleus.  &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The SRY protein activates the SOX9 (SRY-box9) gene &amp;lt;ref&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;., this gene is found in the 17 chromosom in the long arm 24.3 &amp;lt;ref&amp;gt; NCBI [http://www.ncbi.nlm.nih.gov/gene/6662] &amp;lt;/ref&amp;gt; and is implicated in the stimulation of the differentiation of sertori cells. The activation of sox 9 are done with protein SRY and another transcriptional factor: SF1 (steroidogenic factor 1). These transcriptional factors are bind in an enhancers called: TESCO (testis-specific enhancer of Sox9 core element). The fixation of transcriptional factor in enhancer provokes a curvature of DNA (90°C) allowing a stabilisation of the elongation complex on the SOX9 promoter. The SOX 9 protein activates the gene AMH (anti-mullerian hormone)&amp;lt;ref&amp;gt;[http://www.ebi.ac.uk/interpro/entry/IPR006799?q=AMH] &amp;lt;/ref&amp;gt; allows the reduction of the channels of Müller in male. &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==Structure==&lt;br /&gt;
&lt;br /&gt;
===The SRY-HMG domain (HMG-Box)===&lt;br /&gt;
&#039;&#039;&#039;SRY-HMG&#039;&#039;&#039; stands for &#039;&#039;&#039;S&#039;&#039;&#039;ex determining &#039;&#039;&#039;R&#039;&#039;&#039;egion &#039;&#039;&#039;Y&#039;&#039;&#039; - &#039;&#039;&#039;H&#039;&#039;&#039;igh &#039;&#039;&#039;M&#039;&#039;&#039;obility &#039;&#039;&#039;G&#039;&#039;&#039;roup domain.&lt;br /&gt;
It is approximately 80 residues long. It mediates the binding of the protein to the minor groove of DNA. It is the most important part of the SRY protein. Not only because it enable  the protein to bind the DNA but because even a little mutation can cause an inactivation of the protein.&lt;br /&gt;
&lt;br /&gt;
It has a Twisted L shape meaning that it has a long (28Å) and a short (22Å) arm. The HMG Box is made of 3 helices, its N-term and C-term are irregular. The overall structure is stabilized by a hydrophobic core especially at the intersection of the 3 helices where 3 aromatics cycles meet, surrounnded by aliphatic aminoacids.&lt;br /&gt;
&lt;br /&gt;
The interaction between the HMG-Box and DNA is specific and stable. It permits the bend of DNA (?75°). It is mostly hydrophobic interaction. Only one molecule of water interface the Box and the DNA. the complex is stabilized by salt bridges between positive charged residues of the HMG domain and negative charged phosphates.&amp;lt;ref&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[Media:HHMG-SRY.pdf]]&lt;br /&gt;
&lt;br /&gt;
The binding of SRY to DNA is specific. The DNA target site is a DNA octamer :&lt;br /&gt;
&lt;br /&gt;
(5&#039;-dGCACAAAC)&lt;br /&gt;
(5&#039;-dGTTTGTGC)&lt;br /&gt;
&lt;br /&gt;
This sequenece is found in the promoters of genes expressed during the testicular development&lt;br /&gt;
The bend of DNA permits the recruitment of different proteins and the build of massives proteins-DNA complexes that could change the expression of different genes. It is the role of a transcription factor.&amp;lt;ref&amp;gt;PMID:11563911&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
Even if the most important function of the HMG box is its capacity of binding and bending DNA, it is also involved in DNA condensation, recombination and DNA repair.&lt;br /&gt;
&lt;br /&gt;
There are 2 kinds of protein that contain a HMG box&lt;br /&gt;
* HMG1 : It is expressed in few cell types. It is found in transcription factors that contain a single HMG box. The bind to a DNA sequence is specific.&lt;br /&gt;
* HMG2 : Are found in all cell types and are abundant in chromatin. This proteins can contain two or more HMG boxes that can nonspecifically bind DNA. &lt;br /&gt;
&lt;br /&gt;
===General structure of SRY===&lt;br /&gt;
The overall structure of SRY is organized aroud the HMG-box.&lt;br /&gt;
3 domains:&lt;br /&gt;
* N-term domain&lt;br /&gt;
* Central domain : DNA binding (HMG box)&lt;br /&gt;
* C-term domain&lt;br /&gt;
&lt;br /&gt;
== Function ==&lt;br /&gt;
&lt;br /&gt;
===Sex determining===&lt;br /&gt;
It acts like a sex determinator thanks to it transcriptionnal activity. It inhibits the developpement of female sex structure in th embryonnic individual.&lt;br /&gt;
&lt;br /&gt;
==Implication - Future for SRY ?==&lt;br /&gt;
&lt;br /&gt;
== Disease ==&lt;br /&gt;
&lt;br /&gt;
=== Swyer syndrome (AKA XY gonadal dysgenis) :===&lt;br /&gt;
&lt;br /&gt;
	If the TDF protein is not able to bind its targeted DNA sequences, the genes responsible for the testis development are not expressed. The patient owning this defective protein will then develop female characters, even though he has a XY karyotype. This phenomenon is known as the « Swyer Syndrome ». &lt;br /&gt;
Different causes can explain this « XY gonadal dysgenis », as it is also called. About thirty mutations (named [http://www.uniprot.org/uniprot/Q05066#sequences &amp;quot;SRXY1&amp;quot;]) in the SRY gene have been shown to drive this phenotype development. It can also be due to crossovers during a meiosis. If a Y chromosome portion carrying the SRY gene is recombined into a X chromosome, a sperm cell will get this abnormal Y chromosome. If it then fecundates, a XY karyotype without any SRY gene will be formed. &lt;br /&gt;
&lt;br /&gt;
=== De La Chapelle syndrome (AKA XX male syndrome) :===&lt;br /&gt;
&lt;br /&gt;
From the meiosis just described would also result an abnormal X chromosome, carrying the SRY gene. If the sperm cell owning this chromosome fecundates an ovule, the resulting newborn will have a XX karyotype but a male phenotype. This is called the « De La Chapelle syndrome ». In this case, the patient can either develop testis or both testis and ovarian tissues. As some epigenetic mechanisms can inactivate the X chromosome carrying SRY, this syndrome keeps most of the patients sterile.&amp;lt;ref&amp;gt;PMID: 4622299&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
== Relevance ==&lt;br /&gt;
&lt;br /&gt;
== Structural highlights ==&lt;br /&gt;
&lt;br /&gt;
This is a sample scene created with SAT to &amp;lt;scene name=&amp;quot;/12/3456/Sample/1&amp;quot;&amp;gt;color&amp;lt;/scene&amp;gt; by Group, and another to make &amp;lt;scene name=&amp;quot;/12/3456/Sample/2&amp;quot;&amp;gt;a transparent representation&amp;lt;/scene&amp;gt; of the protein. You can make your own scenes on SAT starting from scratch or loading and editing one of these sample scenes.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;/StructureSection&amp;gt;&lt;br /&gt;
== References ==&lt;br /&gt;
[http://ghr.nlm.nih.gov/gene/SRY Genetic Home reference]&lt;br /&gt;
&amp;lt;references/&amp;gt;&lt;/div&gt;</summary>
		<author><name>Fantin Mesny</name></author>
	</entry>
	<entry>
		<id>https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2523797</id>
		<title>Sandbox Reserved 1120</title>
		<link rel="alternate" type="text/html" href="https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2523797"/>
		<updated>2016-01-27T22:30:00Z</updated>

		<summary type="html">&lt;p&gt;Fantin Mesny: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{Sandbox_Reserved_ESBS_2015}}&amp;lt;!-- PLEASE ADD YOUR CONTENT BELOW HERE --&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==SRY protein (AKA TDF protein)==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;StructureSection load=&#039;1hry&#039; size=&#039;340&#039; side=&#039;right&#039; caption=&#039;The SRY protein linked to DNA&#039; scene=&#039;&#039;&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The SRY protein is a 223 residues long monomeric polypeptide &amp;lt;ref&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;. It is a &#039;&#039;&#039;transcriptionnal factor&#039;&#039;&#039;, It activates the &#039;&#039;&#039;M&#039;&#039;&#039;üllerian &#039;&#039;&#039;In&#039;&#039;&#039;hibiting &#039;&#039;&#039;S&#039;&#039;&#039;ubstance (&#039;&#039;&#039;MIS&#039;&#039;&#039; gene).&lt;br /&gt;
It is encoded by the [[testis-determining sex gene]] and is itself involved in the sex determination in mammels by being responsible for the male sexual developement.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{| border=0&lt;br /&gt;
|-&lt;br /&gt;
  |rowspan=&amp;quot;2&amp;quot;|SRY&lt;br /&gt;
  | Molecular weight&lt;br /&gt;
  |Ligand&lt;br /&gt;
  | Activity&lt;br /&gt;
|-&lt;br /&gt;
  | XXX kDa&lt;br /&gt;
  | Minor groove of DNA (specific octamer)&lt;br /&gt;
  | transcription factor&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==History==&lt;br /&gt;
&lt;br /&gt;
After centuries of unfounded theories mainly based on environmental factors, the first molecular theory concerning the sex determination appeared in 1891. At this time, the german biologist Hermann Henking was studying sperm formation in wasps. As a chromosome which was not present in all the wasps looked different from the others, he suspected it to play a role in sex determination and called it the &amp;quot;X chromosome&amp;quot;.&lt;br /&gt;
Ten years later, Clarence Erwin McClung saw that this chromosome behaved differently during the meiosis and was only present in half the sperm cells of grasshoppers. As the main characteristic that varies in 50/50 proportions among zygotes is the sex, McClung suspected the X chromosome to be implicated in sexual development. &lt;br /&gt;
In 1905, Nettie Stevens discovered the &amp;quot;Y chromosome&amp;quot; (and the female XX and male XY patterns) while she was counting the chromosomes of beetles under the microscope&amp;lt;ref&amp;gt;Sumner, A. T. Sex Chromosomes and Sex Determination. Chromosomes: Organization and Function, 97-108. [http://www.nature.com/scitable/nated/topicpage/Sex-Chromosomes-and-Sex-Determination-44565]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
During the next decades, a few theories were in competition. In 1921, Calvin Bridges&#039;s works on &#039;&#039;Drosophila melanogaster&#039;&#039; seemed to reveal that male characters acquisition is due to a genic balance between the genes contained in the X chromosome and those contained in the autosomes&amp;lt;ref&amp;gt;PMID: 17769897&amp;lt;/ref&amp;gt;.&lt;br /&gt;
In 1930, Ronald Fisher introduced the first Y-based control of sex theory by proposing two different models : either all the genes responsible for the male characters are located on the Y chromosome or there is a Y-located gene which regulates the expression of genes elsewhere in the genome&amp;lt;ref&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt;.&lt;br /&gt;
As Alfred Jost had shown the testosterone produced by the testis is responsible for the entire male phenotype acquisition&amp;lt;ref&amp;gt;PMID: 4805859&amp;lt;/ref&amp;gt;, in 1988, Peter Neville Goodfellow proposed that there is a gene (&#039;&#039;TDF&#039;&#039; in human, &#039;&#039;Tdy&#039;&#039; in mice)  on the Y chromosome which drives the development of the testis.&amp;lt;ref&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt; In 1990, Goodfellow&#039;s hypothesis was validated with the discovery of &#039;&#039;Tdy&#039;&#039;&#039;s localisation. This gene&#039;s product (expressed during the male gonadal development) owns an amino-acid motif showing homology to other known or putative DNA-binding domains. &#039;&#039;Tdy&#039;&#039; is therefore a transcriptional factor&amp;lt;ref&amp;gt;PMID: 2374589&amp;lt;/ref&amp;gt;. The same year, the human &#039;&#039;SRY&#039;&#039; gene (accepted later as the &#039;&#039;TDF&#039;&#039;) was discovered&amp;lt;ref&amp;gt;PMID: 1695712&amp;lt;/ref&amp;gt;. &lt;br /&gt;
Three dimensional structure of the SRY protein was determined in 1995 using NMR spectroscopy&amp;lt;ref&amp;gt;PMID: 7774012&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==SRY gene==&lt;br /&gt;
&lt;br /&gt;
===generality===&lt;br /&gt;
&lt;br /&gt;
The SRY gene encodes the SRY protein. The SRY protein is a transcriptional factor inducing the male phenotype in embryo. The SRY gene is located on the [https://en.wikipedia.org/wiki/Y_chromosome Y chromosom] in the short arm (p) 11.3 &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/gene/6736]&amp;lt;/ref&amp;gt;. This gene has only one exon containing the HMG domain (DNA-binding high-mobility group box domain). That&#039;s means that SRY mRNA does not have a alternative splicing, so there is one isoform of SRY protein.&amp;lt;ref&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;. Moreover,the human genome contains one copy of the SRY gene, whereas the mouse genome contains 6 copy of this gene. &amp;lt;ref&amp;gt; Sekido R, Lovell-Badge R. Genetic control of testis development. Sex Dev Genet Mol Biol Evol Endocrinol Embryol Pathol Sex Determ Differ. 2013;7(1-3):21–32 &amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===sequence of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
&amp;gt;gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/nuccore]&amp;lt;/ref&amp;gt;&lt;br /&gt;
TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT&lt;br /&gt;
TTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACA&lt;br /&gt;
&#039;&#039;&#039;ATG&#039;&#039;&#039;CAATCATATGCTTCTGCTATGTTAAGCGTATTCAACAGCGATGATTACAGTCCAGCTGTGCAAGAGAAT&lt;br /&gt;
ATTCCCGCTCTCCGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTAAGTATCAGTGTGAAA&lt;br /&gt;
CGGGAGAAAACAGTAAAGGCAACGTCCA&#039;&#039;&#039;GGATAGAGTGAAGCGACCCATGAACGCATTCATCGTGTGGTC&lt;br /&gt;
&#039;&#039;&#039;TCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCAGAGATCAGCAAGCAGCTG&lt;br /&gt;
&#039;&#039;&#039;GGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCATTCTTCCAGGAGGCACAGAAATTACAGG&lt;br /&gt;
&#039;&#039;&#039;CCATGCACAGAGAGAAATACCCGAATTATAAGTATCGA&#039;&#039;&#039;CCTCGTCGGAAGGCGAAGATGCTGCCGAAGAA&lt;br /&gt;
TTGCAGTTTGCTTCCCGCAGATCCCGCTTCGGTACTCTGCAGCGAAGTGCAACTGGACAACAGGTTGTAC&lt;br /&gt;
AGGGATGACTGTACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAACG&lt;br /&gt;
CAGCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTG&#039;&#039;&#039;TAG&#039;&#039;&#039;GACAATCGGGTAACATT&lt;br /&gt;
GGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCACTTTCTTATGTTTAGTTT&lt;br /&gt;
CAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCATTTCA&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;&#039;legend of bole &#039;&#039;&#039;&lt;br /&gt;
&lt;br /&gt;
first: initiation codon&lt;br /&gt;
&lt;br /&gt;
second: HMG sequence&lt;br /&gt;
&lt;br /&gt;
third: stop codon&lt;br /&gt;
&lt;br /&gt;
===regulation of the expression of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
In humans, the SRY promoter is found at −408 bp to −95 bp upstream of the ATG initiation codon. Moreover, the SRY gene has enhancers at -727 pb upstream of the ATG initiation codon. The linkage between regulatory proteins and this enhancers have the property to increase the production of SRY protein. These regulatory proteins could be: SF1 (steroidogenic factor 1), SP1  and WT 1 (Wilms tumor). &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
-SF1: this transcriptional factor belong to the family of nuclear hormone receptor and contains a zinc finger. The activation of this protein requires a ligand (hormone).&lt;br /&gt;
&lt;br /&gt;
-SP1: this transciprional factor is a ubiquitous protein binding in site containing rich-GC sequences and implicated in the transcription of many genes. Moreover, this protein contains a zinc finger.&lt;br /&gt;
&lt;br /&gt;
-WT1:this transcriptional factor transactives SRY gene, it contains a zinc finger. &amp;lt;ref&amp;gt;Larney C, Bailey TL, Koopman P. Switching on sex: transcriptional regulation of the testis-determining gene Sry. Dev Camb Engl. 2014 Jun;141(11):2195–205. &amp;lt;/ref&amp;gt; &lt;br /&gt;
&lt;br /&gt;
=== role of the SRY gene ===&lt;br /&gt;
The SRY protein is a transcription factor, which contains nuclear localization domains in N terminal and C terminal. An acetylation on these domains allows to export the protein SRY in the nucleus.  &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The SRY protein activates the SOX9 (SRY-box9) gene &amp;lt;ref&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;., this gene is found in the 17 chromosom in the long arm 24.3 &amp;lt;ref&amp;gt; NCBI [http://www.ncbi.nlm.nih.gov/gene/6662] &amp;lt;/ref&amp;gt; and is implicated in the stimulation of the differentiation of sertori cells. The activation of sox 9 are done with protein SRY and another transcriptional factor: SF1 (steroidogenic factor 1). These transcriptional factors are bind in an enhancers called: TESCO (testis-specific enhancer of Sox9 core element). The fixation of transcriptional factor in enhancer provokes a curvature of DNA (90°C) allowing a stabilisation of the elongation complex on the SOX9 promoter. The SOX 9 protein activates the gene AMH (anti-mullerian hormone)&amp;lt;ref&amp;gt;[http://www.ebi.ac.uk/interpro/entry/IPR006799?q=AMH] &amp;lt;/ref&amp;gt; allows the reduction of the channels of Müller in male. &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==Structure==&lt;br /&gt;
&lt;br /&gt;
===The SRY-HMG domain (HMG-Box)===&lt;br /&gt;
&#039;&#039;&#039;SRY-HMG&#039;&#039;&#039; stands for &#039;&#039;&#039;S&#039;&#039;&#039;ex determining &#039;&#039;&#039;R&#039;&#039;&#039;egion &#039;&#039;&#039;Y&#039;&#039;&#039; - &#039;&#039;&#039;H&#039;&#039;&#039;igh &#039;&#039;&#039;M&#039;&#039;&#039;obility &#039;&#039;&#039;G&#039;&#039;&#039;roup domain.&lt;br /&gt;
It is approximately 80 residues long. It mediates the binding of the protein to the minor groove of DNA.&lt;br /&gt;
It has a Twisted L shape meaning that it has a long (28Å) and a short (22Å) arm. The HMG Box is made of 3 helices, its N-term and C-term are irregular. &amp;lt;ref&amp;gt;PMID: 7774012&amp;lt;/ref&amp;gt;. the overall Structure is stabilized by a hydrophobic core. &lt;br /&gt;
&lt;br /&gt;
The interaction between the HMG-Box and DNA is specific and stable. It permits the bend of DNA (≈75°). It is mostly hydrophobic interaction. Only one molecule of water interface the Box and the DNA. the complex is stabilized by salt bridges between positive charged residues of the HMG domain and negative charged phosphates.&amp;lt;ref&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
Even if the most important function of the HMG box is its capacity of binding DNA, it is also involved in:&lt;br /&gt;
*DNA bending &lt;br /&gt;
*DNA condensation&lt;br /&gt;
*Recombination&lt;br /&gt;
*Transcription activation&lt;br /&gt;
*DNA repair&lt;br /&gt;
&lt;br /&gt;
There are 2 kinds of protein that contain a HMG box&lt;br /&gt;
* HMG1 : It is expressed in few cell types. It is found in transcription factors that contain a single HMG box. The bind to a DNA sequence is specific.&lt;br /&gt;
* HMG2 : Are found in all cell types and are abundant in chromatin. This proteins can contain two or more HMG boxes that can nonspecifically bind DNA. &lt;br /&gt;
&lt;br /&gt;
===General structure of SRY===&lt;br /&gt;
&lt;br /&gt;
3 domains:&lt;br /&gt;
* N-term domain&lt;br /&gt;
* Central domain : DNA binding (HMG box)&lt;br /&gt;
* C-term domain&lt;br /&gt;
&lt;br /&gt;
===Structure of the DNA target site===&lt;br /&gt;
&lt;br /&gt;
The DNA target site is a DNA octamer : d(GCACAAAC).&lt;br /&gt;
&lt;br /&gt;
== Function ==&lt;br /&gt;
&lt;br /&gt;
===Sex determining===&lt;br /&gt;
It acts like a sex determinator thanks to it transcriptionnal activity. It inhibits the developpement of female sex structure in th embryonnic individual.&lt;br /&gt;
&lt;br /&gt;
==Implication - Future for SRY ?==&lt;br /&gt;
&lt;br /&gt;
== Disease ==&lt;br /&gt;
&lt;br /&gt;
=== Swyer syndrome (AKA XY gonadal dysgenis) :===&lt;br /&gt;
&lt;br /&gt;
	If the TDF protein is not able to bind its targeted DNA sequences, the genes responsible for the testis development are not expressed. The patient owning this defective protein will then develop female characters, even though he has a XY karyotype. This phenomenon is known as the « Swyer Syndrome ». &lt;br /&gt;
Different causes can explain this « XY gonadal dysgenis », as it is also called. About thirty mutations (named [http://www.uniprot.org/uniprot/Q05066#sequences &amp;quot;SRXY1&amp;quot;]) in the SRY gene have been shown to drive this phenotype development. It can also be due to crossovers during a meiosis. If a Y chromosome portion carrying the SRY gene is recombined into a X chromosome, a sperm cell will get this abnormal Y chromosome. If it then fecundates, a XY karyotype without any SRY gene will be formed. &lt;br /&gt;
&lt;br /&gt;
=== De La Chapelle syndrome (AKA XX male syndrome) :===&lt;br /&gt;
&lt;br /&gt;
From the meiosis just described would also result an abnormal X chromosome, carrying the SRY gene. If the sperm cell owning this chromosome fecundates an ovule, the resulting newborn will have a XX karyotype but a male phenotype. This is called the « De La Chapelle syndrome ». In this case, the patient can either develop testis or both testis and ovarian tissues. As some epigenetic mechanisms can inactivate the X chromosome carrying SRY, this syndrome keeps most of the patients sterile.&amp;lt;ref&amp;gt;PMID: 4622299&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
== Relevance ==&lt;br /&gt;
&lt;br /&gt;
== Structural highlights ==&lt;br /&gt;
&lt;br /&gt;
This is a sample scene created with SAT to &amp;lt;scene name=&amp;quot;/12/3456/Sample/1&amp;quot;&amp;gt;color&amp;lt;/scene&amp;gt; by Group, and another to make &amp;lt;scene name=&amp;quot;/12/3456/Sample/2&amp;quot;&amp;gt;a transparent representation&amp;lt;/scene&amp;gt; of the protein. You can make your own scenes on SAT starting from scratch or loading and editing one of these sample scenes.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;/StructureSection&amp;gt;&lt;br /&gt;
== References ==&lt;br /&gt;
[http://ghr.nlm.nih.gov/gene/SRY Genetic Home reference]&lt;br /&gt;
&amp;lt;references/&amp;gt;&lt;/div&gt;</summary>
		<author><name>Fantin Mesny</name></author>
	</entry>
	<entry>
		<id>https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2523794</id>
		<title>Sandbox Reserved 1120</title>
		<link rel="alternate" type="text/html" href="https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2523794"/>
		<updated>2016-01-27T22:27:58Z</updated>

		<summary type="html">&lt;p&gt;Fantin Mesny: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{Sandbox_Reserved_ESBS_2015}}&amp;lt;!-- PLEASE ADD YOUR CONTENT BELOW HERE --&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==SRY protein (AKA TDF protein)==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;StructureSection load=&#039;1hry&#039; size=&#039;340&#039; side=&#039;right&#039; caption=&#039;The SRY protein linked to DNA&#039; scene=&#039;&#039;&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The SRY protein is a 223 residues long monomeric polypeptide &amp;lt;ref&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;. It is a &#039;&#039;&#039;transcriptionnal factor&#039;&#039;&#039;, It activates the &#039;&#039;&#039;M&#039;&#039;&#039;üllerian &#039;&#039;&#039;In&#039;&#039;&#039;hibiting &#039;&#039;&#039;S&#039;&#039;&#039;ubstance (&#039;&#039;&#039;MIS&#039;&#039;&#039; gene).&lt;br /&gt;
It is encoded by the [[testis-determining sex gene]] and is itself involved in the sex determination in mammels by being responsible for the male sexual developement.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{| border=0&lt;br /&gt;
|-&lt;br /&gt;
  |rowspan=&amp;quot;2&amp;quot;|SRY&lt;br /&gt;
  | Molecular weight&lt;br /&gt;
  |Ligand&lt;br /&gt;
  | Activity&lt;br /&gt;
|-&lt;br /&gt;
  | XXX kDa&lt;br /&gt;
  | Minor groove of DNA (specific octamer)&lt;br /&gt;
  | transcription factor&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==History==&lt;br /&gt;
&lt;br /&gt;
After centuries of unfounded theories mainly based on environmental factors, the first molecular theory concerning the sex determination appeared in 1891. At this time, the german biologist Hermann Henking was studying sperm formation in wasps. As a chromosome which was not present in all the wasps looked different from the others, he suspected it to play a role in sex determination and called it the &amp;quot;X chromosome&amp;quot;.&lt;br /&gt;
Ten years later, Clarence Erwin McClung saw that this chromosome behaved differently during the meiosis and was only present in half the sperm cells of grasshoppers. As the main characteristic that varies in 50/50 proportions among zygotes is the sex, McClung suspected the X chromosome to be implicated in sexual development. &lt;br /&gt;
In 1905, Nettie Stevens discovered the &amp;quot;Y chromosome&amp;quot; (and the female XX and male XY patterns) while she was counting the chromosomes of beetles under the microscope&amp;lt;ref&amp;gt;Sumner, A. T. Sex Chromosomes and Sex Determination. Chromosomes: Organization and Function, 97-108. [http://www.nature.com/scitable/nated/topicpage/Sex-Chromosomes-and-Sex-Determination-44565]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
During the next decades, a few theories were in competition. In 1921, Calvin Bridges&#039;s works on &#039;&#039;Drosophila melanogaster&#039;&#039; seemed to reveal that male characters acquisition is due to a genic balance between the genes contained in the X chromosome and those contained in the autosomes&amp;lt;ref&amp;gt;PMID: 17769897&amp;lt;/ref&amp;gt;.&lt;br /&gt;
In 1930, Ronald Fisher introduced the first Y-based control of sex theory by proposing two different models : either all the genes responsible for the male characters are located on the Y chromosome or there is a Y-located gene which regulates the expression of genes elsewhere in the genome&amp;lt;ref&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt;.&lt;br /&gt;
As Alfred Jost had shown the testosterone produced by the testis is responsible for the entire male phenotype acquisition&amp;lt;ref&amp;gt;PMID: 4805859&amp;lt;/ref&amp;gt;, in 1988, Peter Neville Goodfellow proposed that there is a gene (&#039;&#039;TDF&#039;&#039; in human, &#039;&#039;Tdy&#039;&#039; in mice)  on the Y chromosome which drives the development of the testis.&amp;lt;ref&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt; In 1990, Goodfellow&#039;s hypothesis was validated with the discovery of &#039;&#039;Tdy&#039;&#039;&#039;s localisation. This gene&#039;s product (expressed during the male gonadal development) owns an amino-acid motif showing homology to other known or putative DNA-binding domains. &#039;&#039;Tdy&#039;&#039; is therefore a transcriptional factor&amp;lt;ref&amp;gt;PMID: 2374589&amp;lt;/ref&amp;gt;. The same year, the human &#039;&#039;SRY&#039;&#039; gene (accepted later as the &#039;&#039;TDF&#039;&#039;) was discovered&amp;lt;ref&amp;gt;PMID: 1695712&amp;lt;/ref&amp;gt;. &lt;br /&gt;
Three dimensional structure of the SRY protein was determined in 1995 using NMR spectroscopy&amp;lt;ref&amp;gt;PMID: 7774012&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==SRY gene==&lt;br /&gt;
&lt;br /&gt;
===generality===&lt;br /&gt;
&lt;br /&gt;
The SRY gene encodes the SRY protein. The SRY protein is a transcriptional factor inducing the male phenotype in embryo. The SRY gene is located on the [https://en.wikipedia.org/wiki/Y_chromosome Y chromosom] in the short arm (p) 11.3 &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/gene/6736]&amp;lt;/ref&amp;gt;. This gene has only one exon containing the HMG domain (DNA-binding high-mobility group box domain). That&#039;s means that SRY mRNA does not have a alternative splicing, so there is one isoform of SRY protein.&amp;lt;ref&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;. Moreover,the human genome contains one copy of the SRY gene, whereas the mouse genome contains 6 copy of this gene. &amp;lt;ref&amp;gt; Sekido R, Lovell-Badge R. Genetic control of testis development. Sex Dev Genet Mol Biol Evol Endocrinol Embryol Pathol Sex Determ Differ. 2013;7(1-3):21–32 &amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===sequence of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
&amp;gt;gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/nuccore]&amp;lt;/ref&amp;gt;&lt;br /&gt;
TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT&lt;br /&gt;
TTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACA&lt;br /&gt;
&#039;&#039;&#039;ATG&#039;&#039;&#039;CAATCATATGCTTCTGCTATGTTAAGCGTATTCAACAGCGATGATTACAGTCCAGCTGTGCAAGAGAAT&lt;br /&gt;
ATTCCCGCTCTCCGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTAAGTATCAGTGTGAAA&lt;br /&gt;
CGGGAGAAAACAGTAAAGGCAACGTCCA&#039;&#039;&#039;GGATAGAGTGAAGCGACCCATGAACGCATTCATCGTGTGGTC&lt;br /&gt;
&#039;&#039;&#039;TCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCAGAGATCAGCAAGCAGCTG&lt;br /&gt;
&#039;&#039;&#039;GGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCATTCTTCCAGGAGGCACAGAAATTACAGG&lt;br /&gt;
&#039;&#039;&#039;CCATGCACAGAGAGAAATACCCGAATTATAAGTATCGA&#039;&#039;&#039;CCTCGTCGGAAGGCGAAGATGCTGCCGAAGAA&lt;br /&gt;
TTGCAGTTTGCTTCCCGCAGATCCCGCTTCGGTACTCTGCAGCGAAGTGCAACTGGACAACAGGTTGTAC&lt;br /&gt;
AGGGATGACTGTACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAACG&lt;br /&gt;
CAGCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTG&#039;&#039;&#039;TAG&#039;&#039;&#039;GACAATCGGGTAACATT&lt;br /&gt;
GGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCACTTTCTTATGTTTAGTTT&lt;br /&gt;
CAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCATTTCA&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;&#039;legend of bole &#039;&#039;&#039;&lt;br /&gt;
&lt;br /&gt;
first: initiation codon&lt;br /&gt;
&lt;br /&gt;
second: HMG sequence&lt;br /&gt;
&lt;br /&gt;
third: stop codon&lt;br /&gt;
&lt;br /&gt;
===regulation of the expression of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
In humans, the SRY promoter is found at −408 bp to −95 bp upstream of the ATG initiation codon. Moreover, the SRY gene has enhancers at -727 pb upstream of the ATG initiation codon. The linkage between regulatory proteins and this enhancers have the property to increase the production of SRY protein. These regulatory proteins could be: SF1 (steroidogenic factor 1), SP1  and WT 1 (Wilms tumor). &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
-SF1: this transcriptional factor belong to the family of nuclear hormone receptor and contains a zinc finger. The activation of this protein requires a ligand (hormone).&lt;br /&gt;
&lt;br /&gt;
-SP1: this transciprional factor is a ubiquitous protein binding in site containing rich-GC sequences and implicated in the transcription of many genes. Moreover, this protein contains a zinc finger.&lt;br /&gt;
&lt;br /&gt;
-WT1:this transcriptional factor transactives SRY gene, it contains a zinc finger. &amp;lt;ref&amp;gt;Larney C, Bailey TL, Koopman P. Switching on sex: transcriptional regulation of the testis-determining gene Sry. Dev Camb Engl. 2014 Jun;141(11):2195–205. &amp;lt;/ref&amp;gt; &lt;br /&gt;
&lt;br /&gt;
=== role of the SRY gene ===&lt;br /&gt;
The SRY protein is a transcription factor, which contains nuclear localization domains in N terminal and C terminal. An acetylation on these domains allows to export the protein SRY in the nucleus.  &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The SRY protein activates the SOX9 (SRY-box9) gene &amp;lt;ref&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;., this gene is found in the 17 chromosom in the long arm 24.3 &amp;lt;ref&amp;gt; NCBI [http://www.ncbi.nlm.nih.gov/gene/6662] &amp;lt;/ref&amp;gt; and is implicated in the stimulation of the differentiation of sertori cells. The activation of sox 9 are done with protein SRY and another transcriptional factor: SF1 (steroidogenic factor 1). These transcriptional factors are bind in an enhancers called: TESCO (testis-specific enhancer of Sox9 core element). The fixation of transcriptional factor in enhancer provokes a curvature of DNA (90°C) allowing a stabilisation of the elongation complex on the SOX9 promoter. The SOX 9 protein activates the gene AMH (anti-mullerian hormone)&amp;lt;ref&amp;gt;[http://www.ebi.ac.uk/interpro/entry/IPR006799?q=AMH] &amp;lt;/ref&amp;gt; allows the reduction of the channels of Müller in male. &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==Structure==&lt;br /&gt;
&lt;br /&gt;
===The SRY-HMG domain (HMG-Box)===&lt;br /&gt;
&#039;&#039;&#039;SRY-HMG&#039;&#039;&#039; stands for &#039;&#039;&#039;S&#039;&#039;&#039;ex determining &#039;&#039;&#039;R&#039;&#039;&#039;egion &#039;&#039;&#039;Y&#039;&#039;&#039; - &#039;&#039;&#039;H&#039;&#039;&#039;igh &#039;&#039;&#039;M&#039;&#039;&#039;obility &#039;&#039;&#039;G&#039;&#039;&#039;roup domain.&lt;br /&gt;
It is approximately 80 residues long. It mediates the binding of the protein to the minor groove of DNA.&lt;br /&gt;
It has a Twisted L shape meaning that it has a long (28Å) and a short (22Å) arm. The HMG Box is made of 3 helices, its N-term and C-term are irregular. &amp;lt;ref&amp;gt;PMID: 7774012&amp;lt;/ref&amp;gt;. the overall Structure is stabilized by a hydrophobic core. &lt;br /&gt;
&lt;br /&gt;
The interaction between the HMG-Box and DNA is specific and stable. It permits the bend of DNA (≈75°). It is mostly hydrophobic interaction. Only one molecule of water interface the Box and the DNA. the complex is stabilized by salt bridges between positive charged residues of the HMG domain and negative charged phosphates.&amp;lt;ref&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
Even if the most important function of the HMG box is its capacity of binding DNA, it is also involved in:&lt;br /&gt;
*DNA bending &lt;br /&gt;
*DNA condensation&lt;br /&gt;
*Recombination&lt;br /&gt;
*Transcription activation&lt;br /&gt;
*DNA repair&lt;br /&gt;
&lt;br /&gt;
There are 2 kinds of protein that contain a HMG box&lt;br /&gt;
* HMG1 : It is expressed in few cell types. It is found in transcription factors that contain a single HMG box. The bind to a DNA sequence is specific.&lt;br /&gt;
* HMG2 : Are found in all cell types and are abundant in chromatin. This proteins can contain two or more HMG boxes that can nonspecifically bind DNA. &lt;br /&gt;
&lt;br /&gt;
===General structure of SRY===&lt;br /&gt;
&lt;br /&gt;
3 domains:&lt;br /&gt;
* N-term domain&lt;br /&gt;
* Central domain : DNA binding (HMG box)&lt;br /&gt;
* C-term domain&lt;br /&gt;
&lt;br /&gt;
===Structure of the DNA target site===&lt;br /&gt;
&lt;br /&gt;
The DNA target site is a DNA octamer : d(GCACAAAC).&lt;br /&gt;
&lt;br /&gt;
== Function ==&lt;br /&gt;
&lt;br /&gt;
===Sex determining===&lt;br /&gt;
It acts like a sex determinator thanks to it transcriptionnal activity. It inhibits the developpement of female sex structure in th embryonnic individual.&lt;br /&gt;
&lt;br /&gt;
==Implication - Future for SRY ?==&lt;br /&gt;
&lt;br /&gt;
== Disease ==&lt;br /&gt;
&lt;br /&gt;
=== Swyer syndrome (AKA XY gonadal dysgenis) :===&lt;br /&gt;
&lt;br /&gt;
	If the TDF protein is not able to bind its targeted DNA sequences, the genes responsible for the testis development are not expressed. The patient owning this defective protein will then develop female characters, even though he has a XY karyotype. This phenomenon is known as the « Swyer Syndrome ». &lt;br /&gt;
Different causes can explain this « XY gonadal dysgenis », as it is also called. About thirty mutations (named [http://www.uniprot.org/uniprot/Q05066#sequences &amp;quot;SRXY1&amp;quot;]) in the SRY gene have been shown to drive this phenotype development. It can also be due to crossovers during a meiosis. If a Y chromosome portion carrying the SRY gene is recombined into a X chromosome, a sperm cell will get this abnormal Y chromosome. If it then fecundates, a XY karyotype without any SRY gene will be formed. &lt;br /&gt;
&lt;br /&gt;
=== De La Chapelle syndrome (AKA XX male syndrome) :===&lt;br /&gt;
&lt;br /&gt;
From the meiosis just described would also result an abnormal X chromosome, carrying the SRY gene. If the sperm cell owning this chromosome fecundates an ovule, the resulting newborn will have a XX karyotype but a male phenotype. This is called the « De La Chapelle syndrome ». In this case, the patient can either develop testis or both testis and ovarian tissues. As some epigenetic mechanisms can inactivate the X chromosome carrying SRY, this syndrome often keeps the patient sterile.&amp;lt;ref&amp;gt;PMID: 4622299&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
== Relevance ==&lt;br /&gt;
&lt;br /&gt;
== Structural highlights ==&lt;br /&gt;
&lt;br /&gt;
This is a sample scene created with SAT to &amp;lt;scene name=&amp;quot;/12/3456/Sample/1&amp;quot;&amp;gt;color&amp;lt;/scene&amp;gt; by Group, and another to make &amp;lt;scene name=&amp;quot;/12/3456/Sample/2&amp;quot;&amp;gt;a transparent representation&amp;lt;/scene&amp;gt; of the protein. You can make your own scenes on SAT starting from scratch or loading and editing one of these sample scenes.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;/StructureSection&amp;gt;&lt;br /&gt;
== References ==&lt;br /&gt;
[http://ghr.nlm.nih.gov/gene/SRY Genetic Home reference]&lt;br /&gt;
&amp;lt;references/&amp;gt;&lt;/div&gt;</summary>
		<author><name>Fantin Mesny</name></author>
	</entry>
	<entry>
		<id>https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2523793</id>
		<title>Sandbox Reserved 1120</title>
		<link rel="alternate" type="text/html" href="https://proteopedia.org/index.php?title=Sandbox_Reserved_1120&amp;diff=2523793"/>
		<updated>2016-01-27T22:26:49Z</updated>

		<summary type="html">&lt;p&gt;Fantin Mesny: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{Sandbox_Reserved_ESBS_2015}}&amp;lt;!-- PLEASE ADD YOUR CONTENT BELOW HERE --&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==SRY protein (AKA TDF protein)==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;StructureSection load=&#039;1hry&#039; size=&#039;340&#039; side=&#039;right&#039; caption=&#039;The SRY protein linked to DNA&#039; scene=&#039;&#039;&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The SRY protein is a 223 residues long monomeric polypeptide &amp;lt;ref&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;. It is a &#039;&#039;&#039;transcriptionnal factor&#039;&#039;&#039;, It activates the &#039;&#039;&#039;M&#039;&#039;&#039;üllerian &#039;&#039;&#039;In&#039;&#039;&#039;hibiting &#039;&#039;&#039;S&#039;&#039;&#039;ubstance (&#039;&#039;&#039;MIS&#039;&#039;&#039; gene).&lt;br /&gt;
It is encoded by the [[testis-determining sex gene]] and is itself involved in the sex determination in mammels by being responsible for the male sexual developement.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{| border=0&lt;br /&gt;
|-&lt;br /&gt;
  |rowspan=&amp;quot;2&amp;quot;|SRY&lt;br /&gt;
  | Molecular weight&lt;br /&gt;
  |Ligand&lt;br /&gt;
  | Activity&lt;br /&gt;
|-&lt;br /&gt;
  | XXX kDa&lt;br /&gt;
  | Minor groove of DNA (specific octamer)&lt;br /&gt;
  | transcription factor&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==History==&lt;br /&gt;
&lt;br /&gt;
After centuries of unfounded theories mainly based on environmental factors, the first molecular theory concerning the sex determination appeared in 1891. At this time, the german biologist Hermann Henking was studying sperm formation in wasps. As a chromosome which was not present in all the wasps looked different from the others, he suspected it to play a role in sex determination and called it the &amp;quot;X chromosome&amp;quot;.&lt;br /&gt;
Ten years later, Clarence Erwin McClung saw that this chromosome behaved differently during the meiosis and was only present in half the sperm cells of grasshoppers. As the main characteristic that varies in 50/50 proportions among zygotes is the sex, McClung suspected the X chromosome to be implicated in sexual development. &lt;br /&gt;
In 1905, Nettie Stevens discovered the &amp;quot;Y chromosome&amp;quot; (and the female XX and male XY patterns) while she was counting the chromosomes of beetles under the microscope&amp;lt;ref&amp;gt;Sumner, A. T. Sex Chromosomes and Sex Determination. Chromosomes: Organization and Function, 97-108. [http://www.nature.com/scitable/nated/topicpage/Sex-Chromosomes-and-Sex-Determination-44565]&amp;lt;/ref&amp;gt;.&lt;br /&gt;
During the next decades, a few theories were in competition. In 1921, Calvin Bridges&#039;s works on &#039;&#039;Drosophila melanogaster&#039;&#039; seemed to reveal that male characters acquisition is due to a genic balance between the genes contained in the X chromosome and those contained in the autosomes&amp;lt;ref&amp;gt;PMID: 17769897&amp;lt;/ref&amp;gt;.&lt;br /&gt;
In 1930, Ronald Fisher introduced the first Y-based control of sex theory by proposing two different models : either all the genes responsible for the male characters are located on the Y chromosome or there is a Y-located gene which regulates the expression of genes elsewhere in the genome&amp;lt;ref&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt;.&lt;br /&gt;
As Alfred Jost had shown the testosterone produced by the testis is responsible for the entire male phenotype acquisition&amp;lt;ref&amp;gt;PMID: 4805859&amp;lt;/ref&amp;gt;, in 1988, Peter Neville Goodfellow proposed that there is a gene (&#039;&#039;TDF&#039;&#039; in human, &#039;&#039;Tdy&#039;&#039; in mice)  on the Y chromosome which drives the development of the testis.&amp;lt;ref&amp;gt;PMID: 3046910&amp;lt;/ref&amp;gt; In 1990, Goodfellow&#039;s hypothesis was validated with the discovery of &#039;&#039;Tdy&#039;&#039;&#039;s localisation. This gene&#039;s product (expressed during the male gonadal development) owns an amino-acid motif showing homology to other known or putative DNA-binding domains. &#039;&#039;Tdy&#039;&#039; is therefore a transcriptional factor&amp;lt;ref&amp;gt;PMID: 2374589&amp;lt;/ref&amp;gt;. The same year, the human &#039;&#039;SRY&#039;&#039; gene (accepted later as the &#039;&#039;TDF&#039;&#039;) was discovered&amp;lt;ref&amp;gt;PMID: 1695712&amp;lt;/ref&amp;gt;. &lt;br /&gt;
Three dimensional structure of the SRY protein was determined in 1995 using NMR spectroscopy&amp;lt;ref&amp;gt;PMID: 7774012&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==SRY gene==&lt;br /&gt;
&lt;br /&gt;
===generality===&lt;br /&gt;
&lt;br /&gt;
The SRY gene encodes the SRY protein. The SRY protein is a transcriptional factor inducing the male phenotype in embryo. The SRY gene is located on the [https://en.wikipedia.org/wiki/Y_chromosome Y chromosom] in the short arm (p) 11.3 &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/gene/6736]&amp;lt;/ref&amp;gt;. This gene has only one exon containing the HMG domain (DNA-binding high-mobility group box domain). That&#039;s means that SRY mRNA does not have a alternative splicing, so there is one isoform of SRY protein.&amp;lt;ref&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;. Moreover,the human genome contains one copy of the SRY gene, whereas the mouse genome contains 6 copy of this gene. &amp;lt;ref&amp;gt; Sekido R, Lovell-Badge R. Genetic control of testis development. Sex Dev Genet Mol Biol Evol Endocrinol Embryol Pathol Sex Determ Differ. 2013;7(1-3):21–32 &amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===sequence of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
&amp;gt;gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly &amp;lt;ref&amp;gt;[http://www.ncbi.nlm.nih.gov/nuccore]&amp;lt;/ref&amp;gt;&lt;br /&gt;
TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT&lt;br /&gt;
TTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACA&lt;br /&gt;
&#039;&#039;&#039;ATG&#039;&#039;&#039;CAATCATATGCTTCTGCTATGTTAAGCGTATTCAACAGCGATGATTACAGTCCAGCTGTGCAAGAGAAT&lt;br /&gt;
ATTCCCGCTCTCCGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTAAGTATCAGTGTGAAA&lt;br /&gt;
CGGGAGAAAACAGTAAAGGCAACGTCCA&#039;&#039;&#039;GGATAGAGTGAAGCGACCCATGAACGCATTCATCGTGTGGTC&lt;br /&gt;
&#039;&#039;&#039;TCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCAGAGATCAGCAAGCAGCTG&lt;br /&gt;
&#039;&#039;&#039;GGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCATTCTTCCAGGAGGCACAGAAATTACAGG&lt;br /&gt;
&#039;&#039;&#039;CCATGCACAGAGAGAAATACCCGAATTATAAGTATCGA&#039;&#039;&#039;CCTCGTCGGAAGGCGAAGATGCTGCCGAAGAA&lt;br /&gt;
TTGCAGTTTGCTTCCCGCAGATCCCGCTTCGGTACTCTGCAGCGAAGTGCAACTGGACAACAGGTTGTAC&lt;br /&gt;
AGGGATGACTGTACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAACG&lt;br /&gt;
CAGCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTG&#039;&#039;&#039;TAG&#039;&#039;&#039;GACAATCGGGTAACATT&lt;br /&gt;
GGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCACTTTCTTATGTTTAGTTT&lt;br /&gt;
CAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCATTTCA&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;&#039;legend of bole &#039;&#039;&#039;&lt;br /&gt;
&lt;br /&gt;
first: initiation codon&lt;br /&gt;
&lt;br /&gt;
second: HMG sequence&lt;br /&gt;
&lt;br /&gt;
third: stop codon&lt;br /&gt;
&lt;br /&gt;
===regulation of the expression of the SRY gene===&lt;br /&gt;
&lt;br /&gt;
In humans, the SRY promoter is found at −408 bp to −95 bp upstream of the ATG initiation codon. Moreover, the SRY gene has enhancers at -727 pb upstream of the ATG initiation codon. The linkage between regulatory proteins and this enhancers have the property to increase the production of SRY protein. These regulatory proteins could be: SF1 (steroidogenic factor 1), SP1  and WT 1 (Wilms tumor). &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
-SF1: this transcriptional factor belong to the family of nuclear hormone receptor and contains a zinc finger. The activation of this protein requires a ligand (hormone).&lt;br /&gt;
&lt;br /&gt;
-SP1: this transciprional factor is a ubiquitous protein binding in site containing rich-GC sequences and implicated in the transcription of many genes. Moreover, this protein contains a zinc finger.&lt;br /&gt;
&lt;br /&gt;
-WT1:this transcriptional factor transactives SRY gene, it contains a zinc finger. &amp;lt;ref&amp;gt;Larney C, Bailey TL, Koopman P. Switching on sex: transcriptional regulation of the testis-determining gene Sry. Dev Camb Engl. 2014 Jun;141(11):2195–205. &amp;lt;/ref&amp;gt; &lt;br /&gt;
&lt;br /&gt;
=== role of the SRY gene ===&lt;br /&gt;
The SRY protein is a transcription factor, which contains nuclear localization domains in N terminal and C terminal. An acetylation on these domains allows to export the protein SRY in the nucleus.  &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The SRY protein activates the SOX9 (SRY-box9) gene &amp;lt;ref&amp;gt; McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]&amp;lt;/ref&amp;gt;., this gene is found in the 17 chromosom in the long arm 24.3 &amp;lt;ref&amp;gt; NCBI [http://www.ncbi.nlm.nih.gov/gene/6662] &amp;lt;/ref&amp;gt; and is implicated in the stimulation of the differentiation of sertori cells. The activation of sox 9 are done with protein SRY and another transcriptional factor: SF1 (steroidogenic factor 1). These transcriptional factors are bind in an enhancers called: TESCO (testis-specific enhancer of Sox9 core element). The fixation of transcriptional factor in enhancer provokes a curvature of DNA (90°C) allowing a stabilisation of the elongation complex on the SOX9 promoter. The SOX 9 protein activates the gene AMH (anti-mullerian hormone)&amp;lt;ref&amp;gt;[http://www.ebi.ac.uk/interpro/entry/IPR006799?q=AMH] &amp;lt;/ref&amp;gt; allows the reduction of the channels of Müller in male. &amp;lt;ref&amp;gt;Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&amp;amp;rfr_id=ori%3Arid%3Acrossref.org&amp;amp;rfr_dat=cr_pub%3Dpubmed&amp;amp;]&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
==Structure==&lt;br /&gt;
&lt;br /&gt;
===The SRY-HMG domain (HMG-Box)===&lt;br /&gt;
&#039;&#039;&#039;SRY-HMG&#039;&#039;&#039; stands for &#039;&#039;&#039;S&#039;&#039;&#039;ex determining &#039;&#039;&#039;R&#039;&#039;&#039;egion &#039;&#039;&#039;Y&#039;&#039;&#039; - &#039;&#039;&#039;H&#039;&#039;&#039;igh &#039;&#039;&#039;M&#039;&#039;&#039;obility &#039;&#039;&#039;G&#039;&#039;&#039;roup domain.&lt;br /&gt;
It is approximately 80 residues long. It mediates the binding of the protein to the minor groove of DNA.&lt;br /&gt;
It has a Twisted L shape meaning that it has a long (28Å) and a short (22Å) arm. The HMG Box is made of 3 helices, its N-term and C-term are irregular. &amp;lt;ref&amp;gt;PMID: 7774012&amp;lt;/ref&amp;gt;. the overall Structure is stabilized by a hydrophobic core. &lt;br /&gt;
&lt;br /&gt;
The interaction between the HMG-Box and DNA is specific and stable. It permits the bend of DNA (≈75°). It is mostly hydrophobic interaction. Only one molecule of water interface the Box and the DNA. the complex is stabilized by salt bridges between positive charged residues of the HMG domain and negative charged phosphates.&amp;lt;ref&amp;gt;PMID: 9626701&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
Even if the most important function of the HMG box is its capacity of binding DNA, it is also involved in:&lt;br /&gt;
*DNA bending &lt;br /&gt;
*DNA condensation&lt;br /&gt;
*Recombination&lt;br /&gt;
*Transcription activation&lt;br /&gt;
*DNA repair&lt;br /&gt;
&lt;br /&gt;
There are 2 kinds of protein that contain a HMG box&lt;br /&gt;
* HMG1 : It is expressed in few cell types. It is found in transcription factors that contain a single HMG box. The bind to a DNA sequence is specific.&lt;br /&gt;
* HMG2 : Are found in all cell types and are abundant in chromatin. This proteins can contain two or more HMG boxes that can nonspecifically bind DNA. &lt;br /&gt;
&lt;br /&gt;
===General structure of SRY===&lt;br /&gt;
&lt;br /&gt;
3 domains:&lt;br /&gt;
* N-term domain&lt;br /&gt;
* Central domain : DNA binding (HMG box)&lt;br /&gt;
* C-term domain&lt;br /&gt;
&lt;br /&gt;
===Structure of the DNA target site===&lt;br /&gt;
&lt;br /&gt;
The DNA target site is a DNA octamer : d(GCACAAAC).&lt;br /&gt;
&lt;br /&gt;
== Function ==&lt;br /&gt;
&lt;br /&gt;
===Sex determining===&lt;br /&gt;
It acts like a sex determinator thanks to it transcriptionnal activity. It inhibits the developpement of female sex structure in th embryonnic individual.&lt;br /&gt;
&lt;br /&gt;
==Implication - Future for SRY ?==&lt;br /&gt;
&lt;br /&gt;
== Disease ==&lt;br /&gt;
&lt;br /&gt;
=== Swyer syndrome (AKA XY gonadal dysgenis) :===&lt;br /&gt;
&lt;br /&gt;
	If the TDF protein is not able to bind its targeted DNA sequences, the genes responsible for the testis development are not expressed. The patient owning this defective protein will then develop female characters, even though he has a XY karyotype. This phenomenon is known as the « Swyer Syndrome ». &lt;br /&gt;
Different causes can explain this « XY gonadal dysgenis », as it is also called. About thirty mutations ([http://www.uniprot.org/uniprot/Q05066#sequences SRXY1]) in the SRY gene have been shown to drive this phenotype development. It can also be due to crossovers during a meiosis. If a Y chromosome portion carrying the SRY gene is recombined into a X chromosome, a sperm cell will get this abnormal Y chromosome. If it then fecundates, a XY karyotype without any SRY gene will be formed. &lt;br /&gt;
&lt;br /&gt;
=== De La Chapelle syndrome (AKA XX male syndrome) :===&lt;br /&gt;
&lt;br /&gt;
From the meiosis just described would also result an abnormal X chromosome, carrying the SRY gene. If the sperm cell owning this chromosome fecundates an ovule, the resulting newborn will have a XX karyotype but a male phenotype. This is called the « De La Chapelle syndrome ». In this case, the patient can either develop testis or both testis and ovarian tissues. As some epigenetic mechanisms can inactivate the X chromosome carrying SRY, this syndrome often keeps the patient sterile.&amp;lt;ref&amp;gt;PMID: 4622299&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
== Relevance ==&lt;br /&gt;
&lt;br /&gt;
== Structural highlights ==&lt;br /&gt;
&lt;br /&gt;
This is a sample scene created with SAT to &amp;lt;scene name=&amp;quot;/12/3456/Sample/1&amp;quot;&amp;gt;color&amp;lt;/scene&amp;gt; by Group, and another to make &amp;lt;scene name=&amp;quot;/12/3456/Sample/2&amp;quot;&amp;gt;a transparent representation&amp;lt;/scene&amp;gt; of the protein. You can make your own scenes on SAT starting from scratch or loading and editing one of these sample scenes.&lt;br /&gt;
&lt;br /&gt;
&amp;lt;/StructureSection&amp;gt;&lt;br /&gt;
== References ==&lt;br /&gt;
[http://ghr.nlm.nih.gov/gene/SRY Genetic Home reference]&lt;br /&gt;
&amp;lt;references/&amp;gt;&lt;/div&gt;</summary>
		<author><name>Fantin Mesny</name></author>
	</entry>
</feed>