User:Wayne Decatur/I-Ppo Morph Methods - Revision history

Wayne Decatur at 17:13, 7 December 2015

2015-12-07T17:13:05Z

← Older revision		Revision as of 17:13, 7 December 2015
Line 35:		Line 35:
	So I searched for something else thinking although I could break it up and do it with a simple Python program it would be nice to find a tool or service to do it to which I could direct students and colleagues who have the same issues arise instead of having them install Python if they aren't already using it.)		So I searched for something else thinking although I could break it up and do it with a simple Python program it would be nice to find a tool or service to do it to which I could direct students and colleagues who have the same issues arise instead of having them install Python if they aren't already using it.)

	I found [http://dicsoft2.physics.iisc.ernet.in/pdbgoodies/ PDB Goodies] to take care of the chain renumbering (a.k.a. 'change chain designations' or 'change chain identifiers' or change 'chain lettering'). To get started, just a bit down the page I clicked the not overly obvious spot that said 'click here to see available options in PDB Goodies' to start and on the next page uploaded my pdb file. (Note on this page a link to <help> in the bottom right corner that does summarize what PDB Goodies does). And I chose 'Change Chain Identifiers' and changed A and B to C and D easily using the form generated from my uploaded file and getting the results (HOWEVER DURING LATER USE OF THIS SITE I NOTED THAT WILL THE RESULT ON THE SCREEN AFTER RUNNING THE CHANGE HAD ALL THE RESIDUES, USING THE SAVE BUTTON ONLY OBTAINED 359 of THE 543 RESIDUES. SO BEST TO COPY TO RESULT FROM THE SCREEN.) (Note PDB goodies also renumbers residue numbers, generating a nice form using the file; I had problems when name of my uploaded file was very long (shortening name fixed it). )('''When helping people with animations previously I had used 'alter' command right in Pymol (see http://pymol.sourceforge.net/newman/ref/S1000comref.html) and ran 'sort' command after each altering in order to change chain designations in the pdb files, for example see [[User:Wayne Decatur/Sandboxmangai]]''' Plus 'alter' can be used to renumber residues of everything, see [http://pymolwiki.org/index.php/Alter the wiki].) For renumbering the atom numbers I found [http://www.mayachemtools.org/docs/scripts/html/ModifyPDBFiles.html this page] of documentation for [http://www.mayachemtools.org/ Maya Chem Tools] which does a lot more manipulating of PDB files than just what I found it for but it ~~is for installing with~~ Perl. So having found a number of possibly useful items, I decided it was easier to write my own Python script because I realized that I also need to discard lines that involved atoms designated 'H5*' that I assume came from Model It and this is a fairly unique situation that shouldn't arise often for others.		I found [http://dicsoft2.physics.iisc.ernet.in/pdbgoodies/ PDB Goodies] to take care of the chain renumbering (a.k.a. 'change chain designations' or 'change chain identifiers' or change 'chain lettering'). To get started, just a bit down the page I clicked the not overly obvious spot that said 'click here to see available options in PDB Goodies' to start and on the next page uploaded my pdb file. (Note on this page a link to <help> in the bottom right corner that does summarize what PDB Goodies does). And I chose 'Change Chain Identifiers' and changed A and B to C and D easily using the form generated from my uploaded file and getting the results (HOWEVER DURING LATER USE OF THIS SITE I NOTED THAT WILL THE RESULT ON THE SCREEN AFTER RUNNING THE CHANGE HAD ALL THE RESIDUES, USING THE SAVE BUTTON ONLY OBTAINED 359 of THE 543 RESIDUES. SO BEST TO COPY TO RESULT FROM THE SCREEN.) (Note PDB goodies also renumbers residue numbers, generating a nice form using the file; I had problems when name of my uploaded file was very long (shortening name fixed it). )('''When helping people with animations previously I had used 'alter' command right in Pymol (see http://pymol.sourceforge.net/newman/ref/S1000comref.html) and ran 'sort' command after each altering in order to change chain designations in the pdb files, for example see [[User:Wayne Decatur/Sandboxmangai]]''' Plus 'alter' can be used to renumber residues of everything, see [http://pymolwiki.org/index.php/Alter the wiki].) For renumbering the atom numbers I found [http://www.mayachemtools.org/docs/scripts/html/ModifyPDBFiles.html this page] of documentation for [http://www.mayachemtools.org/ Maya Chem Tools] which does a lot more manipulating of PDB files than just what I found it for, but it requires Perl. So having found a number of possibly useful items, I decided it was easier to write my own Python script because I realized that I also need to discard lines that involved atoms designated 'H5*' that I assume came from Model It and this is a fairly unique situation that shouldn't arise often for others.
	The Python (v2.5) script I generated (; it can be updated to version 3 by adding an opening parenthesis after the print function call and a closing one at the end of that line):		The Python (v2.5) script I generated (; it can be updated to version 3 by adding an opening parenthesis after the print function call and a closing one at the end of that line):

Wayne Decatur at 06:15, 11 March 2012

2012-03-11T06:15:52Z

← Older revision		Revision as of 06:15, 11 March 2012
Line 36:		Line 36:

	I found [http://dicsoft2.physics.iisc.ernet.in/pdbgoodies/ PDB Goodies] to take care of the chain renumbering (a.k.a. 'change chain designations' or 'change chain identifiers' or change 'chain lettering'). To get started, just a bit down the page I clicked the not overly obvious spot that said 'click here to see available options in PDB Goodies' to start and on the next page uploaded my pdb file. (Note on this page a link to <help> in the bottom right corner that does summarize what PDB Goodies does). And I chose 'Change Chain Identifiers' and changed A and B to C and D easily using the form generated from my uploaded file and getting the results (HOWEVER DURING LATER USE OF THIS SITE I NOTED THAT WILL THE RESULT ON THE SCREEN AFTER RUNNING THE CHANGE HAD ALL THE RESIDUES, USING THE SAVE BUTTON ONLY OBTAINED 359 of THE 543 RESIDUES. SO BEST TO COPY TO RESULT FROM THE SCREEN.) (Note PDB goodies also renumbers residue numbers, generating a nice form using the file; I had problems when name of my uploaded file was very long (shortening name fixed it). )('''When helping people with animations previously I had used 'alter' command right in Pymol (see http://pymol.sourceforge.net/newman/ref/S1000comref.html) and ran 'sort' command after each altering in order to change chain designations in the pdb files, for example see [[User:Wayne Decatur/Sandboxmangai]]''' Plus 'alter' can be used to renumber residues of everything, see [http://pymolwiki.org/index.php/Alter the wiki].) For renumbering the atom numbers I found [http://www.mayachemtools.org/docs/scripts/html/ModifyPDBFiles.html this page] of documentation for [http://www.mayachemtools.org/ Maya Chem Tools] which does a lot more manipulating of PDB files than just what I found it for but it is for installing with Perl. So having found a number of possibly useful items, I decided it was easier to write my own Python script because I realized that I also need to discard lines that involved atoms designated 'H5*' that I assume came from Model It and this is a fairly unique situation that shouldn't arise often for others.		I found [http://dicsoft2.physics.iisc.ernet.in/pdbgoodies/ PDB Goodies] to take care of the chain renumbering (a.k.a. 'change chain designations' or 'change chain identifiers' or change 'chain lettering'). To get started, just a bit down the page I clicked the not overly obvious spot that said 'click here to see available options in PDB Goodies' to start and on the next page uploaded my pdb file. (Note on this page a link to <help> in the bottom right corner that does summarize what PDB Goodies does). And I chose 'Change Chain Identifiers' and changed A and B to C and D easily using the form generated from my uploaded file and getting the results (HOWEVER DURING LATER USE OF THIS SITE I NOTED THAT WILL THE RESULT ON THE SCREEN AFTER RUNNING THE CHANGE HAD ALL THE RESIDUES, USING THE SAVE BUTTON ONLY OBTAINED 359 of THE 543 RESIDUES. SO BEST TO COPY TO RESULT FROM THE SCREEN.) (Note PDB goodies also renumbers residue numbers, generating a nice form using the file; I had problems when name of my uploaded file was very long (shortening name fixed it). )('''When helping people with animations previously I had used 'alter' command right in Pymol (see http://pymol.sourceforge.net/newman/ref/S1000comref.html) and ran 'sort' command after each altering in order to change chain designations in the pdb files, for example see [[User:Wayne Decatur/Sandboxmangai]]''' Plus 'alter' can be used to renumber residues of everything, see [http://pymolwiki.org/index.php/Alter the wiki].) For renumbering the atom numbers I found [http://www.mayachemtools.org/docs/scripts/html/ModifyPDBFiles.html this page] of documentation for [http://www.mayachemtools.org/ Maya Chem Tools] which does a lot more manipulating of PDB files than just what I found it for but it is for installing with Perl. So having found a number of possibly useful items, I decided it was easier to write my own Python script because I realized that I also need to discard lines that involved atoms designated 'H5*' that I assume came from Model It and this is a fairly unique situation that shouldn't arise often for others.
	The Python script I generated:		The Python (v2.5) script I generated (; it can be updated to version 3 by adding an opening parenthesis after the print function call and a closing one at the end of that line):

	<pre>		<pre>

Wayne Decatur at 20:57, 23 January 2012

2012-01-23T20:57:36Z

← Older revision		Revision as of 20:57, 23 January 2012
Line 35:		Line 35:
	So I searched for something else thinking although I could break it up and do it with a simple Python program it would be nice to find a tool or service to do it to which I could direct students and colleagues who have the same issues arise instead of having them install Python if they aren't already using it.)		So I searched for something else thinking although I could break it up and do it with a simple Python program it would be nice to find a tool or service to do it to which I could direct students and colleagues who have the same issues arise instead of having them install Python if they aren't already using it.)

	I found [http://dicsoft2.physics.iisc.ernet.in/pdbgoodies/ PDB Goodies] to take care of the chain renumbering (a.k.a. 'change chain designations' or 'change chain identifiers' or change 'chain lettering'). To get started, just a bit down the page I clicked the not overly obvious spot that said 'click here to see available options in PDB Goodies' to start and on the next page uploaded my pdb file. (Note on this page a link to <help> in the bottom right corner that does summarize what PDB Goodies does). And I chose 'Change Chain Identifiers' and changed A and B to C and D easily using the form generated from my uploaded file and getting the results (HOWEVER DURING LATER USE OF THIS SITE I NOTED THAT WILL THE RESULT ON THE SCREEN AFTER RUNNING THE CHANGE HAD ALL THE RESIDUES, USING THE SAVE BUTTON ONLY OBTAINED 359 of THE 543 RESIDUES. SO BEST TO COPY TO RESULT FROM THE SCREEN.) (Note PDB goodies also renumbers residue numbers, generating a nice form using the file; I had problems when name of my uploaded file was very long (shortening name fixed it). )('''When helping people with animations previously I had used 'alter' command right in Pymol (see http://pymol.sourceforge.net/newman/ref/S1000comref.html) and ran 'sort' command after each altering in order to change chain designations in the pdb files, for example see [[User:Wayne Decatur/Sandboxmangai]]''' Plus alter can be used to ~~renumer~~ residues of everything, see [http://pymolwiki.org/index.php/Alter the wiki].) For renumbering the atom numbers I found [http://www.mayachemtools.org/docs/scripts/html/ModifyPDBFiles.html this page] of documentation for [http://www.mayachemtools.org/ Maya Chem Tools] which does a lot more manipulating of PDB files than just what I found it for but it is for installing with Perl. So having found a number of possibly useful items, I decided it was easier to write my own Python script because I realized that I also need to discard lines that involved atoms designated 'H5*' that I assume came from Model It and this is a fairly unique situation that shouldn't arise often for others.		I found [http://dicsoft2.physics.iisc.ernet.in/pdbgoodies/ PDB Goodies] to take care of the chain renumbering (a.k.a. 'change chain designations' or 'change chain identifiers' or change 'chain lettering'). To get started, just a bit down the page I clicked the not overly obvious spot that said 'click here to see available options in PDB Goodies' to start and on the next page uploaded my pdb file. (Note on this page a link to <help> in the bottom right corner that does summarize what PDB Goodies does). And I chose 'Change Chain Identifiers' and changed A and B to C and D easily using the form generated from my uploaded file and getting the results (HOWEVER DURING LATER USE OF THIS SITE I NOTED THAT WILL THE RESULT ON THE SCREEN AFTER RUNNING THE CHANGE HAD ALL THE RESIDUES, USING THE SAVE BUTTON ONLY OBTAINED 359 of THE 543 RESIDUES. SO BEST TO COPY TO RESULT FROM THE SCREEN.) (Note PDB goodies also renumbers residue numbers, generating a nice form using the file; I had problems when name of my uploaded file was very long (shortening name fixed it). )('''When helping people with animations previously I had used 'alter' command right in Pymol (see http://pymol.sourceforge.net/newman/ref/S1000comref.html) and ran 'sort' command after each altering in order to change chain designations in the pdb files, for example see [[User:Wayne Decatur/Sandboxmangai]]''' Plus 'alter' can be used to renumber residues of everything, see [http://pymolwiki.org/index.php/Alter the wiki].) For renumbering the atom numbers I found [http://www.mayachemtools.org/docs/scripts/html/ModifyPDBFiles.html this page] of documentation for [http://www.mayachemtools.org/ Maya Chem Tools] which does a lot more manipulating of PDB files than just what I found it for but it is for installing with Perl. So having found a number of possibly useful items, I decided it was easier to write my own Python script because I realized that I also need to discard lines that involved atoms designated 'H5*' that I assume came from Model It and this is a fairly unique situation that shouldn't arise often for others.
	The Python script I generated:		The Python script I generated:

Wayne Decatur at 20:52, 23 January 2012

2012-01-23T20:52:17Z

← Older revision		Revision as of 20:52, 23 January 2012
Line 35:		Line 35:
	So I searched for something else thinking although I could break it up and do it with a simple Python program it would be nice to find a tool or service to do it to which I could direct students and colleagues who have the same issues arise instead of having them install Python if they aren't already using it.)		So I searched for something else thinking although I could break it up and do it with a simple Python program it would be nice to find a tool or service to do it to which I could direct students and colleagues who have the same issues arise instead of having them install Python if they aren't already using it.)

	I found [http://dicsoft2.physics.iisc.ernet.in/pdbgoodies/ PDB Goodies] to take care of the chain renumbering (a.k.a. 'change chain designations' or 'change chain identifiers' or change 'chain lettering'). To get started, just a bit down the page I clicked the not overly obvious spot that said 'click here to see available options in PDB Goodies' to start and on the next page uploaded my pdb file. (Note on this page a link to <help> in the bottom right corner that does summarize what PDB Goodies does). And I chose 'Change Chain Identifiers' and changed A and B to C and D easily using the form generated from my uploaded file and getting the results (HOWEVER DURING LATER USE OF THIS SITE I NOTED THAT WILL THE RESULT ON THE SCREEN AFTER RUNNING THE CHANGE HAD ALL THE RESIDUES, USING THE SAVE BUTTON ONLY OBTAINED 359 of THE 543 RESIDUES. SO BEST TO COPY TO RESULT FROM THE SCREEN.) (Note PDB goodies also renumbers residue numbers, generating a nice form using the file; I had problems when name of my uploaded file was very long (shortening name fixed it). )('''When helping people with animations previously I had used 'alter' command right in Pymol (see http://pymol.sourceforge.net/newman/ref/S1000comref.html) and ran 'sort' command after each altering in order to change chain designations in the pdb files, for example see [[User:Wayne Decatur/Sandboxmangai]]''') For renumbering the atom numbers I found [http://www.mayachemtools.org/docs/scripts/html/ModifyPDBFiles.html this page] of documentation for [http://www.mayachemtools.org/ Maya Chem Tools] which does a lot more manipulating of PDB files than just what I found it for but it is for installing with Perl. So having found a number of possibly useful items, I decided it was easier to write my own Python script because I realized that I also need to discard lines that involved atoms designated 'H5*' that I assume came from Model It and this is a fairly unique situation that shouldn't arise often for others.		I found [http://dicsoft2.physics.iisc.ernet.in/pdbgoodies/ PDB Goodies] to take care of the chain renumbering (a.k.a. 'change chain designations' or 'change chain identifiers' or change 'chain lettering'). To get started, just a bit down the page I clicked the not overly obvious spot that said 'click here to see available options in PDB Goodies' to start and on the next page uploaded my pdb file. (Note on this page a link to <help> in the bottom right corner that does summarize what PDB Goodies does). And I chose 'Change Chain Identifiers' and changed A and B to C and D easily using the form generated from my uploaded file and getting the results (HOWEVER DURING LATER USE OF THIS SITE I NOTED THAT WILL THE RESULT ON THE SCREEN AFTER RUNNING THE CHANGE HAD ALL THE RESIDUES, USING THE SAVE BUTTON ONLY OBTAINED 359 of THE 543 RESIDUES. SO BEST TO COPY TO RESULT FROM THE SCREEN.) (Note PDB goodies also renumbers residue numbers, generating a nice form using the file; I had problems when name of my uploaded file was very long (shortening name fixed it). )('''When helping people with animations previously I had used 'alter' command right in Pymol (see http://pymol.sourceforge.net/newman/ref/S1000comref.html) and ran 'sort' command after each altering in order to change chain designations in the pdb files, for example see [[User:Wayne Decatur/Sandboxmangai]]''' Plus alter can be used to renumer residues of everything, see [http://pymolwiki.org/index.php/Alter the wiki].) For renumbering the atom numbers I found [http://www.mayachemtools.org/docs/scripts/html/ModifyPDBFiles.html this page] of documentation for [http://www.mayachemtools.org/ Maya Chem Tools] which does a lot more manipulating of PDB files than just what I found it for but it is for installing with Perl. So having found a number of possibly useful items, I decided it was easier to write my own Python script because I realized that I also need to discard lines that involved atoms designated 'H5*' that I assume came from Model It and this is a fairly unique situation that shouldn't arise often for others.
	The Python script I generated:		The Python script I generated:

Wayne Decatur: added a new server for getting DNA moadel based on sequence alone

2012-01-23T04:26:32Z

added a new server for getting DNA moadel based on sequence alone

← Older revision		Revision as of 04:26, 23 January 2012
Line 1:		Line 1:
	Generated straight B-form DNA of homing site used in structure (TTGACTCTCTTAAGAGAGTCAA [extra 'A' at 3' end for getting two T's on both strands since you only enter text for one strand) using [http://hydra.icgeb.trieste.it/~kristian/dna/ Model It] (see [http://molvisindex.org molvisindex.org] under Molecules, Sources of PDB Files, under DNA Tools) as described in [[Lac repressor morph methods]]. Editing text of the pdb file, I deleted the 'A' at the three prime end of each strand to generate ends like in the 1a73 structure.		Generated straight B-form DNA of homing site used in structure (TTGACTCTCTTAAGAGAGTCAA [extra 'A' at 3' end for getting two T's on both strands since you only enter text for one strand) using [http://hydra.icgeb.trieste.it/~kristian/dna/ Model It] (see [http://molvisindex.org molvisindex.org] under Molecules, Sources of PDB Files, under DNA Tools) as described in [[Lac repressor morph methods]]. <nowiki>[</nowiki>UPDATE: The Model It server seems to no longer be accessible, but can use Custom Build on [http://haddock.chem.uu.nl/dna/dna.php the Utrecht Biomolecular Interaction web portal] to access
			[http://haddock.chem.uu.nl/services/3DDART/ the 3D-DART software web portal]; it was meant in part to help with making materials to be used in [http://www.nmr.chem.uu.nl/haddock/ the HADDOCK Docking server].<nowiki>]</nowiki> Editing text of the pdb file, I deleted the 'A' at the three prime end of each strand to generate ends like in the 1a73 structure.

	In order to use with straight B-form DNA (generated by Model IT), I needed to get unremediated pdb file for 1a73 or completely alter the order of the residue atoms and chain designations to match. I felt the unremediated file was the easiest route to go.		In order to use with straight B-form DNA (generated by Model IT), I needed to get unremediated pdb file for 1a73 or completely alter the order of the residue atoms and chain designations to match. I felt the unremediated file was the easiest route to go.

Wayne Decatur at 12:20, 14 March 2011

2011-03-14T12:20:09Z

← Older revision		Revision as of 12:20, 14 March 2011
Line 34:		Line 34:
	So I searched for something else thinking although I could break it up and do it with a simple Python program it would be nice to find a tool or service to do it to which I could direct students and colleagues who have the same issues arise instead of having them install Python if they aren't already using it.)		So I searched for something else thinking although I could break it up and do it with a simple Python program it would be nice to find a tool or service to do it to which I could direct students and colleagues who have the same issues arise instead of having them install Python if they aren't already using it.)

	I found [http://dicsoft2.physics.iisc.ernet.in/pdbgoodies/ PDB Goodies] to take care of the chain renumbering. To get started, just a bit down the page I clicked the not overly obvious spot that said 'click here to see available options in PDB Goodies' to start and on the next page uploaded my pdb file. (Note on this page a link to <help> in the bottom right corner that does summarize what PDB Goodies does). And I chose 'Change Identifiers' and changed A and B to C and D easily using the form generated from my uploaded file and getting the results (HOWEVER DURING LATER USE OF THIS SITE I NOTED THAT WILL THE RESULT ON THE SCREEN AFTER RUNNING THE CHANGE HAD ALL THE RESIDUES, USING THE SAVE BUTTON ONLY OBTAINED 359 of THE 543 RESIDUES. SO BEST TO COPY TO RESULT FROM THE SCREEN.) (Note PDB goodies also renumbers residue numbers, generating a nice form using the file; I had problems when name of my uploaded file was very long (shortening name fixed it). )('''When helping people with animations previously I had used 'alter' command right in Pymol (see http://pymol.sourceforge.net/newman/ref/S1000comref.html) and ran 'sort' command after each altering in order to change chain designations in the pdb files, for example see [[User:Wayne Decatur/Sandboxmangai]]''') For renumbering the atom numbers I found [http://www.mayachemtools.org/docs/scripts/html/ModifyPDBFiles.html this page] of documentation for [http://www.mayachemtools.org/ Maya Chem Tools] which does a lot more manipulating of PDB files than just what I found it for but it is for installing with Perl. So having found a number of possibly useful items, I decided it was easier to write my own Python script because I realized that I also need to discard lines that involved atoms designated 'H5*' that I assume came from Model It and this is a fairly unique situation that shouldn't arise often for others.		I found [http://dicsoft2.physics.iisc.ernet.in/pdbgoodies/ PDB Goodies] to take care of the chain renumbering (a.k.a. 'change chain designations' or 'change chain identifiers' or change 'chain lettering'). To get started, just a bit down the page I clicked the not overly obvious spot that said 'click here to see available options in PDB Goodies' to start and on the next page uploaded my pdb file. (Note on this page a link to <help> in the bottom right corner that does summarize what PDB Goodies does). And I chose 'Change Chain Identifiers' and changed A and B to C and D easily using the form generated from my uploaded file and getting the results (HOWEVER DURING LATER USE OF THIS SITE I NOTED THAT WILL THE RESULT ON THE SCREEN AFTER RUNNING THE CHANGE HAD ALL THE RESIDUES, USING THE SAVE BUTTON ONLY OBTAINED 359 of THE 543 RESIDUES. SO BEST TO COPY TO RESULT FROM THE SCREEN.) (Note PDB goodies also renumbers residue numbers, generating a nice form using the file; I had problems when name of my uploaded file was very long (shortening name fixed it). )('''When helping people with animations previously I had used 'alter' command right in Pymol (see http://pymol.sourceforge.net/newman/ref/S1000comref.html) and ran 'sort' command after each altering in order to change chain designations in the pdb files, for example see [[User:Wayne Decatur/Sandboxmangai]]''') For renumbering the atom numbers I found [http://www.mayachemtools.org/docs/scripts/html/ModifyPDBFiles.html this page] of documentation for [http://www.mayachemtools.org/ Maya Chem Tools] which does a lot more manipulating of PDB files than just what I found it for but it is for installing with Perl. So having found a number of possibly useful items, I decided it was easier to write my own Python script because I realized that I also need to discard lines that involved atoms designated 'H5*' that I assume came from Model It and this is a fairly unique situation that shouldn't arise often for others.
	The Python script I generated:		The Python script I generated:

Wayne Decatur at 02:44, 14 November 2010

2010-11-14T02:44:32Z

← Older revision		Revision as of 02:44, 14 November 2010
Line 49:		Line 49:
	</pre>		</pre>

	Next I combined the aligned edited 1evx file with the aligned edited unbound DNA file to match 1a73. At first I thought the [http://www2.molmovdb.org/wiki/info/index.php/Morph_Server Yale Morph Server] wouldn't work because I had DNA in the structure but in the FAQ I found a link to the [http://molmovdb.org/cgi-bin/multichain.cgi Morph Server for multiple subunits and nucleic acids] that sounded perfectly suited; however, it didn't seem to ever send anything back. So I went looking for more explanation and couldn't figure out what was wrong. So I looked at what the FAQ called 'the Beta server'. That server said on its page [http://www.molmovdb.org/cgi-bin/beta.cgi here] that is was the 'Server for morphing complexes' and they wanted to implement it working for nucleic acids "in a few weeks". (I also found that at the time, the link to the 'multi chain server' [http://www2.molmovdb.org/wiki/info/index.php/Morph_Server here] went to that server too.) On a lark, I tried it with the proteins (using the same file I submitted to the other server) and they came right back nicely morphed. Then I used it to submit the same files and they came back nicely morphed. IT WORKED.		Next I combined the aligned edited 1evx file with the aligned edited unbound DNA file to match 1a73. At first I thought the [http://www2.molmovdb.org/wiki/info/index.php/Morph_Server Yale Morph Server] wouldn't work because I had DNA in the structure but in the FAQ I found a link to the [http://molmovdb.org/cgi-bin/multichain.cgi Morph Server for multiple subunits and nucleic acids] that sounded perfectly suited; however, it didn't seem to ever send anything back. So I went looking for more explanation and couldn't figure out what was wrong. So I looked at what the FAQ called 'the Beta server'. That server said on its page [http://www.molmovdb.org/cgi-bin/beta.cgi here] that is was the 'Server for morphing complexes' and they wanted to implement it working for nucleic acids "in a few weeks". (I also found that at the time, the link to the 'multi chain server' [http://www2.molmovdb.org/wiki/info/index.php/Morph_Server here] went to that server too.) On a lark, I tried it with the proteins (using the same file I submitted to the other server) and they came right back nicely morphed. Then I used it to submit the same files with the nucleic acid and they came back nicely morphed. IT WORKED.

Wayne Decatur at 02:04, 24 May 2010

2010-05-24T02:04:07Z

← Older revision		Revision as of 02:04, 24 May 2010
Line 34:		Line 34:
	So I searched for something else thinking although I could break it up and do it with a simple Python program it would be nice to find a tool or service to do it to which I could direct students and colleagues who have the same issues arise instead of having them install Python if they aren't already using it.)		So I searched for something else thinking although I could break it up and do it with a simple Python program it would be nice to find a tool or service to do it to which I could direct students and colleagues who have the same issues arise instead of having them install Python if they aren't already using it.)

	I found [http://dicsoft2.physics.iisc.ernet.in/pdbgoodies/ PDB Goodies] to take care of the chain renumbering. To get started, just a bit down the page I clicked the not overly obvious spot that said 'click here to see available options in PDB Goodies' to start and on the next page uploaded my pdb file. (Note on this page a link to <help> in the bottom right corner that does summarize what PDB Goodies does). And I chose 'Change Identifiers' and changed A and B to C and D easily using the form generated from my uploaded file and getting the results. (Note PDB goodies also renumbers ~~residues~~ numbers, generating a nice form using the file; I had problems when name of my uploaded file was very long (shortening name fixed it). )('''When helping people with animations previously I had used 'alter' command right in Pymol (see http://pymol.sourceforge.net/newman/ref/S1000comref.html) and ran 'sort' command after each altering in order to change chain designations in the pdb files, for example see [[User:Wayne Decatur/Sandboxmangai]]''') For renumbering the atom numbers I found [http://www.mayachemtools.org/docs/scripts/html/ModifyPDBFiles.html this page] of documentation for [http://www.mayachemtools.org/ Maya Chem Tools] which does a lot more manipulating of PDB files than just what I found it for but it is for installing with Perl. So having found a number of possibly useful items, I decided it was easier to write my own Python script because I realized that I also need to discard lines that involved atoms designated 'H5*' that I assume came from Model It and this is a fairly unique situation that shouldn't arise often for others.		I found [http://dicsoft2.physics.iisc.ernet.in/pdbgoodies/ PDB Goodies] to take care of the chain renumbering. To get started, just a bit down the page I clicked the not overly obvious spot that said 'click here to see available options in PDB Goodies' to start and on the next page uploaded my pdb file. (Note on this page a link to <help> in the bottom right corner that does summarize what PDB Goodies does). And I chose 'Change Identifiers' and changed A and B to C and D easily using the form generated from my uploaded file and getting the results (HOWEVER DURING LATER USE OF THIS SITE I NOTED THAT WILL THE RESULT ON THE SCREEN AFTER RUNNING THE CHANGE HAD ALL THE RESIDUES, USING THE SAVE BUTTON ONLY OBTAINED 359 of THE 543 RESIDUES. SO BEST TO COPY TO RESULT FROM THE SCREEN.) (Note PDB goodies also renumbers residue numbers, generating a nice form using the file; I had problems when name of my uploaded file was very long (shortening name fixed it). )('''When helping people with animations previously I had used 'alter' command right in Pymol (see http://pymol.sourceforge.net/newman/ref/S1000comref.html) and ran 'sort' command after each altering in order to change chain designations in the pdb files, for example see [[User:Wayne Decatur/Sandboxmangai]]''') For renumbering the atom numbers I found [http://www.mayachemtools.org/docs/scripts/html/ModifyPDBFiles.html this page] of documentation for [http://www.mayachemtools.org/ Maya Chem Tools] which does a lot more manipulating of PDB files than just what I found it for but it is for installing with Perl. So having found a number of possibly useful items, I decided it was easier to write my own Python script because I realized that I also need to discard lines that involved atoms designated 'H5*' that I assume came from Model It and this is a fairly unique situation that shouldn't arise often for others.
	The Python script I generated:		The Python script I generated:

Wayne Decatur at 20:36, 5 May 2010

2010-05-05T20:36:49Z

← Older revision		Revision as of 20:36, 5 May 2010
Line 32:		Line 32:


	So I searched for something else thinking although I could break it up and do it with a simple Python program it would be nice to find ~~something~~ to do it.)		So I searched for something else thinking although I could break it up and do it with a simple Python program it would be nice to find a tool or service to do it to which I could direct students and colleagues who have the same issues arise instead of having them install Python if they aren't already using it.)

	I found [http://dicsoft2.physics.iisc.ernet.in/pdbgoodies/ PDB Goodies] to take care of the chain renumbering. To get started, just a bit down the page I clicked the not overly obvious spot that said 'click here to see available options in PDB Goodies' to start and on the next page uploaded my pdb file. (Note on this page a link to <help> in the bottom right corner that does summarize what PDB Goodies does). And I chose 'Change Identifiers' and changed A and B to C and D easily using the form generated from my uploaded file and getting the results. (Note PDB goodies also renumbers residues numbers, generating a nice form using the file; I had problems when name of my uploaded file was very long (shortening name fixed it). )('''When helping people with animations previously I had used 'alter' command right in Pymol (see http://pymol.sourceforge.net/newman/ref/S1000comref.html) and ran 'sort' command after each altering in order to change chain designations in the pdb files, for example see [[User:Wayne Decatur/Sandboxmangai]]''') For renumbering the atom numbers I found [http://www.mayachemtools.org/docs/scripts/html/ModifyPDBFiles.html this page] of documentation for [http://www.mayachemtools.org/ Maya Chem Tools] which does a lot more manipulating of PDB files than just what I found it for but it is for installing with Perl. So I ~~gave up and wrote~~ my own Python script ~~and as I did it,~~ I realized that I also need to discard lines that involved atoms designated 'H5*' that I assume came from Model It.		I found [http://dicsoft2.physics.iisc.ernet.in/pdbgoodies/ PDB Goodies] to take care of the chain renumbering. To get started, just a bit down the page I clicked the not overly obvious spot that said 'click here to see available options in PDB Goodies' to start and on the next page uploaded my pdb file. (Note on this page a link to <help> in the bottom right corner that does summarize what PDB Goodies does). And I chose 'Change Identifiers' and changed A and B to C and D easily using the form generated from my uploaded file and getting the results. (Note PDB goodies also renumbers residues numbers, generating a nice form using the file; I had problems when name of my uploaded file was very long (shortening name fixed it). )('''When helping people with animations previously I had used 'alter' command right in Pymol (see http://pymol.sourceforge.net/newman/ref/S1000comref.html) and ran 'sort' command after each altering in order to change chain designations in the pdb files, for example see [[User:Wayne Decatur/Sandboxmangai]]''') For renumbering the atom numbers I found [http://www.mayachemtools.org/docs/scripts/html/ModifyPDBFiles.html this page] of documentation for [http://www.mayachemtools.org/ Maya Chem Tools] which does a lot more manipulating of PDB files than just what I found it for but it is for installing with Perl. So having found a number of possibly useful items, I decided it was easier to write my own Python script because I realized that I also need to discard lines that involved atoms designated 'H5*' that I assume came from Model It and this is a fairly unique situation that shouldn't arise often for others.
	The Python script I generated:		The Python script I generated:

Line 49:		Line 49:
	</pre>		</pre>

	Next I combined the aligned edited 1evx file with the aligned edited unbound DNA file to match 1a73. At first I thought the [http://www2.molmovdb.org/wiki/info/index.php/Morph_Server Yale Morph Server] wouldn't work because I had DNA in the structure but in the FAQ I found a link to the [http://molmovdb.org/cgi-bin/multichain.cgi Morph Server for multiple subunits and nucleic acids] that sounded perfectly suited; however, it didn't seem to ever send anything back. So I went looking for more explanation and couldn't figure out what was wrong. So I looked at what the FAQ called 'the Beta server'. That server said on its page [http://www.molmovdb.org/cgi-bin/beta.cgi here] that is was the 'Server for morphing complexes' and they wanted to implement it working for nucleic acids "in a few weeks". (I also found that at the time, the link to the 'multi chain server' [http://www2.molmovdb.org/wiki/info/index.php/Morph_Server here] went to that server too.) On a lark, I tried it with the proteins (using the same file I submitted to the other server) and they came right back nicely morphed. Then I used it to submit the same files and they came back nicely morphed~~!!!!~~ IT WORKED~~!!!~~		Next I combined the aligned edited 1evx file with the aligned edited unbound DNA file to match 1a73. At first I thought the [http://www2.molmovdb.org/wiki/info/index.php/Morph_Server Yale Morph Server] wouldn't work because I had DNA in the structure but in the FAQ I found a link to the [http://molmovdb.org/cgi-bin/multichain.cgi Morph Server for multiple subunits and nucleic acids] that sounded perfectly suited; however, it didn't seem to ever send anything back. So I went looking for more explanation and couldn't figure out what was wrong. So I looked at what the FAQ called 'the Beta server'. That server said on its page [http://www.molmovdb.org/cgi-bin/beta.cgi here] that is was the 'Server for morphing complexes' and they wanted to implement it working for nucleic acids "in a few weeks". (I also found that at the time, the link to the 'multi chain server' [http://www2.molmovdb.org/wiki/info/index.php/Morph_Server here] went to that server too.) On a lark, I tried it with the proteins (using the same file I submitted to the other server) and they came right back nicely morphed. Then I used it to submit the same files and they came back nicely morphed. IT WORKED.

Wayne Decatur at 21:01, 16 December 2009

2009-12-16T21:01:30Z

← Older revision		Revision as of 21:01, 16 December 2009
Line 34:		Line 34:
	So I searched for something else thinking although I could break it up and do it with a simple Python program it would be nice to find something to do it.)		So I searched for something else thinking although I could break it up and do it with a simple Python program it would be nice to find something to do it.)

	I found [http://dicsoft2.physics.iisc.ernet.in/pdbgoodies/ PDB Goodies] to take care of the chain renumbering. To get started, just a bit down the page I clicked the not overly obvious spot that said 'click here to see available options in PDB Goodies' to start and on the next page uploaded my pdb file. (Note on this page a link to <help> in the bottom right corner that does summarize what PDB Goodies does). And I chose 'Change Identifiers' and changed A and B to C and D easily using the form generated from my uploaded file and getting the results. (Note PDB goodies also renumbers residues numbers, generating a nice form using the file; I had problems when name of my uploaded file was very long (shortening name fixed it). )(When helping people with animations previously I had used 'alter' command right in Pymol (see http://pymol.sourceforge.net/newman/ref/S1000comref.html) and ran 'sort' command after each altering to change chain designations.) For renumbering the atom numbers I found [http://www.mayachemtools.org/docs/scripts/html/ModifyPDBFiles.html this page] of documentation for [http://www.mayachemtools.org/ Maya Chem Tools] which does a lot more manipulating of PDB files than just what I found it for but it is for installing with Perl. So I gave up and wrote my own Python script and as I did it, I realized that I also need to discard lines that involved atoms designated 'H5*' that I assume came from Model It.		I found [http://dicsoft2.physics.iisc.ernet.in/pdbgoodies/ PDB Goodies] to take care of the chain renumbering. To get started, just a bit down the page I clicked the not overly obvious spot that said 'click here to see available options in PDB Goodies' to start and on the next page uploaded my pdb file. (Note on this page a link to <help> in the bottom right corner that does summarize what PDB Goodies does). And I chose 'Change Identifiers' and changed A and B to C and D easily using the form generated from my uploaded file and getting the results. (Note PDB goodies also renumbers residues numbers, generating a nice form using the file; I had problems when name of my uploaded file was very long (shortening name fixed it). )('''When helping people with animations previously I had used 'alter' command right in Pymol (see http://pymol.sourceforge.net/newman/ref/S1000comref.html) and ran 'sort' command after each altering in order to change chain designations in the pdb files, for example see [[User:Wayne Decatur/Sandboxmangai]]''') For renumbering the atom numbers I found [http://www.mayachemtools.org/docs/scripts/html/ModifyPDBFiles.html this page] of documentation for [http://www.mayachemtools.org/ Maya Chem Tools] which does a lot more manipulating of PDB files than just what I found it for but it is for installing with Perl. So I gave up and wrote my own Python script and as I did it, I realized that I also need to discard lines that involved atoms designated 'H5*' that I assume came from Model It.
	The Python script I generated:		The Python script I generated: