2m93: Difference between revisions

From Proteopedia
Jump to navigationJump to search
OCA (talk | contribs)
m Protected "2m93" [edit=sysop:move=sysop]
OCA (talk | contribs)
No edit summary
 
(10 intermediate revisions by the same user not shown)
Line 1: Line 1:
'''Unreleased structure'''


The entry 2m93 is ON HOLD
==Structure of d[TTGGGTGGGCGCGAAGCATTCGCGGGGTGGGT] quadruplex-duplex hybrid==
<StructureSection load='2m93' size='340' side='right'caption='[[2m93]]' scene=''>
== Structural highlights ==
<table><tr><td colspan='2'>[[2m93]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=2M93 OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=2M93 FirstGlance]. <br>
</td></tr><tr id='method'><td class="sblockLbl"><b>[[Empirical_models|Method:]]</b></td><td class="sblockDat" id="methodDat">Solution NMR</td></tr>
<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=2m93 FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=2m93 OCA], [https://pdbe.org/2m93 PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=2m93 RCSB], [https://www.ebi.ac.uk/pdbsum/2m93 PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=2m93 ProSAT]</span></td></tr>
</table>
<div style="background-color:#fffaf0;">
== Publication Abstract from PubMed ==
Coaxial and orthogonal orientations of the helices (left and right illustration, respectively) in a quadruplex-duplex junction were realized by incorporating a duplex hairpin across the diverse geometries of a quadruplex. The modularity of the approach was validated through the simultaneous attachment of multiple duplex stems onto a G-quadruplex scaffold to generate a G-junction.


Authors: Lim, K., Phan, A.
Structural Basis of DNA Quadruplex-Duplex Junction Formation.,Lim KW, Phan AT Angew Chem Int Ed Engl. 2013 Jun 21. doi: 10.1002/anie.201302995. PMID:23794476<ref>PMID:23794476</ref>


Description: Structure of d[TTGGGTGGGCGCGAAGCATTCGCGGGGTGGGT] duplex-quadruplex hybrid
From MEDLINE&reg;/PubMed&reg;, a database of the U.S. National Library of Medicine.<br>
</div>
<div class="pdbe-citations 2m93" style="background-color:#fffaf0;"></div>
== References ==
<references/>
__TOC__
</StructureSection>
[[Category: Large Structures]]
[[Category: Lim KW]]
[[Category: Phan AT]]

Latest revision as of 06:02, 15 May 2024

Structure of d[TTGGGTGGGCGCGAAGCATTCGCGGGGTGGGT] quadruplex-duplex hybrid

Drag the structure with the mouse to rotate

Proteopedia Page Contributors and Editors (what is this?)

OCA