3iv5: Difference between revisions

From Proteopedia
Jump to navigationJump to search
OCA (talk | contribs)
No edit summary
OCA (talk | contribs)
No edit summary
 
(9 intermediate revisions by the same user not shown)
Line 1: Line 1:
'''Unreleased structure'''


The entry 3iv5 is ON HOLD
==Crystal structure of Fis bound to 27 bp optimal binding sequence F1==
<StructureSection load='3iv5' size='340' side='right'caption='[[3iv5]], [[Resolution|resolution]] 2.90&Aring;' scene=''>
== Structural highlights ==
<table><tr><td colspan='2'>[[3iv5]] is a 4 chain structure with sequence from [https://en.wikipedia.org/wiki/Escherichia_coli_K-12 Escherichia coli K-12]. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=3IV5 OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=3IV5 FirstGlance]. <br>
</td></tr><tr id='method'><td class="sblockLbl"><b>[[Empirical_models|Method:]]</b></td><td class="sblockDat" id="methodDat">X-ray diffraction, [[Resolution|Resolution]] 2.9&#8491;</td></tr>
<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=3iv5 FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=3iv5 OCA], [https://pdbe.org/3iv5 PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=3iv5 RCSB], [https://www.ebi.ac.uk/pdbsum/3iv5 PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=3iv5 ProSAT]</span></td></tr>
</table>
== Function ==
[https://www.uniprot.org/uniprot/FIS_ECOLI FIS_ECOLI] Activates ribosomal RNA transcription, as well other genes. Plays a direct role in upstream activation of rRNA promoters. Binds to a recombinational enhancer sequence that is required to stimulate hin-mediated DNA inversion. Prevents initiation of DNA replication from oriC.<ref>PMID:2209559</ref> <ref>PMID:8836178</ref>
== Evolutionary Conservation ==
[[Image:Consurf_key_small.gif|200px|right]]
Check<jmol>
  <jmolCheckbox>
    <scriptWhenChecked>; select protein; define ~consurf_to_do selected; consurf_initial_scene = true; script "/wiki/ConSurf/iv/3iv5_consurf.spt"</scriptWhenChecked>
    <scriptWhenUnchecked>script /wiki/extensions/Proteopedia/spt/initialview01.spt</scriptWhenUnchecked>
    <text>to colour the structure by Evolutionary Conservation</text>
  </jmolCheckbox>
</jmol>, as determined by [http://consurfdb.tau.ac.il/ ConSurfDB]. You may read the [[Conservation%2C_Evolutionary|explanation]] of the method and the full data available from [http://bental.tau.ac.il/new_ConSurfDB/main_output.php?pdb_ID=3iv5 ConSurf].
<div style="clear:both"></div>
<div style="background-color:#fffaf0;">
== Publication Abstract from PubMed ==
The bacterial nucleoid-associated protein Fis regulates diverse reactions by bending DNA and through DNA-dependent interactions with other control proteins and enzymes. In addition to dynamic nonspecific binding to DNA, Fis forms stable complexes with DNA segments that share little sequence conservation. Here we report the first crystal structures of Fis bound to high- and low-affinity 27-base-pair DNA sites. These 11 structures reveal that Fis selects targets primarily through indirect recognition mechanisms involving the shape of the minor groove and sequence-dependent induced fits over adjacent major groove interfaces. The DNA shows an overall curvature of approximately 65 degrees , and the unprecedented close spacing between helix-turn-helix motifs present in the apodimer is accommodated by severe compression of the central minor groove. In silico DNA structure models show that only the roll, twist, and slide parameters are sufficient to reproduce the changes in minor groove widths and recreate the curved Fis-bound DNA structure. Models based on naked DNA structures suggest that Fis initially selects DNA targets with intrinsically narrow minor grooves using the separation between helix-turn-helix motifs in the Fis dimer as a ruler. Then Fis further compresses the minor groove and bends the DNA to generate the bound structure.


Authors: Stella, S., Cascio, D., Johnson, R.C.
The shape of the DNA minor groove directs binding by the DNA-bending protein Fis.,Stella S, Cascio D, Johnson RC Genes Dev. 2010 Apr 15;24(8):814-26. PMID:20395367<ref>PMID:20395367</ref>


Description: Crystal structure of Fis bound to 27bp consensus sequence DNA F1(AAATTTGTTTGAATTTTGAGCAAATTT)
From MEDLINE&reg;/PubMed&reg;, a database of the U.S. National Library of Medicine.<br>
</div>
<div class="pdbe-citations 3iv5" style="background-color:#fffaf0;"></div>


''Page seeded by [http://oca.weizmann.ac.il/oca OCA ] on Wed Sep 30 08:59:19 2009''
==See Also==
*[[FIS protein|FIS protein]]
== References ==
<references/>
__TOC__
</StructureSection>
[[Category: Escherichia coli K-12]]
[[Category: Large Structures]]
[[Category: Cascio D]]
[[Category: Johnson RC]]
[[Category: Stella S]]