User:Wayne Decatur/I-Ppo Morph Methods: Difference between revisions

From Proteopedia
Jump to navigationJump to search
Wayne Decatur (talk | contribs)
mNo edit summary
Wayne Decatur (talk | contribs)
mNo edit summary
 
(4 intermediate revisions by the same user not shown)
Line 1: Line 1:
Generated straight B-form DNA of homing site used in structure (TTGACTCTCTTAAGAGAGTCAA [extra 'A' at 3' end for getting two T's on both strands since you only enter text for one strand) using [http://hydra.icgeb.trieste.it/~kristian/dna/ Model It] (see [http://molvisindex.org molvisindex.org] under Molecules, Sources of PDB Files, under DNA Tools) as described in [[Lac repressor morph methods]]. Editing text of the pdb file, I deleted the 'A' at the three prime end of each strand to generate ends like in the 1a73 structure.
Generated straight B-form DNA of homing site used in structure (TTGACTCTCTTAAGAGAGTCAA [extra 'A' at 3' end for getting two T's on both strands since you only enter text for one strand) using [http://hydra.icgeb.trieste.it/~kristian/dna/ Model It] (see [http://molvisindex.org molvisindex.org] under Molecules, Sources of PDB Files, under DNA Tools) as described in [[Lac repressor morph methods]]. <nowiki>[</nowiki>UPDATE: The Model It server seems to no longer be accessible, but can use Custom Build on [http://haddock.chem.uu.nl/dna/dna.php the Utrecht Biomolecular Interaction web portal] to access
[http://haddock.chem.uu.nl/services/3DDART/ the 3D-DART software web portal]; it was meant in part to help with making materials to be used in [http://www.nmr.chem.uu.nl/haddock/ the HADDOCK Docking server].<nowiki>]</nowiki> Editing text of the pdb file, I deleted the 'A' at the three prime end of each strand to generate ends like in the 1a73 structure.


In order to use with straight B-form DNA (generated by Model IT), I needed to get unremediated pdb file for 1a73 or completely alter the order of the residue atoms and chain designations to match. I felt the unremediated file was the easiest route to go.
In order to use with straight B-form DNA (generated by Model IT), I needed to get unremediated pdb file for 1a73 or completely alter the order of the residue atoms and chain designations to match. I felt the unremediated file was the easiest route to go.
Line 34: Line 35:
So I searched for something else thinking although I could break it up and do it with a simple Python program it would be nice to find a tool or service to do it to which I could direct students and colleagues who have the same issues arise instead of having them install Python if they aren't already using it.)
So I searched for something else thinking although I could break it up and do it with a simple Python program it would be nice to find a tool or service to do it to which I could direct students and colleagues who have the same issues arise instead of having them install Python if they aren't already using it.)


I found [http://dicsoft2.physics.iisc.ernet.in/pdbgoodies/ PDB Goodies] to take care of the chain renumbering (a.k.a. 'change chain designations' or 'change chain identifiers' or change 'chain lettering'). To get started, just a bit down the page I clicked the not overly obvious spot that said 'click here to see available options in PDB Goodies' to start and on the next page uploaded my pdb file. (Note on this page a link to <help> in the bottom right corner that does summarize what PDB Goodies does). And I chose 'Change Chain Identifiers' and changed A and B to C and D easily using the form generated from my uploaded file and getting the results (HOWEVER DURING LATER USE OF THIS SITE I NOTED THAT WILL THE RESULT ON THE SCREEN AFTER RUNNING THE CHANGE HAD ALL THE RESIDUES, USING THE SAVE BUTTON ONLY OBTAINED 359 of THE 543 RESIDUES. SO BEST TO COPY TO RESULT FROM THE SCREEN.) (Note PDB goodies also renumbers residue numbers, generating a nice form using the file; I had problems when name of my uploaded file was very long (shortening name fixed it). )('''When helping people with animations previously I had used 'alter' command right in Pymol (see http://pymol.sourceforge.net/newman/ref/S1000comref.html) and ran 'sort' command after each altering in order to change chain designations in the pdb files, for example see [[User:Wayne Decatur/Sandboxmangai]]''') For renumbering the atom numbers I found [http://www.mayachemtools.org/docs/scripts/html/ModifyPDBFiles.html this page] of documentation for [http://www.mayachemtools.org/ Maya Chem Tools] which does a lot more manipulating of PDB files than just what I found it for but it is for installing with Perl. So having found a number of possibly useful items, I decided it was easier to write my own Python script because I realized that I also need to discard lines that involved atoms designated 'H5*' that I assume came from Model It and this is a fairly unique situation that shouldn't arise often for others.  
I found [http://dicsoft2.physics.iisc.ernet.in/pdbgoodies/ PDB Goodies] to take care of the chain renumbering (a.k.a. 'change chain designations' or 'change chain identifiers' or change 'chain lettering'). To get started, just a bit down the page I clicked the not overly obvious spot that said 'click here to see available options in PDB Goodies' to start and on the next page uploaded my pdb file. (Note on this page a link to <help> in the bottom right corner that does summarize what PDB Goodies does). And I chose 'Change Chain Identifiers' and changed A and B to C and D easily using the form generated from my uploaded file and getting the results (HOWEVER DURING LATER USE OF THIS SITE I NOTED THAT WILL THE RESULT ON THE SCREEN AFTER RUNNING THE CHANGE HAD ALL THE RESIDUES, USING THE SAVE BUTTON ONLY OBTAINED 359 of THE 543 RESIDUES. SO BEST TO COPY TO RESULT FROM THE SCREEN.) (Note PDB goodies also renumbers residue numbers, generating a nice form using the file; I had problems when name of my uploaded file was very long (shortening name fixed it). )('''When helping people with animations previously I had used 'alter' command right in Pymol (see http://pymol.sourceforge.net/newman/ref/S1000comref.html) and ran 'sort' command after each altering in order to change chain designations in the pdb files, for example see [[User:Wayne Decatur/Sandboxmangai]]''' Plus 'alter' can be used to renumber residues of everything, see [http://pymolwiki.org/index.php/Alter the wiki].) For renumbering the atom numbers I found [http://www.mayachemtools.org/docs/scripts/html/ModifyPDBFiles.html this page] of documentation for [http://www.mayachemtools.org/ Maya Chem Tools] which does a lot more manipulating of PDB files than just what I found it for, but it requires Perl. So having found a number of possibly useful items, I decided it was easier to write my own Python script because I realized that I also need to discard lines that involved atoms designated 'H5*' that I assume came from Model It and this is a fairly unique situation that shouldn't arise often for others.  
The Python script I generated:  
The Python (v2.5) script I generated (; it can be updated to version 3 by adding an opening parenthesis after the print function call and a closing one at the end of that line):  


<pre>
<pre>