6gh0: Difference between revisions
From Proteopedia
Jump to navigationJump to search
New page: '''Unreleased structure''' The entry 6gh0 is ON HOLD Authors: Description: Category: Unreleased Structures |
No edit summary |
||
| (2 intermediate revisions by the same user not shown) | |||
| Line 1: | Line 1: | ||
==Two-quartet kit* G-quadruplex is formed via double-stranded pre-folded structure== | |||
<StructureSection load='6gh0' size='340' side='right'caption='[[6gh0]], [[NMR_Ensembles_of_Models | 10 NMR models]]' scene=''> | |||
== Structural highlights == | |||
<table><tr><td colspan='2'>[[6gh0]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=6GH0 OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=6GH0 FirstGlance]. <br> | |||
</td></tr><tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=6gh0 FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=6gh0 OCA], [http://pdbe.org/6gh0 PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=6gh0 RCSB], [http://www.ebi.ac.uk/pdbsum/6gh0 PDBsum], [http://prosat.h-its.org/prosat/prosatexe?pdbcode=6gh0 ProSAT]</span></td></tr> | |||
</table> | |||
<div style="background-color:#fffaf0;"> | |||
== Publication Abstract from PubMed == | |||
In the promoter of c-KIT proto-oncogene, whose deregulation has been implicated in many cancers, three G-rich regions (kit1, kit* and kit2) are able to fold into G-quadruplexes. While kit1 and kit2 have been studied in depth, little information is available on kit* folding behavior despite its key role in regulation of c-KIT transcription. Notably, kit* contains consensus sites for SP1 and AP2 transcription factors. Herein, a set of complementary spectroscopic and biophysical methods reveals that kit*, d[GGCGAGGAGGGGCGTGGCCGGC], adopts a chair type antiparallel G-quadruplex with two G-quartets at physiological relevant concentrations of KCl. Heterogeneous ensemble of structures is observed in the presence of Na+ and NH4+ ions, which however stabilize pre-folded structure. In the presence of K+ ions stacking interactions of adenine and thymine residues on the top G-quartet contribute to structural stability together with a G10*C18 base pair and a fold-back motif of the five residues at the 3'-terminal under the bottom G-quartet. The 3'-tail enables formation of a bimolecular pre-folded structure that drives folding of kit* into a single G-quadruplex. Intriguingly, kinetics of kit* G-quadruplex formation matches timescale of transcriptional processes and might demonstrate interplay of kinetic and thermodynamic factors for understanding regulation of c-KIT proto-oncogene expression. | |||
Two-quartet kit* G-quadruplex is formed via double-stranded pre-folded structure.,Kotar A, Rigo R, Sissi C, Plavec J Nucleic Acids Res. 2018 Dec 21. pii: 5257350. doi: 10.1093/nar/gky1269. PMID:30590801<ref>PMID:30590801</ref> | |||
From MEDLINE®/PubMed®, a database of the U.S. National Library of Medicine.<br> | |||
[[Category: | </div> | ||
<div class="pdbe-citations 6gh0" style="background-color:#fffaf0;"></div> | |||
== References == | |||
<references/> | |||
__TOC__ | |||
</StructureSection> | |||
[[Category: Large Structures]] | |||
[[Category: Kotar, A]] | |||
[[Category: Plavec, J]] | |||
[[Category: Rigo, R]] | |||
[[Category: Sissi, C]] | |||
[[Category: C-kit promoter]] | |||
[[Category: Dna]] | |||
[[Category: G-quadruplex]] | |||
[[Category: Two g-quartet]] | |||
