5j6u: Difference between revisions
From Proteopedia
Jump to navigationJump to search
No edit summary |
No edit summary |
||
| (One intermediate revision by the same user not shown) | |||
| Line 1: | Line 1: | ||
==DIY G-Quadruplexes: Solution Structure of d(GGGGTTTGGGGTTTTGGGGAAGGGG) in sodium== | ==DIY G-Quadruplexes: Solution Structure of d(GGGGTTTGGGGTTTTGGGGAAGGGG) in sodium== | ||
<StructureSection load='5j6u' size='340' side='right'caption='[[5j6u | <StructureSection load='5j6u' size='340' side='right'caption='[[5j6u]]' scene=''> | ||
== Structural highlights == | == Structural highlights == | ||
<table><tr><td colspan='2'>[[5j6u]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=5J6U OCA]. For a <b>guided tour on the structure components</b> use [ | <table><tr><td colspan='2'>[[5j6u]] is a 1 chain structure with sequence from [https://en.wikipedia.org/wiki/Synthetic_construct Synthetic construct]. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=5J6U OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=5J6U FirstGlance]. <br> | ||
</td></tr><tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[ | </td></tr><tr id='method'><td class="sblockLbl"><b>[[Empirical_models|Method:]]</b></td><td class="sblockDat" id="methodDat">Solution NMR</td></tr> | ||
<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=5j6u FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=5j6u OCA], [https://pdbe.org/5j6u PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=5j6u RCSB], [https://www.ebi.ac.uk/pdbsum/5j6u PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=5j6u ProSAT]</span></td></tr> | |||
</table> | </table> | ||
<div style="background-color:#fffaf0;"> | <div style="background-color:#fffaf0;"> | ||
| Line 20: | Line 21: | ||
</StructureSection> | </StructureSection> | ||
[[Category: Large Structures]] | [[Category: Large Structures]] | ||
[[Category: | [[Category: Synthetic construct]] | ||
[[Category: | [[Category: Dvorkin SA]] | ||
[[Category: | [[Category: Karsisiotis AI]] | ||
[[Category: | [[Category: Webba da Silva M]] | ||
Latest revision as of 06:01, 19 June 2024
DIY G-Quadruplexes: Solution Structure of d(GGGGTTTGGGGTTTTGGGGAAGGGG) in sodium
| ||||||||||||