3iv5: Difference between revisions

From Proteopedia
Jump to navigationJump to search
OCA (talk | contribs)
No edit summary
OCA (talk | contribs)
No edit summary
Line 1: Line 1:
'''Unreleased structure'''
'''Unreleased structure'''


The entry 3iv5 is ON HOLD  
The entry 3iv5 is ON HOLD until Paper Publication


Authors: Stella, S., Cascio, D., Johnson, R.C.
Authors: Stella, S., Cascio, D., Johnson, R.C.


Description: Crystal structure of Fis bound to 27bp consensus sequence DNA F1(AAATTTGTTTGAATTTTGAGCAAATTT)
Description: Crystal structure of Fis bound to 27 bp optimal binding sequence F1


''Page seeded by [http://oca.weizmann.ac.il/oca OCA ] on Wed Sep 30 08:59:19 2009''
''Page seeded by [http://oca.weizmann.ac.il/oca OCA ] on Wed Dec 23 09:19:18 2009''