2m92: Difference between revisions

From Proteopedia
Jump to navigationJump to search
← Older editNewer edit →
OCA (talk | contribs)
Bots, Bureaucrats, journal, Administrators
3,330,058 edits
No edit summary
OCA (talk | contribs)
Bots, Bureaucrats, journal, Administrators
3,330,058 edits
No edit summary
Line 1: Line 1:
'''Unreleased structure'''
{{STRUCTURE_2m92|  PDB=2m92  |  SCENE=  }}
===Structure of d[AGGGTGGGTGCTGGGGCGCGAAGCATTCGCGAGG] quadruplex-duplex hybrid===
{{ABSTRACT_PUBMED_23794476}}


The entry 2m92 is ON HOLD  until Paper Publication
==About this Structure==
[[2m92]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=2M92 OCA].


Authors: Lim, K.W., Phan, A.T.
==Reference==
 
<ref group="xtra">PMID:023794476</ref><references group="xtra"/><references/>
Description: Structure of d[AGGGTGGGTGCTGGGGCGCGAAGCATTCGCGAGG] quadruplex-duplex hybrid
[[Category: Lim, K W.]]
[[Category: Phan, A T.]]
[[Category: Dna]]
[[Category: Duplex]]
[[Category: Quadruplex]]
[[Category: Quadruplex-duplex hybrid]]

Revision as of 15:42, 10 July 2013

Template:STRUCTURE 2m92

Structure of d[AGGGTGGGTGCTGGGGCGCGAAGCATTCGCGAGG] quadruplex-duplex hybrid

Template:ABSTRACT PUBMED 23794476

About this Structure

2m92 is a 1 chain structure. Full experimental information is available from OCA.

Reference

  1. Lim KW, Phan AT. Structural Basis of DNA Quadruplex-Duplex Junction Formation. Angew Chem Int Ed Engl. 2013 Jun 21. doi: 10.1002/anie.201302995. PMID:23794476 doi:10.1002/anie.201302995

Proteopedia Page Contributors and Editors (what is this?)

OCA

Retrieved from "https://proteopedia.org/index.php?title=2m92&oldid=1819460"