2m6w: Difference between revisions

From Proteopedia
Jump to navigationJump to search
OCA (talk | contribs)
No edit summary
OCA (talk | contribs)
No edit summary
Line 1: Line 1:
'''Unreleased structure'''
==Solution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex in sodium conditions==
 
<StructureSection load='2m6w' size='340' side='right' caption='[[2m6w]], [[NMR_Ensembles_of_Models | 8 NMR models]]' scene=''>
The entry 2m6w is ON HOLD  until Jul 23 2015
== Structural highlights ==
 
<table><tr><td colspan='2'>[[2m6w]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=2M6W OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=2M6W FirstGlance]. <br>
Authors: Karsisiotis, A., Webba da Silva, M.
</td></tr><tr><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=2m6w FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=2m6w OCA], [http://www.rcsb.org/pdb/explore.do?structureId=2m6w RCSB], [http://www.ebi.ac.uk/pdbsum/2m6w PDBsum]</span></td></tr>
 
<table>
Description: Solution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex in sodium conditions
__TOC__
</StructureSection>
[[Category: Karsisiotis, A.]]
[[Category: Silva, M Webba da.]]
[[Category: Dna]]
[[Category: Folding topology]]
[[Category: G-quadruplex]]

Revision as of 08:02, 23 July 2014

Solution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex in sodium conditions

Drag the structure with the mouse to rotate

Proteopedia Page Contributors and Editors (what is this?)

OCA