5ds9: Difference between revisions
From Proteopedia
Jump to navigationJump to search
m Protected "5ds9" [edit=sysop:move=sysop] |
No edit summary |
||
| Line 1: | Line 1: | ||
'''Unreleased structure''' | '''Unreleased structure''' | ||
The entry 5ds9 is ON HOLD until | The entry 5ds9 is ON HOLD until sometime in the future | ||
Authors: Hancock, S.P., Cascio, D., Johnson, R.C. | Authors: Hancock, S.P., Cascio, D., Johnson, R.C. | ||
Revision as of 12:32, 7 October 2015
Unreleased structure
The entry 5ds9 is ON HOLD until sometime in the future
Authors: Hancock, S.P., Cascio, D., Johnson, R.C.
Description: Crystal structure of Fis bound to 27bp DNA F1-8A (AAATTAGTTTGAATTTTGAGCTAATTT)
