5e3l: Difference between revisions

From Proteopedia
Jump to navigationJump to search
OCA (talk | contribs)
New page: '''Unreleased structure''' The entry 5e3l is ON HOLD Authors: Hancock, S.P., Cascio, D., Johnson, R.C. Description: Crystal structure of Fis bound to 27bp DNA F1-8G (AAATTGGTTTGAATTTTG...
 
OCA (talk | contribs)
m Protected "5e3l" [edit=sysop:move=sysop]
(No difference)

Revision as of 02:56, 16 October 2015

Unreleased structure

The entry 5e3l is ON HOLD

Authors: Hancock, S.P., Cascio, D., Johnson, R.C.

Description: Crystal structure of Fis bound to 27bp DNA F1-8G (AAATTGGTTTGAATTTTGAGCCAATTT)

Proteopedia Page Contributors and Editors (what is this?)

OCA