5e3l: Difference between revisions
From Proteopedia
Jump to navigationJump to search
New page: '''Unreleased structure''' The entry 5e3l is ON HOLD Authors: Hancock, S.P., Cascio, D., Johnson, R.C. Description: Crystal structure of Fis bound to 27bp DNA F1-8G (AAATTGGTTTGAATTTTG... |
m Protected "5e3l" [edit=sysop:move=sysop] |
(No difference)
| |
Revision as of 02:56, 16 October 2015
Unreleased structure
The entry 5e3l is ON HOLD
Authors: Hancock, S.P., Cascio, D., Johnson, R.C.
Description: Crystal structure of Fis bound to 27bp DNA F1-8G (AAATTGGTTTGAATTTTGAGCCAATTT)
