Sandbox Reserved 1120: Difference between revisions

From Proteopedia
Jump to navigationJump to search
No edit summary
No edit summary
Line 49: Line 49:
AGGGATGACTGTACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAACG
AGGGATGACTGTACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAACG
CAGCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTG<FONT color="red"><b>TAG</b></FONT>GACAATCGGGTAACATT
CAGCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTG<FONT color="red"><b>TAG</b></FONT>GACAATCGGGTAACATT
GGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCACTTTCTTATGTTTAGTTT
GGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCACTTTCTTATGTTTAGTTTCAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCATTTCA</small></center>
CAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCATTTCA</small></div></center>
 
'''legend of bold '''


<FONT color="green"><b>Initiation codon</b></FONT>
<FONT color="green"><b>Initiation codon</b></FONT>
Line 58: Line 55:
<b>HMG sequence</b>
<b>HMG sequence</b>


<FONT color="red"><b>Stop codon</b></FONT>
<FONT color="red"><b>Stop codon</b></FONT></div>


===Regulation of the expression of the SRY gene===
===Regulation of the expression of the SRY gene===

Revision as of 10:04, 28 January 2016

This Sandbox is Reserved from 15/12/2015, through 15/06/2016 for use in the course "Structural Biology" taught by Bruno Kieffer at the University of Strasbourg, ESBS. This reservation includes Sandbox Reserved 1120 through Sandbox Reserved 1159.
To get started:
  • Click the edit this page tab at the top. Save the page after each step, then edit it again.
  • Click the 3D button (when editing, above the wikitext box) to insert Jmol.
  • show the Scene authoring tools, create a molecular scene, and save it. Copy the green link into the page.
  • Add a description of your scene. Use the buttons above the wikitext box for bold, italics, links, headlines, etc.

More help: Help:Editing

SRY protein (AKA TDF protein)

The SRY protein linked to DNA

Drag the structure with the mouse to rotate

References

Genetic Home reference