5j05: Difference between revisions
From Proteopedia
Jump to navigationJump to search
No edit summary |
No edit summary |
||
| Line 1: | Line 1: | ||
==DIY G-Quadruplexes: Solution structure of d(GGGTTTGGGTTTTGGGAGGG) in sodium== | |||
<StructureSection load='5j05' size='340' side='right' caption='[[5j05]], [[NMR_Ensembles_of_Models | 10 NMR models]]' scene=''> | |||
== Structural highlights == | |||
<table><tr><td colspan='2'>[[5j05]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=5J05 OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=5J05 FirstGlance]. <br> | |||
</td></tr><tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=5j05 FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=5j05 OCA], [http://pdbe.org/5j05 PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=5j05 RCSB], [http://www.ebi.ac.uk/pdbsum/5j05 PDBsum], [http://prosat.h-its.org/prosat/prosatexe?pdbcode=5j05 ProSAT]</span></td></tr> | |||
[[Category: | </table> | ||
__TOC__ | |||
</StructureSection> | |||
[[Category: Dvorkin, S A]] | |||
[[Category: Karsisiotis, A I]] | |||
[[Category: Silva, M Webba da]] | |||
[[Category: Dna]] | |||
[[Category: Structure from molmol]] | |||
Revision as of 13:25, 5 April 2017
DIY G-Quadruplexes: Solution structure of d(GGGTTTGGGTTTTGGGAGGG) in sodium
| ||||||||||||