5j05: Difference between revisions

From Proteopedia
Jump to navigationJump to search
OCA (talk | contribs)
No edit summary
OCA (talk | contribs)
No edit summary
Line 1: Line 1:
'''Unreleased structure'''


The entry 5j05 is ON HOLD  until Paper Publication
==DIY G-Quadruplexes: Solution structure of d(GGGTTTGGGTTTTGGGAGGG) in sodium==
 
<StructureSection load='5j05' size='340' side='right' caption='[[5j05]], [[NMR_Ensembles_of_Models | 10 NMR models]]' scene=''>
Authors:  
== Structural highlights ==
 
<table><tr><td colspan='2'>[[5j05]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=5J05 OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=5J05 FirstGlance]. <br>
Description:  
</td></tr><tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=5j05 FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=5j05 OCA], [http://pdbe.org/5j05 PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=5j05 RCSB], [http://www.ebi.ac.uk/pdbsum/5j05 PDBsum], [http://prosat.h-its.org/prosat/prosatexe?pdbcode=5j05 ProSAT]</span></td></tr>
[[Category: Unreleased Structures]]
</table>
__TOC__
</StructureSection>
[[Category: Dvorkin, S A]]
[[Category: Karsisiotis, A I]]
[[Category: Silva, M Webba da]]
[[Category: Dna]]
[[Category: Structure from molmol]]

Revision as of 13:25, 5 April 2017

DIY G-Quadruplexes: Solution structure of d(GGGTTTGGGTTTTGGGAGGG) in sodium

Drag the structure with the mouse to rotate

Proteopedia Page Contributors and Editors (what is this?)

OCA