7otb: Difference between revisions

From Proteopedia
Jump to navigationJump to search
OCA (talk | contribs)
No edit summary
OCA (talk | contribs)
No edit summary
Line 1: Line 1:


==Ruthenium polypridyl complex bound to a unimolecular chair-form G-quadruplex==
==Ruthenium polypridyl complex bound to a unimolecular chair-form G-quadruplex==
<StructureSection load='7otb' size='340' side='right'caption='[[7otb]]' scene=''>
<StructureSection load='7otb' size='340' side='right'caption='[[7otb]], [[Resolution|resolution]] 1.60&Aring;' scene=''>
== Structural highlights ==
== Structural highlights ==
<table><tr><td colspan='2'>Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=7OTB OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=7OTB FirstGlance]. <br>
<table><tr><td colspan='2'>[[7otb]] is a 1 chain structure. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=7OTB OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=7OTB FirstGlance]. <br>
</td></tr><tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=7otb FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=7otb OCA], [https://pdbe.org/7otb PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=7otb RCSB], [https://www.ebi.ac.uk/pdbsum/7otb PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=7otb ProSAT]</span></td></tr>
</td></tr><tr id='ligand'><td class="sblockLbl"><b>[[Ligand|Ligands:]]</b></td><td class="sblockDat" id="ligandDat"><scene name='pdbligand=0K8:Ruthenium+bis-(phenanthroline)+12,17-dihydro-naphthodipyridophenazine-12,17-dione'>0K8</scene>, <scene name='pdbligand=BA:BARIUM+ION'>BA</scene>, <scene name='pdbligand=K:POTASSIUM+ION'>K</scene></td></tr>
<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=7otb FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=7otb OCA], [https://pdbe.org/7otb PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=7otb RCSB], [https://www.ebi.ac.uk/pdbsum/7otb PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=7otb ProSAT]</span></td></tr>
</table>
</table>
<div style="background-color:#fffaf0;">
== Publication Abstract from PubMed ==
The DNA G-quadruplex is known for forming a range of topologies and for the observed lability of the assembly, consistent with its transient formation in live cells. The stabilization of a particular topology by a small molecule is of great importance for therapeutic applications. Here, we show that the ruthenium complex Lambda-[Ru(phen)2(qdppz)](2+) displays enantiospecific G-quadruplex binding. It crystallized in 1:1 stoichiometry with a modified human telomeric G-quadruplex sequence, GGGTTAGGGTTAGGGTTTGGG (htel21T18), in an antiparallel chair topology, the first structurally characterized example of ligand binding to this topology. The lambda complex is bound in an intercalation cavity created by a terminal G-quartet and the central narrow lateral loop formed by T10-T11-A12. The two remaining wide lateral loops are linked through a third K(+) ion at the other end of the G-quartet stack, which also coordinates three thymine residues. In a comparative ligand-binding study, we showed, using a Klenow fragment assay, that this complex is the strongest observed inhibitor of replication, both using the native human telomeric sequence and the modified sequence used in this work.
Ruthenium Polypyridyl Complex Bound to a Unimolecular Chair-Form G-Quadruplex.,McQuaid KT, Takahashi S, Baumgaertner L, Cardin DJ, Paterson NG, Hall JP, Sugimoto N, Cardin CJ J Am Chem Soc. 2022 Mar 24. doi: 10.1021/jacs.2c00178. PMID:35324198<ref>PMID:35324198</ref>
From MEDLINE&reg;/PubMed&reg;, a database of the U.S. National Library of Medicine.<br>
</div>
<div class="pdbe-citations 7otb" style="background-color:#fffaf0;"></div>
== References ==
<references/>
__TOC__
__TOC__
</StructureSection>
</StructureSection>
[[Category: Large Structures]]
[[Category: Large Structures]]
[[Category: Baumgaertner L]]
[[Category: Baumgaertner, L]]
[[Category: Cardin CJ]]
[[Category: Cardin, C J]]
[[Category: Hall JP]]
[[Category: Hall, J P]]
[[Category: McQuaid KT]]
[[Category: McQuaid, K T]]
[[Category: Paterson NG]]
[[Category: Paterson, N G]]
[[Category: Chair]]
[[Category: Dna]]
[[Category: G-quadruplex]]
[[Category: Ruthenium]]
[[Category: Telomeric]]