9pz7: Difference between revisions

From Proteopedia
Jump to navigationJump to search
OCA (talk | contribs)
m Protected "9pz7" [edit=sysop:move=sysop]
OCA (talk | contribs)
No edit summary
Line 1: Line 1:
'''Unreleased structure'''
'''Unreleased structure'''


The entry 9pz7 is ON HOLD  
The entry 9pz7 is ON HOLD until Paper Publication


Authors: Werther, R., Stoddard, B.L.
Authors: Werther, R., Stoddard, B.L.


Description: Engineered variant of I-OnuI meganuclease to target DNA sequence TTTCCACTTATTCACTATTTTA
Description: One of a series of engineered variants of I-OnuI meganuclease targeting altered DNA target sequence
[[Category: Unreleased Structures]]
[[Category: Unreleased Structures]]
[[Category: Werther, R]]
[[Category: Stoddard, B.L]]
[[Category: Stoddard, B.L]]
[[Category: Werther, R]]

Revision as of 09:04, 3 September 2025

Unreleased structure

The entry 9pz7 is ON HOLD until Paper Publication

Authors: Werther, R., Stoddard, B.L.

Description: One of a series of engineered variants of I-OnuI meganuclease targeting altered DNA target sequence

Proteopedia Page Contributors and Editors (what is this?)

OCA