User:Wayne Decatur/I-Ppo Morph Methods: Difference between revisions
From Proteopedia
Jump to navigationJump to search
New page: Generated straight B-form DNA of homing site used in structure (TTGACTCTCTTAAGAGAGTCAA [extra 'A' at 3' end for getting two T's on both strands since you only enter text for one strand) us... |
No edit summary |
||
| Line 1: | Line 1: | ||
Generated straight B-form DNA of homing site used in structure (TTGACTCTCTTAAGAGAGTCAA [extra 'A' at 3' end for getting two T's on both strands since you only enter text for one strand) using Model It as described in [[Lac repressor morph methods]]. I deleted the | Generated straight B-form DNA of homing site used in structure (TTGACTCTCTTAAGAGAGTCAA [extra 'A' at 3' end for getting two T's on both strands since you only enter text for one strand) using Model It as described in [[Lac repressor morph methods]]. Editing text of the pdb file, I deleted the 'A' at the three prime end of each strand to generate like in structure. | ||
In order to use with straight B-form DNA, I needed to get unremediated pdb file for 1a73 or | In order to use with straight B-form DNA, I needed to get unremediated pdb file for 1a73 or | ||
Revision as of 06:44, 30 December 2008
Generated straight B-form DNA of homing site used in structure (TTGACTCTCTTAAGAGAGTCAA [extra 'A' at 3' end for getting two T's on both strands since you only enter text for one strand) using Model It as described in Lac repressor morph methods. Editing text of the pdb file, I deleted the 'A' at the three prime end of each strand to generate like in structure.
In order to use with straight B-form DNA, I needed to get unremediated pdb file for 1a73 or
