User:Wayne Decatur/I-Ppo Morph Methods: Difference between revisions
From Proteopedia
Jump to navigationJump to search
No edit summary |
No edit summary |
||
| Line 1: | Line 1: | ||
Generated straight B-form DNA of homing site used in structure (TTGACTCTCTTAAGAGAGTCAA [extra 'A' at 3' end for getting two T's on both strands since you only enter text for one strand) using Model It as described in [[Lac repressor morph methods]]. Editing text of the pdb file, I deleted the 'A' at the three prime end of each strand to generate ends | Generated straight B-form DNA of homing site used in structure (TTGACTCTCTTAAGAGAGTCAA [extra 'A' at 3' end for getting two T's on both strands since you only enter text for one strand) using Model It as described in [[Lac repressor morph methods]]. Editing text of the pdb file, I deleted the 'A' at the three prime end of each strand to generate ends like in the 1a73 structure. | ||
In order to use with straight B-form DNA, I needed to get unremediated pdb file for 1a73 or completely alter the order and chain designations to match. I felt the unremediated file was the easiest route to go. | In order to use with straight B-form DNA, I needed to get unremediated pdb file for 1a73 or completely alter the order and chain designations to match. I felt the unremediated file was the easiest route to go. | ||