User:Wayne Decatur/I-Ppo Morph Methods: Difference between revisions

From Proteopedia
Jump to navigationJump to search
Wayne Decatur (talk | contribs)
No edit summary
Wayne Decatur (talk | contribs)
No edit summary
Line 2: Line 2:


In order to use with straight B-form DNA, I needed to get unremediated pdb file for 1a73 or completely alter the order and chain designations to match. I felt the unremediated file was the easiest route to go.
In order to use with straight B-form DNA, I needed to get unremediated pdb file for 1a73 or completely alter the order and chain designations to match. I felt the unremediated file was the easiest route to go.
I loaded 1a73 structure into swiss-pdb viewer and let it magic fit the apo enzyme in 1evx. I disabled movement on those two structures and loaded the unbound DNA. When I had turned it so it was close, I enable movement on all and turned about 90 degress and then disabled movement again all all but the unbound DNA and moved it into plane with the other structures. I save each layer individually. I edited the aligned 1evx file to match atom numbers with the aligned 1a73 and removed the SO4s. I deleted the 2 MGs in the aligned 1a73 file.

Revision as of 01:09, 19 April 2009

Generated straight B-form DNA of homing site used in structure (TTGACTCTCTTAAGAGAGTCAA [extra 'A' at 3' end for getting two T's on both strands since you only enter text for one strand) using Model It as described in Lac repressor morph methods. Editing text of the pdb file, I deleted the 'A' at the three prime end of each strand to generate ends like in the 1a73 structure.

In order to use with straight B-form DNA, I needed to get unremediated pdb file for 1a73 or completely alter the order and chain designations to match. I felt the unremediated file was the easiest route to go.

I loaded 1a73 structure into swiss-pdb viewer and let it magic fit the apo enzyme in 1evx. I disabled movement on those two structures and loaded the unbound DNA. When I had turned it so it was close, I enable movement on all and turned about 90 degress and then disabled movement again all all but the unbound DNA and moved it into plane with the other structures. I save each layer individually. I edited the aligned 1evx file to match atom numbers with the aligned 1a73 and removed the SO4s. I deleted the 2 MGs in the aligned 1a73 file.

Proteopedia Page Contributors and Editors (what is this?)

Wayne Decatur