User:Wayne Decatur/I-Ppo Morph Methods: Difference between revisions
From Proteopedia
Jump to navigationJump to search
No edit summary |
No edit summary |
||
| Line 1: | Line 1: | ||
Generated straight B-form DNA of homing site used in structure (TTGACTCTCTTAAGAGAGTCAA [extra 'A' at 3' end for getting two T's on both strands since you only enter text for one strand) using Model It as described in [[Lac repressor morph methods]]. Editing text of the pdb file, I deleted the 'A' at the three prime end of each strand to generate ends like in the 1a73 structure. | Generated straight B-form DNA of homing site used in structure (TTGACTCTCTTAAGAGAGTCAA [extra 'A' at 3' end for getting two T's on both strands since you only enter text for one strand) using [http://hydra.icgeb.trieste.it/~kristian/dna/ Model It] (see [http://molvisindex.org molvisindex.org] under Molecules, Sources of PDB Files, under DNA Tools) as described in [[Lac repressor morph methods]]. Editing text of the pdb file, I deleted the 'A' at the three prime end of each strand to generate ends like in the 1a73 structure. | ||
In order to use with straight B-form DNA, I needed to get unremediated pdb file for 1a73 or completely alter the order and chain designations to match. I felt the unremediated file was the easiest route to go. | In order to use with straight B-form DNA (generated by Model IT), I needed to get unremediated pdb file for 1a73 or completely alter the order and chain designations to match. I felt the unremediated file was the easiest route to go. | ||
I loaded 1a73 structure into | I loaded 1a73 structure into [http://spdbv.vital-it.ch/ Swiss-pdb viewer (DEEP VIEW)] and let it magic fit the apo enzyme in 1evx. I disabled movement on those two structures and loaded the unbound DNA. When I had turned it so it was close, I enable movement on all and turned about 90 degrees and then disabled movement again all all but the unbound DNA and moved it into plane with the other structures. I save each layer individually. I edited the aligned 1evx file to match atom numbers with the aligned 1a73 and removed the SO4s. I deleted the 2 Magnesiums in the aligned 1a73 file. | ||
Next, I needed to renumber the atoms in the unbound DNA to make it easy to compare to file 1a73 for matchin up number of atoms since morphing needs equal numbers. I also needed to change the chain ids from a and b to match c and d in 1a73. | Next, I needed to renumber the atoms in the unbound DNA to make it easy to compare to file 1a73 for matchin up number of atoms since morphing needs equal numbers. I also needed to change the chain ids from a and b to match c and d in 1a73. | ||
| Line 35: | Line 35: | ||
So I searched for something else thinking although I could break it up and do it with a simple Python program it would be nice to find something to do it.) | So I searched for something else thinking although I could break it up and do it with a simple Python program it would be nice to find something to do it.) | ||
I found [http://dicsoft2.physics.iisc.ernet.in/pdbgoodies/ PDB Goodies] to take care of the chain renumbering. To get started, just a bit down the page I clicked the not overly obvious spot that said 'click here to see available options in PDB Goodies' to start and on the next page uploaded my pdb file. (Note on this page a link to <help> in the bottom right corner that does summarize what PDB Goodies does). And I chose 'Change Identifiers' and changed A and B to C and D easily using the form generated from my uploaded file and getting the results. (Note PDB goodies also renumbers residues numbers, generating a nice form using the file.) | I found [http://dicsoft2.physics.iisc.ernet.in/pdbgoodies/ PDB Goodies] to take care of the chain renumbering. To get started, just a bit down the page I clicked the not overly obvious spot that said 'click here to see available options in PDB Goodies' to start and on the next page uploaded my pdb file. (Note on this page a link to <help> in the bottom right corner that does summarize what PDB Goodies does). And I chose 'Change Identifiers' and changed A and B to C and D easily using the form generated from my uploaded file and getting the results. (Note PDB goodies also renumbers residues numbers, generating a nice form using the file and that I had problems when name of my uploaded file was very long (shortening name fixed it).) | ||
For renumbering the atom numbers I found [http://www.mayachemtools.org/docs/scripts/html/ModifyPDBFiles.html this page] of documentation for [http://www.mayachemtools.org/ Maya Chem Tools] which does a lot more manipulatinf of PDB files than just what I found it for but it is for installing with Perl. So I gave up and wrote my own Python script and as I did it, I realized that I also need to discard lines that involved atoms designated 'H5*' that I assume came from Model It. | For renumbering the atom numbers I found [http://www.mayachemtools.org/docs/scripts/html/ModifyPDBFiles.html this page] of documentation for [http://www.mayachemtools.org/ Maya Chem Tools] which does a lot more manipulatinf of PDB files than just what I found it for but it is for installing with Perl. So I gave up and wrote my own Python script and as I did it, I realized that I also need to discard lines that involved atoms designated 'H5*' that I assume came from Model It. | ||
The Python script I generated: | The Python script I generated: | ||