User:Wayne Decatur/I-Ppo Morph Methods: Difference between revisions
From Proteopedia
Jump to navigationJump to search
No edit summary |
No edit summary |
||
| Line 1: | Line 1: | ||
Generated straight B-form DNA of homing site used in structure (TTGACTCTCTTAAGAGAGTCAA [extra 'A' at 3' end for getting two T's on both strands since you only enter text for one strand) using [http://hydra.icgeb.trieste.it/~kristian/dna/ Model It] (see [http://molvisindex.org molvisindex.org] under Molecules, Sources of PDB Files, under DNA Tools) as described in [[Lac repressor morph methods]]. Editing text of the pdb file, I deleted the 'A' at the three prime end of each strand to generate ends like in the 1a73 structure. | Generated straight B-form DNA of homing site used in structure (TTGACTCTCTTAAGAGAGTCAA [extra 'A' at 3' end for getting two T's on both strands since you only enter text for one strand) using [http://hydra.icgeb.trieste.it/~kristian/dna/ Model It] (see [http://molvisindex.org molvisindex.org] under Molecules, Sources of PDB Files, under DNA Tools) as described in [[Lac repressor morph methods]]. Editing text of the pdb file, I deleted the 'A' at the three prime end of each strand to generate ends like in the 1a73 structure. | ||
In order to use with straight B-form DNA (generated by Model IT), I needed to get unremediated pdb file for 1a73 or completely alter the order and chain designations to match. I felt the unremediated file was the easiest route to go. | In order to use with straight B-form DNA (generated by Model IT), I needed to get unremediated pdb file for 1a73 or completely alter the order of the residue atoms and chain designations to match. I felt the unremediated file was the easiest route to go. | ||
I loaded 1a73 structure into [http://spdbv.vital-it.ch/ Swiss-pdb viewer (DEEP VIEW)] and let it magic fit the apo enzyme in 1evx. I disabled movement on those two structures and loaded the unbound DNA. When I had turned it so it was close, I enable movement on all and turned about 90 degrees and then disabled movement again all all but the unbound DNA and moved it into plane with the other structures. I save each layer individually. I edited the aligned 1evx file to match atom numbers with the aligned 1a73 and removed the SO4s. I deleted the 2 Magnesiums in the aligned 1a73 file. | I loaded 1a73 structure into [http://spdbv.vital-it.ch/ Swiss-pdb viewer (DEEP VIEW)] and let it magic fit the apo enzyme in 1evx. I disabled movement on those two structures and loaded the unbound DNA. When I had turned it so it was close, I enable movement on all and turned about 90 degrees and then disabled movement again all all but the unbound DNA and moved it into plane with the other structures. I save each layer individually. I edited the aligned 1evx file to match atom numbers with the aligned 1a73 and removed the SO4s. I deleted the 2 Magnesiums in the aligned 1a73 file. | ||
