1r7w: Difference between revisions

From Proteopedia
Jump to navigationJump to search
OCA (talk | contribs)
New page: left|200px<br /><applet load="1r7w" size="450" color="white" frame="true" align="right" spinBox="true" caption="1r7w" /> '''NMR STRUCTURE OF THE R(GGAGGACAUCCCUCACGGGUG...
 
OCA (talk | contribs)
No edit summary
Line 1: Line 1:
[[Image:1r7w.gif|left|200px]]<br /><applet load="1r7w" size="450" color="white" frame="true" align="right" spinBox="true"  
[[Image:1r7w.gif|left|200px]]<br /><applet load="1r7w" size="350" color="white" frame="true" align="right" spinBox="true"  
caption="1r7w" />
caption="1r7w" />
'''NMR STRUCTURE OF THE R(GGAGGACAUCCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUCCCU BULGE'''<br />
'''NMR STRUCTURE OF THE R(GGAGGACAUCCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUCCCU BULGE'''<br />


==Overview==
==Overview==
The 5'-untranslated region of positive-strand RNA viruses harbors many, cis-acting RNA structural elements that are important for various viral, processes such as replication, translation, and packaging of new virions., Among these is loop B RNA of the stem-loop IV domain within the internal, ribosomal entry site (IRES) of enteroviruses, including Poliovirus type 1, (PV1). Studies on PV1 have shown that specific recognition of loop B by, the first KH (hnRNP K homology) domain of cellular poly(rC)-binding, protein 2 (PCBP2) is essential for efficient translation of the viral, mRNA. Here we report the NMR solution structures of two representative, sequence variants of enteroviral loop B RNA. The two RNA variants differ, at only one position (C vs U) within a six-nucleotide asymmetric internal, loop sequence that is the binding site for the PCBP2 KH1 domain., Surprisingly, the two RNAs are drastically different in the overall shape, and local dynamics of the bulge region. The RNA with the 5'-AUCCCU bulge, sequence adopts an overall L shape. Its bulge nucleotides, especially the, last four, are highly flexible and not very well defined by NMR. The RNA, with the 5'-AUUCCU bulge sequence adopts an overall U shape, and its bulge, sequence exhibits only limited flexibility. A detailed analysis of the two, RNA structures and their dynamic properties, as well as available sequence, data and known KH domain-RNA complex structures, not only provides, insights into how loop B RNA might be recognized by the PCBP2 KH1 domain, but also suggests a possible correlation between structural flexibility, and pre-existing structural features for protein recognition.
The 5'-untranslated region of positive-strand RNA viruses harbors many cis-acting RNA structural elements that are important for various viral processes such as replication, translation, and packaging of new virions. Among these is loop B RNA of the stem-loop IV domain within the internal ribosomal entry site (IRES) of enteroviruses, including Poliovirus type 1 (PV1). Studies on PV1 have shown that specific recognition of loop B by the first KH (hnRNP K homology) domain of cellular poly(rC)-binding protein 2 (PCBP2) is essential for efficient translation of the viral mRNA. Here we report the NMR solution structures of two representative sequence variants of enteroviral loop B RNA. The two RNA variants differ at only one position (C vs U) within a six-nucleotide asymmetric internal loop sequence that is the binding site for the PCBP2 KH1 domain. Surprisingly, the two RNAs are drastically different in the overall shape and local dynamics of the bulge region. The RNA with the 5'-AUCCCU bulge sequence adopts an overall L shape. Its bulge nucleotides, especially the last four, are highly flexible and not very well defined by NMR. The RNA with the 5'-AUUCCU bulge sequence adopts an overall U shape, and its bulge sequence exhibits only limited flexibility. A detailed analysis of the two RNA structures and their dynamic properties, as well as available sequence data and known KH domain-RNA complex structures, not only provides insights into how loop B RNA might be recognized by the PCBP2 KH1 domain but also suggests a possible correlation between structural flexibility and pre-existing structural features for protein recognition.


==About this Structure==
==About this Structure==
1R7W is a [http://en.wikipedia.org/wiki/Protein_complex Protein complex] structure of sequences from [http://en.wikipedia.org/wiki/ ]. Full crystallographic information is available from [http://ispc.weizmann.ac.il/oca-bin/ocashort?id=1R7W OCA].  
1R7W is a [http://en.wikipedia.org/wiki/Protein_complex Protein complex] structure of sequences from [http://en.wikipedia.org/wiki/ ]. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=1R7W OCA].  


==Reference==
==Reference==
Line 13: Line 13:
[[Category: Protein complex]]
[[Category: Protein complex]]
[[Category: Du, Z.]]
[[Category: Du, Z.]]
[[Category: James, T.L.]]
[[Category: James, T L.]]
[[Category: Ulyanov, N.B.]]
[[Category: Ulyanov, N B.]]
[[Category: Yu, J.]]
[[Category: Yu, J.]]
[[Category: guga tetraloop]]
[[Category: guga tetraloop]]
Line 20: Line 20:
[[Category: stem-and-loop structure]]
[[Category: stem-and-loop structure]]


''Page seeded by [http://ispc.weizmann.ac.il/oca OCA ] on Sat Nov 24 22:18:56 2007''
''Page seeded by [http://oca.weizmann.ac.il/oca OCA ] on Thu Feb 21 14:48:01 2008''

Revision as of 12:48, 21 February 2008

File:1r7w.gif


1r7w

Drag the structure with the mouse to rotate

NMR STRUCTURE OF THE R(GGAGGACAUCCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUCCCU BULGE

Overview

The 5'-untranslated region of positive-strand RNA viruses harbors many cis-acting RNA structural elements that are important for various viral processes such as replication, translation, and packaging of new virions. Among these is loop B RNA of the stem-loop IV domain within the internal ribosomal entry site (IRES) of enteroviruses, including Poliovirus type 1 (PV1). Studies on PV1 have shown that specific recognition of loop B by the first KH (hnRNP K homology) domain of cellular poly(rC)-binding protein 2 (PCBP2) is essential for efficient translation of the viral mRNA. Here we report the NMR solution structures of two representative sequence variants of enteroviral loop B RNA. The two RNA variants differ at only one position (C vs U) within a six-nucleotide asymmetric internal loop sequence that is the binding site for the PCBP2 KH1 domain. Surprisingly, the two RNAs are drastically different in the overall shape and local dynamics of the bulge region. The RNA with the 5'-AUCCCU bulge sequence adopts an overall L shape. Its bulge nucleotides, especially the last four, are highly flexible and not very well defined by NMR. The RNA with the 5'-AUUCCU bulge sequence adopts an overall U shape, and its bulge sequence exhibits only limited flexibility. A detailed analysis of the two RNA structures and their dynamic properties, as well as available sequence data and known KH domain-RNA complex structures, not only provides insights into how loop B RNA might be recognized by the PCBP2 KH1 domain but also suggests a possible correlation between structural flexibility and pre-existing structural features for protein recognition.

About this Structure

1R7W is a Protein complex structure of sequences from [1]. Full crystallographic information is available from OCA.

Reference

NMR structures of loop B RNAs from the stem-loop IV domain of the enterovirus internal ribosome entry site: a single C to U substitution drastically changes the shape and flexibility of RNA., Du Z, Ulyanov NB, Yu J, Andino R, James TL, Biochemistry. 2004 May 18;43(19):5757-71. PMID:15134450

Page seeded by OCA on Thu Feb 21 14:48:01 2008

Proteopedia Page Contributors and Editors (what is this?)

OCA