3iv5: Difference between revisions
From Proteopedia
Jump to navigationJump to search
New page: '''Unreleased structure''' The entry 3iv5 is ON HOLD until sometime in the future Authors: Stella, Stefano, Cascio, Duilio, Johnson, Reid C. Description: Crystal structure of Fis bound... |
No edit summary |
||
| Line 1: | Line 1: | ||
'''Unreleased structure''' | '''Unreleased structure''' | ||
The entry 3iv5 is ON HOLD | The entry 3iv5 is ON HOLD | ||
Authors: Stella, | Authors: Stella, S., Cascio, D., Johnson, R.C. | ||
Description: Crystal structure of Fis bound to 27bp consensus sequence DNA F1(AAATTTGTTTGAATTTTGAGCAAATTT) | Description: Crystal structure of Fis bound to 27bp consensus sequence DNA F1(AAATTTGTTTGAATTTTGAGCAAATTT) | ||
''Page seeded by [http://oca.weizmann.ac.il/oca OCA ] on Wed Sep | ''Page seeded by [http://oca.weizmann.ac.il/oca OCA ] on Wed Sep 30 08:59:19 2009'' | ||
