User:Wayne Decatur/I-Ppo Morph Methods: Difference between revisions
From Proteopedia
Jump to navigationJump to search
mNo edit summary |
m added a new server for getting DNA moadel based on sequence alone |
||
| Line 1: | Line 1: | ||
Generated straight B-form DNA of homing site used in structure (TTGACTCTCTTAAGAGAGTCAA [extra 'A' at 3' end for getting two T's on both strands since you only enter text for one strand) using [http://hydra.icgeb.trieste.it/~kristian/dna/ Model It] (see [http://molvisindex.org molvisindex.org] under Molecules, Sources of PDB Files, under DNA Tools) as described in [[Lac repressor morph methods]]. Editing text of the pdb file, I deleted the 'A' at the three prime end of each strand to generate ends like in the 1a73 structure. | Generated straight B-form DNA of homing site used in structure (TTGACTCTCTTAAGAGAGTCAA [extra 'A' at 3' end for getting two T's on both strands since you only enter text for one strand) using [http://hydra.icgeb.trieste.it/~kristian/dna/ Model It] (see [http://molvisindex.org molvisindex.org] under Molecules, Sources of PDB Files, under DNA Tools) as described in [[Lac repressor morph methods]]. <nowiki>[</nowiki>UPDATE: The Model It server seems to no longer be accessible, but can use Custom Build on [http://haddock.chem.uu.nl/dna/dna.php the Utrecht Biomolecular Interaction web portal] to access | ||
[http://haddock.chem.uu.nl/services/3DDART/ the 3D-DART software web portal]; it was meant in part to help with making materials to be used in [http://www.nmr.chem.uu.nl/haddock/ the HADDOCK Docking server].<nowiki>]</nowiki> Editing text of the pdb file, I deleted the 'A' at the three prime end of each strand to generate ends like in the 1a73 structure. | |||
In order to use with straight B-form DNA (generated by Model IT), I needed to get unremediated pdb file for 1a73 or completely alter the order of the residue atoms and chain designations to match. I felt the unremediated file was the easiest route to go. | In order to use with straight B-form DNA (generated by Model IT), I needed to get unremediated pdb file for 1a73 or completely alter the order of the residue atoms and chain designations to match. I felt the unremediated file was the easiest route to go. | ||