4ihv: Difference between revisions
From Proteopedia
Jump to navigationJump to search
No edit summary |
No edit summary |
||
| Line 1: | Line 1: | ||
{{STRUCTURE_4ihv| PDB=4ihv | SCENE= }} | |||
===Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)=== | |||
==Function== | |||
[[http://www.uniprot.org/uniprot/C9QXL3_ECOD1 C9QXL3_ECOD1]] Activates ribosomal RNA transcription. Plays a direct role in upstream activation of rRNA promoters (By similarity).[HAMAP-Rule:MF_00166] | |||
==About this Structure== | |||
[[4ihv]] is a 4 chain structure with sequence from [http://en.wikipedia.org/wiki/Escherichia_coli_k-12 Escherichia coli k-12]. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=4IHV OCA]. | |||
[[Category: Escherichia coli k-12]] | |||
[[Category: Cascio, D.]] | |||
[[Category: Hancock, S P.]] | |||
[[Category: Johnson, R C.]] | |||
[[Category: Dna bending]] | |||
[[Category: Hth domain]] | |||
[[Category: Indirect recognition]] | |||
[[Category: Minor groove compression]] | |||
[[Category: Protein-dna complex]] | |||
[[Category: Transcription-dna complex]] | |||
Revision as of 07:52, 2 May 2013
Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)
Function
[C9QXL3_ECOD1] Activates ribosomal RNA transcription. Plays a direct role in upstream activation of rRNA promoters (By similarity).[HAMAP-Rule:MF_00166]
About this Structure
4ihv is a 4 chain structure with sequence from Escherichia coli k-12. Full crystallographic information is available from OCA.