2m90: Difference between revisions
From Proteopedia
Jump to navigationJump to search
No edit summary |
No edit summary |
||
| Line 1: | Line 1: | ||
{{STRUCTURE_2m90| PDB=2m90 | SCENE= }} | |||
===Structure of d[GCGCGAAGCATTCGCGGGGAGGTGGGGAAGGG] quadruplex-duplex hybrid=== | |||
{{ABSTRACT_PUBMED_23794476}} | |||
==About this Structure== | |||
[[2m90]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=2M90 OCA]. | |||
==Reference== | |||
<ref group="xtra">PMID:023794476</ref><references group="xtra"/><references/> | |||
[[Category: Lim, K W.]] | |||
[[Category: Phan, A T.]] | |||
[[Category: Dna]] | |||
[[Category: Duplex]] | |||
[[Category: Quadruplex]] | |||
[[Category: Quadruplex-duplex hybrid]] | |||