2m6w: Difference between revisions
From Proteopedia
Jump to navigationJump to search
No edit summary |
No edit summary |
||
| Line 3: | Line 3: | ||
== Structural highlights == | == Structural highlights == | ||
<table><tr><td colspan='2'>[[2m6w]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=2M6W OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=2M6W FirstGlance]. <br> | <table><tr><td colspan='2'>[[2m6w]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=2M6W OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=2M6W FirstGlance]. <br> | ||
</td></tr><tr><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=2m6w FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=2m6w OCA], [http://www.rcsb.org/pdb/explore.do?structureId=2m6w RCSB], [http://www.ebi.ac.uk/pdbsum/2m6w PDBsum]</span></td></tr> | </td></tr><tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=2m6w FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=2m6w OCA], [http://www.rcsb.org/pdb/explore.do?structureId=2m6w RCSB], [http://www.ebi.ac.uk/pdbsum/2m6w PDBsum]</span></td></tr> | ||
<table> | </table> | ||
__TOC__ | __TOC__ | ||
</StructureSection> | </StructureSection> | ||
[[Category: Karsisiotis, A.]] | [[Category: Karsisiotis, A I.]] | ||
[[Category: Silva, M Webba da.]] | [[Category: Silva, M Webba da.]] | ||
[[Category: Dna]] | [[Category: Dna]] | ||
[[Category: Folding topology]] | [[Category: Folding topology]] | ||
[[Category: G-quadruplex]] | [[Category: G-quadruplex]] | ||
Revision as of 08:25, 22 October 2014
Solution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex in sodium conditions
| ||||||||||||