2m6w: Difference between revisions
From Proteopedia
Jump to navigationJump to search
No edit summary |
No edit summary |
||
| Line 7: | Line 7: | ||
__TOC__ | __TOC__ | ||
</StructureSection> | </StructureSection> | ||
[[Category: Karsisiotis, A I | [[Category: Karsisiotis, A I]] | ||
[[Category: Silva, M Webba da | [[Category: Silva, M Webba da]] | ||
[[Category: Dna]] | [[Category: Dna]] | ||
[[Category: Folding topology]] | [[Category: Folding topology]] | ||
[[Category: G-quadruplex]] | [[Category: G-quadruplex]] | ||
Revision as of 08:14, 25 January 2015
Solution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex in sodium conditions
| ||||||||||||