5ds9: Difference between revisions

From Proteopedia
Jump to navigationJump to search
OCA (talk | contribs)
New page: '''Unreleased structure''' The entry 5ds9 is ON HOLD until Paper Publication Authors: Hancock, S.P., Cascio, D., Johnson, R.C. Description: Crystal structure of Fis bound to 27bp DNA F...
 
OCA (talk | contribs)
m Protected "5ds9" [edit=sysop:move=sysop]
(No difference)

Revision as of 13:27, 30 September 2015

Unreleased structure

The entry 5ds9 is ON HOLD until Paper Publication

Authors: Hancock, S.P., Cascio, D., Johnson, R.C.

Description: Crystal structure of Fis bound to 27bp DNA F1-8A (AAATTAGTTTGAATTTTGAGCTAATTT)

Proteopedia Page Contributors and Editors (what is this?)

OCA