Sandbox Reserved 1120: Difference between revisions
From Proteopedia
Jump to navigationJump to search
Fantin Mesny (talk | contribs) No edit summary |
Fantin Mesny (talk | contribs) No edit summary |
||
| Line 36: | Line 36: | ||
===Sequence of the SRY gene=== | ===Sequence of the SRY gene=== | ||
<center><div style="width:90%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: # | <center><div style="width:90%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;"><small> | ||
>gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly <ref>[http://www.ncbi.nlm.nih.gov/nuccore]</ref> | >gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly <ref>[http://www.ncbi.nlm.nih.gov/nuccore]</ref> | ||
TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT | TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT | ||
| Line 54: | Line 54: | ||
'''legend of bold ''' | '''legend of bold ''' | ||
<FONT color=" | <FONT color="green"><b>Initiation codon</b></FONT> | ||
<b>HMG sequence</b> | |||
<FONT color="red"><b>Stop codon</b></FONT> | |||
===Regulation of the expression of the SRY gene=== | ===Regulation of the expression of the SRY gene=== | ||
