Sandbox Reserved 1120: Difference between revisions
No edit summary |
No edit summary |
||
| Line 16: | Line 16: | ||
<tr id='Molecular weight'><td class="sblockLbl"><b>Molecular weight</b></td><td class="sblockDat">XXXX kDa</td></tr> | <tr id='Molecular weight'><td class="sblockLbl"><b>Molecular weight</b></td><td class="sblockDat">XXXX kDa</td></tr> | ||
<tr id='Gene'><td class="sblockLbl"><b>Molecular weight</b></td><td class="sblockDat">XXXX kDa</td></tr> | |||
<tr id='Length'><td class="sblockLbl"><b>Molecular weight</b></td><td class="sblockDat">XXXX kDa</td></tr> | |||
<tr id='DNA target sequence'><td class="sblockLbl"><b>Molecular weight</b></td><td class="sblockDat">XXXX kDa</td></tr> | |||
<tr id='Genes targeted'><td class="sblockLbl"><b>Molecular weight</b></td><td class="sblockDat">XXXX kDa</td></tr> | |||
<tr id='Inhibitors'><td class="sblockLbl"><b>Molecular weight</b></td><td class="sblockDat">XXXX kDa</td></tr> | |||
</span> | </span> | ||
</td></tr> | </td></tr> | ||
Revision as of 16:32, 28 January 2016
| This Sandbox is Reserved from 15/12/2015, through 15/06/2016 for use in the course "Structural Biology" taught by Bruno Kieffer at the University of Strasbourg, ESBS. This reservation includes Sandbox Reserved 1120 through Sandbox Reserved 1159. |
To get started:
More help: Help:Editing |
SRY protein (AKA TDF protein)
ContentsProperties
HistoryAfter centuries of unfounded theories mainly based on environmental factors, the first molecular theory concerning the sex determination appeared in 1891. At this time, the german biologist Hermann Henking was studying sperm formation in wasps. As a chromosome which was not present in all the wasps looked different from the others, he suspected it to play a role in sex determination and called it the "X chromosome". Ten years later, Clarence Erwin McClung saw that this chromosome behaved differently during the meiosis and was only present in half the sperm cells of grasshoppers. As the main characteristic that varies in 50/50 proportions among zygotes is the sex, McClung suspected the X chromosome to be implicated in sexual development. In 1905, Nettie Stevens discovered the "Y chromosome" (and the female XX and male XY patterns) while she was counting the chromosomes of beetles under the microscope[2]. During the next decades, a few theories were in competition. In 1921, Calvin Bridges's works on Drosophila melanogaster seemed to reveal that male characters acquisition is due to a genic balance between the genes contained in the X chromosome and those contained in the autosomes[3]. In 1930, Ronald Fisher introduced the first Y-based control of sex theory by proposing two different models : either all the genes responsible for the male characters are located on the Y chromosome or there is a Y-located gene which regulates the expression of genes elsewhere in the genome[4]. As Alfred Jost had shown the testosterone produced by the testis is responsible for the entire male phenotype acquisition[5], in 1988, Peter Neville Goodfellow proposed that there is a gene (TDF in human, Tdy in mice) on the Y chromosome which drives the development of the testis.[6] In 1990, Goodfellow's hypothesis was validated with the discovery of Tdy's localisation. This gene's product (expressed during the male gonadal development) owns an amino-acid motif showing homology to other known or putative DNA-binding domains. Tdy is therefore a transcriptional factor[7]. The same year, the human SRY gene (accepted later as the TDF) was discovered[8]. Three dimensional structure of the SRY protein was determined in 1995 using NMR spectroscopy[9] SRY geneGeneralityThe SRY gene encodes the SRY protein. The SRY protein is a transcriptional factor inducing the male phenotype in embryo. The SRY gene is located on the Y chromosom in the short arm (p) 11.3 [10]. This gene has only one exon containing the HMG domain (DNA-binding high-mobility group box domain). That's means that SRY mRNA does not have a alternative splicing, so there is one isoform of SRY protein.[11]. Moreover,the human genome contains one copy of the SRY gene, whereas the mouse genome contains 6 copy of this gene. [12] Sequence of the SRY gene>gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly [13] TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT TTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACA ATGCAATCATATGCTTCTGCTATGTTAAGCGTATTCAACAGCGATGATTACAGTCCAGCTGTGCAAGAGAAT ATTCCCGCTCTCCGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTAAGTATCAGTGTGAAA CGGGAGAAAACAGTAAAGGCAACGTCCAGGATAGAGTGAAGCGACCCATGAACGCATTCATCGTGTGGTC TCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCAGAGATCAGCAAGCAGCTG GGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCATTCTTCCAGGAGGCACAGAAATTACAGG CCATGCACAGAGAGAAATACCCGAATTATAAGTATCGACCTCGTCGGAAGGCGAAGATGCTGCCGAAGAA TTGCAGTTTGCTTCCCGCAGATCCCGCTTCGGTACTCTGCAGCGAAGTGCAACTGGACAACAGGTTGTAC AGGGATGACTGTACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAACG CAGCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTGTAGGACAATCGGGTAACATT GGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCACTTTCTTATGTTTAGTTT CAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCATTTCA (Legend : Initiation codon ; HMG sequence ; Stop codon) Regulation of the expression of the SRY geneIn humans, the SRY promoter is found at −408 bp to −95 bp upstream of the ATG initiation codon. Moreover, the SRY gene has enhancers at -727 pb upstream of the ATG initiation codon. The linkage between regulatory proteins and this enhancers have the property to increase the production of SRY protein. These regulatory proteins could be: SF1 (steroidogenic factor 1), SP1 and WT 1 (Wilms tumor). [14]
StructureThe SRY-HMG domain (HMG-Box)SRY-HMG stands for Sex determining Region Y - High Mobility Group domain. It is approximately 80 residues long. It mediates the binding of the protein to the minor groove of DNA. It is the most important part of the SRY protein. Not only because it enable the protein to bind the DNA but because even a little mutation can cause an inactivation of the protein. It has a Twisted L shape meaning that it has a long (28Å) and a short (22Å) arm. The HMG Box is made of 3 helices, its N-term and C-term are irregular. The overall structure is stabilized by a hydrophobic core especially at the intersection of the 3 helices where 3 aromatics cycles meet, surrounnded by aliphatic aminoacids. The interaction between the HMG-Box and DNA is specific and stable. It permits the bend of DNA (?75°). It is mostly hydrophobic interaction. Only one molecule of water interface the Box and the DNA. the complex is stabilized by salt bridges between positive charged residues of the HMG domain and negative charged phosphates.[16] The binding of SRY to DNA is specific. The DNA target site is a DNA octamer :
This sequenece is found in the promoters of genes expressed during the testicular development The bend of DNA permits the recruitment of different proteins and the build of massives proteins-DNA complexes that could change the expression of different genes. It is the role of a transcription factor.[17] Even if the most important function of the HMG box is its capacity of binding and bending DNA, it is also involved in DNA condensation, recombination and DNA repair. There are 2 kinds of protein that contain a HMG box
General structure of SRYThe overall structure of SRY is organized aroud the HMG-box. 3 domains:
FunctionSex determining
The SRY protein is a transcription factor, which contains nuclear localization domains in N terminal and C terminal. An acetylation on these domains allows to export the protein SRY in the nucleus. [18] The SRY protein activates the SOX9 (SRY-box9) gene [19]., this gene is found in the 17 chromosom in the long arm 24.3 [20] and is implicated in the stimulation of the differentiation of sertori cells. The activation of sox 9 are done with protein SRY and another transcriptional factor: SF1 (steroidogenic factor 1). These transcriptional factors are bind in an enhancers called: TESCO (testis-specific enhancer of Sox9 core element). The fixation of transcriptional factor in enhancer provokes a curvature of DNA (90°C) allowing a stabilisation of the elongation complex on the SOX9 promoter. The SOX 9 protein activates the gene AMH (anti-mullerian hormone)[21] allows the reduction of the channels of Müller in male. [22]
Because the human's SRY organisation is very closed to he mouse's, it has been proposed that SRY would have the same function in human but it has not been studied directly.[23] DiseaseSwyer syndrome (AKA XY gonadal dysgenis) :If the TDF protein is not able to bind its targeted DNA sequences, the genes responsible for the testis development are not expressed. The patient owning this defective protein will then develop female characters, even though he has a XY karyotype. This phenomenon is known as the « Swyer Syndrome ». Different causes can explain this « XY gonadal dysgenis », as it is also called. About thirty mutations (named "SRXY1") in the SRY gene have been shown to drive this phenotype development. It can also be due to crossovers during a meiosis. If a Y chromosome portion carrying the SRY gene is recombined into a X chromosome, a sperm cell will get this abnormal Y chromosome. If it then fecundates, a XY karyotype without any SRY gene will be formed. De La Chapelle syndrome (AKA XX male syndrome) :From the meiosis just described would also result an abnormal X chromosome, carrying the SRY gene. If the sperm cell owning this chromosome fecundates an ovule, the resulting newborn will have a XX karyotype but a male phenotype. This is called the « De La Chapelle syndrome ». In this case, the patient can either develop testis or both testis and ovarian tissues. As some epigenetic mechanisms can inactivate the X chromosome carrying SRY, this syndrome keeps most of the patients sterile.[24]
RelevanceStructural highlightsThis is a sample scene created with SAT to color by Group, and another to make a transparent representation of the protein. You can make your own scenes on SAT starting from scratch or loading and editing one of these sample scenes.
| ||||||||||||||||||||||||||||||||||||||||||
