The SRY protein is a transcription factor, which contains nuclear localization domains in N terminal and C terminal. An acetylation on these domains allows to export the protein SRY in the nucleus. <ref>Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&rfr_id=ori%3Arid%3Acrossref.org&rfr_dat=cr_pub%3Dpubmed&]</ref>
The SRY protein is a transcription factor, which contains nuclear localization domains in N terminal and C terminal. An acetylation on these domains allows to export the protein SRY in the nucleus. <ref>Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&rfr_id=ori%3Arid%3Acrossref.org&rfr_dat=cr_pub%3Dpubmed&]</ref>
The SRY protein activates the SOX9 (SRY-box9) gene <ref> McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]</ref>., this gene is found in the 17 chromosom in the long arm 24.3 <ref> NCBI [http://www.ncbi.nlm.nih.gov/gene/6662] </ref> and is implicated in the stimulation of the differentiation of sertori cells. The activation of sox 9 are done with protein SRY and another transcriptional factor: SF1 (steroidogenic factor 1). These transcriptional factors are bind in an enhancers called: TESCO (testis-specific enhancer of Sox9 core element). The fixation of transcriptional factor in enhancer provokes a curvature of DNA (90°C) allowing a stabilisation of the elongation complex on the SOX9 promoter. The SOX 9 protein activates the gene AMH (anti-mullerian hormone)<ref>[http://www.ebi.ac.uk/interpro/entry/IPR006799?q=AMH] </ref> allows the reduction of the channels of Müller in male. <ref>Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&rfr_id=ori%3Arid%3Acrossref.org&rfr_dat=cr_pub%3Dpubmed&]</ref>
The SRY protein activates the SOX9 (SRY-box9) gene <ref> McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]</ref>., this gene is found in the 17 chromosom in the long arm 24.3 <ref> NCBI [http://www.ncbi.nlm.nih.gov/gene/6662] </ref> and is implicated in the stimulation of the differentiation of pre-Sertori cells as Sertoli cells rather than granulosa cells.
The activation of sox 9 are done with protein SRY and another transcriptional factor: SF1 (steroidogenic factor 1). These transcriptional factors are bind in an enhancers called: TESCO (testis-specific enhancer of Sox9 core element). The fixation of transcriptional factor in enhancer provokes a curvature of DNA (90°C) allowing a stabilisation of the elongation complex on the SOX9 promoter. The SOX 9 protein activates the gene AMH (anti-mullerian hormone)<ref>[http://www.ebi.ac.uk/interpro/entry/IPR006799?q=AMH] </ref> allows the reduction of the channels of Müller in male. <ref>Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&rfr_id=ori%3Arid%3Acrossref.org&rfr_dat=cr_pub%3Dpubmed&]</ref>
:It has been shown that SRY would be involved in the regulation of the renin-angiotensin system in mice. Indeed, sequence mutations of the protein lead to hypertension.
:It has been shown that SRY would be involved in the regulation of the renin-angiotensin system in mice. Indeed, sequence mutations of the protein lead to hypertension.
Revision as of 18:36, 29 January 2016
This Sandbox is Reserved from 15/12/2015, through 15/06/2016 for use in the course "Structural Biology" taught by Bruno Kieffer at the University of Strasbourg, ESBS. This reservation includes Sandbox Reserved 1120 through Sandbox Reserved 1159.
To get started:
Click the edit this page tab at the top. Save the page after each step, then edit it again.
Click the 3D button (when editing, above the wikitext box) to insert Jmol.
show the Scene authoring tools, create a molecular scene, and save it. Copy the green link into the page.
Add a description of your scene. Use the buttons above the wikitext box for bold, italics, links, headlines, etc.
The SRY protein is a 204 residues long monomeric polypeptide. It is encoded by the testis-determining sex gene and is involved in the sex determination in mammels by being responsible for the gonadogenesis thus the male sexual developement. It is the HMG-box that gives to the protein its ability to bind DNA by its minor groove. [1]
After centuries of unfounded theories mainly based on environmental factors, the first molecular theory concerning the sex determination appeared in 1891. At this time, the german biologist Hermann Henking was studying sperm formation in wasps. As a chromosome which was not present in all the wasps looked different from the others, he suspected it to play a role in sex determination and called it the "X chromosome".
Ten years later, Clarence Erwin McClung saw that this chromosome behaved differently during the meiosis and was only present in half the sperm cells of grasshoppers. As the main characteristic that varies in 50/50 proportions among zygotes is the sex, McClung suspected the X chromosome to be implicated in sexual development.
In 1905, Nettie Stevens discovered the "Y chromosome" (and the female XX and male XY patterns) while she was counting the chromosomes of beetles under the microscope[2].
During the next decades, a few theories were in competition. In 1921, Calvin Bridges's works on Drosophila melanogaster seemed to reveal that male characters acquisition is due to a genic balance between the genes contained in the X chromosome and those contained in the autosomes[3].
In 1930, Ronald Fisher introduced the first Y-based control of sex theory by proposing two different models : either all the genes responsible for the male characters are located on the Y chromosome or there is a Y-located gene which regulates the expression of genes elsewhere in the genome[4].
As Alfred Jost had shown the testosterone produced by the testis is responsible for the entire male phenotype acquisition[5], in 1988, Peter Neville Goodfellow proposed that there is a gene (TDF in human, Tdy in mice) on the Y chromosome which drives the development of the testis.[6] In 1990, Goodfellow's hypothesis was validated with the discovery of Tdy's localisation. This gene's product (expressed during the male gonadal development) owns an amino-acid motif showing homology to other known or putative DNA-binding domains. Tdy is therefore a transcriptional factor[7]. The same year, the human SRY gene (accepted later as the TDF) was discovered[8].
Three dimensional structure of the SRY protein was determined in 1995 using NMR spectroscopy[9]
SRY gene
Generality
The SRY gene encodes the SRY protein. The SRY protein is a transcriptional factor inducing the male phenotype in embryo. The SRY gene is located on the Y chromosom in the short arm (p) 11.3 [10]. This gene has only one exon containing the HMG domain (DNA-binding high-mobility group box domain). That's means that SRY mRNA does not have a alternative splicing, so there is one isoform of SRY protein.[11]. Moreover,the human genome contains one copy of the SRY gene, whereas the mouse genome contains 6 copy of this gene. [12]
Sequence of the SRY gene
>gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly [13]
TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT
TTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACA
ATGCAATCATATGCTTCTGCTATGTTAAGCGTATTCAACAGCGATGATTACAGTCCAGCTGTGCAAGAGAAT
ATTCCCGCTCTCCGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTAAGTATCAGTGTGAAA
CGGGAGAAAACAGTAAAGGCAACGTCCAGGATAGAGTGAAGCGACCCATGAACGCATTCATCGTGTGGTC
TCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCAGAGATCAGCAAGCAGCTGGGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCATTCTTCCAGGAGGCACAGAAATTACAGGCCATGCACAGAGAGAAATACCCGAATTATAAGTATCGACCTCGTCGGAAGGCGAAGATGCTGCCGAAGAA
TTGCAGTTTGCTTCCCGCAGATCCCGCTTCGGTACTCTGCAGCGAAGTGCAACTGGACAACAGGTTGTAC
AGGGATGACTGTACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAACG
CAGCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTGTAGGACAATCGGGTAACATT
GGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCACTTTCTTATGTTTAGTTT
CAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCATTTCA
In humans, the SRY promoter is found at −408 bp to −95 bp upstream of the ATG initiation codon. Moreover, the SRY gene has enhancers at -727 pb upstream of the ATG initiation codon. The linkage between regulatory proteins and this enhancers have the property to increase the production of SRY protein. These regulatory proteins could be: SF1 (steroidogenic factor 1), SP1 and WT 1 (Wilms tumor). [14]
SF1: this transcriptional factor belong to the family of nuclear hormone receptor and contains a zinc finger. The activation of this protein requires a ligand (hormone).
SP1: this transciprional factor is a ubiquitous protein binding in site containing rich-GC sequences and implicated in the transcription of many genes. Moreover, this protein contains a zinc finger.
WT1:this transcriptional factor transactives SRY gene, it contains a zinc finger. [15]
Structure
The SRY-HMG domain (HMG-Box)
SRY-HMG stands for Sex determining Region Y - High Mobility Group domain.
It is approximately 80 residues long. It mediates the binding of the protein to the minor groove of DNA. It is the most important part of the SRY protein. Not only because it enable the protein to bind the DNA but because even a little mutation can cause an inactivation of the protein.
It has a Twisted L shape meaning that it has a long (28Å) and a short (22Å) arm. The HMG Box is made of 3 helices, its N-term and C-term are irregular. The overall structure is stabilized by a hydrophobic core especially at the intersection of the 3 helices where 3 aromatics cycles meet, surrounnded by aliphatic aminoacids.
The interaction between the HMG-Box and DNA is specific and stable. It permits the bend of DNA (?75°). It is mostly hydrophobic interaction. Only one molecule of water interface the Box and the DNA. the complex is stabilized by salt bridges between positive charged residues of the HMG domain and negative charged phosphates.[16]
Linear structure of hHMG domain
The binding of SRY to DNA is specific. The DNA target site is a DNA octamer :
(5'-dGCACAAAC)
(5'-dGTTTGTGC)
This sequenece is found in the promoters of genes expressed during the testicular development
The bend of DNA permits the recruitment of different proteins and the build of massives proteins-DNA complexes that could change the expression of different genes. It is the role of a transcription factor.[17]
Even if the most important function of the HMG box is its capacity of binding and bending DNA, it is also involved in DNA condensation, recombination and DNA repair.
There are 2 kinds of protein that contain a HMG box
HMG1 : It is expressed in few cell types. It is found in transcription factors that contain a single HMG box. The bind to a DNA sequence is specific.
HMG2 : Are found in all cell types and are abundant in chromatin. This proteins can contain two or more HMG boxes that can nonspecifically bind DNA.
General structure of SRY
The overall structure of SRY is organized aroud the HMG-box.
3 domains:
N-term domain
Central domain : DNA binding (HMG box)
C-term domain
Function
Sex determining
It acts like a sex determinator thanks to it transcriptionnal activity. It inhibits the developpement of female sex structure in th embryonnic individual.
The SRY protein is a transcription factor, which contains nuclear localization domains in N terminal and C terminal. An acetylation on these domains allows to export the protein SRY in the nucleus. [18]
The SRY protein activates the SOX9 (SRY-box9) gene [19]., this gene is found in the 17 chromosom in the long arm 24.3 [20] and is implicated in the stimulation of the differentiation of pre-Sertori cells as Sertoli cells rather than granulosa cells.
The activation of sox 9 are done with protein SRY and another transcriptional factor: SF1 (steroidogenic factor 1). These transcriptional factors are bind in an enhancers called: TESCO (testis-specific enhancer of Sox9 core element). The fixation of transcriptional factor in enhancer provokes a curvature of DNA (90°C) allowing a stabilisation of the elongation complex on the SOX9 promoter. The SOX 9 protein activates the gene AMH (anti-mullerian hormone)[21] allows the reduction of the channels of Müller in male. [22]
It has been shown that SRY would be involved in the regulation of the renin-angiotensin system in mice. Indeed, sequence mutations of the protein lead to hypertension.
Because the human's SRY organisation is very closed to he mouse's, it has been proposed that SRY would have the same function in human but it has not been studied directly.[23]
Cathecolamines regulation
It has been shown SRY is present in brain regions and activate the Tyrosine-3-Hydroxylase expression. This enzyme catalyses the rate-limiting step of catecholamine synthesis (L-Tyrosine to L-DOPA). Furthermore, SRY also activate the expression of Monoamine Oxidase A which is responsible for the inactivation of catecholamines. Therefore, it regulates both positively and negatively the catecholamines concentration. [24]
Other extra-testicular effects
Some knock-down experiments have shown that SRY may also be a major actor in the dopamine pathway. On the peripheral side, it even regulates noradrenaline levels and blood pressure.[25] A researcher who contributed to discovering this effects says it might explain why "the aggressive fight-or-flight reaction is more dominant in men, while women predominantly adopt a less aggressive tend-and-befriend response".[26]
Diseases
Swyer syndrome (AKA XY gonadal dysgenis) :
If the TDF protein is not able to bind its targeted DNA sequences, the genes responsible for the testis development are not expressed. The patient owning this defective protein will then develop female characters, even though he has a XY karyotype. This phenomenon is known as the « Swyer Syndrome ».
Different causes can explain this « XY gonadal dysgenis », as it is also called. About thirty mutations (named "SRXY1") in the SRY gene have been shown to drive this phenotype development. It can also be due to crossovers during a meiosis. If a Y chromosome portion carrying the SRY gene is recombined into a X chromosome, a sperm cell will get this abnormal Y chromosome. If it then fecundates, a XY karyotype without any SRY gene will be formed.
De La Chapelle syndrome (AKA XX male syndrome) :
From the meiosis just described would also result an abnormal X chromosome, carrying the SRY gene. If the sperm cell owning this chromosome fecundates an ovule, the resulting newborn will have a XX karyotype but a male phenotype. This is called the « De La Chapelle syndrome ». In this case, the patient can either develop testis or both testis and ovarian tissues. As some epigenetic mechanisms can inactivate the X chromosome carrying SRY, this syndrome keeps most of the patients sterile.[27]
Hepatocellular carcinoma
In the case on a hepatocellular carcinoma, it has been proven high expression levels of SRY helps cancer progression and poor patient survival. However, it still seems hepatocellular carcinoma is not most likely to develop in men.[28]
Relevance
Structural highlights
This is a sample scene created with SAT to color by Group, and another to make a transparent representation of the protein. You can make your own scenes on SAT starting from scratch or loading and editing one of these sample scenes.
↑Tang Y, Nilsson L. Interaction of human SRY protein with DNA: a molecular dynamics study. Proteins. 1998 Jun 1;31(4):417-33. PMID:9626701
↑Sumner, A. T. Sex Chromosomes and Sex Determination. Chromosomes: Organization and Function, 97-108. [1]
↑Goodfellow PN, Darling SM. Genetics of sex determination in man and mouse. Development. 1988 Feb;102(2):251-8. PMID:3046910
↑Jost A. Becoming a male. Adv Biosci. 1973;10:3-13. PMID:4805859
↑Goodfellow PN, Darling SM. Genetics of sex determination in man and mouse. Development. 1988 Feb;102(2):251-8. PMID:3046910
↑Gubbay J, Collignon J, Koopman P, Capel B, Economou A, Munsterberg A, Vivian N, Goodfellow P, Lovell-Badge R. A gene mapping to the sex-determining region of the mouse Y chromosome is a member of a novel family of embryonically expressed genes. Nature. 1990 Jul 19;346(6281):245-50. PMID:2374589 doi:https://dx.doi.org/10.1038/346245a0
↑Sinclair AH, Berta P, Palmer MS, Hawkins JR, Griffiths BL, Smith MJ, Foster JW, Frischauf AM, Lovell-Badge R, Goodfellow PN. A gene from the human sex-determining region encodes a protein with homology to a conserved DNA-binding motif. Nature. 1990 Jul 19;346(6281):240-4. PMID:1695712 doi:https://dx.doi.org/10.1038/346240a0
↑Werner MH, Huth JR, Gronenborn AM, Clore GM. Molecular basis of human 46X,Y sex reversal revealed from the three-dimensional solution structure of the human SRY-DNA complex. Cell. 1995 Jun 2;81(5):705-14. PMID:7774012
↑McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [3]
↑Sekido R, Lovell-Badge R. Genetic control of testis development. Sex Dev Genet Mol Biol Evol Endocrinol Embryol Pathol Sex Determ Differ. 2013;7(1-3):21–32
↑Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [5]
↑Larney C, Bailey TL, Koopman P. Switching on sex: transcriptional regulation of the testis-determining gene Sry. Dev Camb Engl. 2014 Jun;141(11):2195–205.
↑Tang Y, Nilsson L. Interaction of human SRY protein with DNA: a molecular dynamics study. Proteins. 1998 Jun 1;31(4):417-33. PMID:9626701
↑Murphy EC, Zhurkin VB, Louis JM, Cornilescu G, Clore GM. Structural basis for SRY-dependent 46-X,Y sex reversal: modulation of DNA bending by a naturally occurring point mutation. J Mol Biol. 2001 Sep 21;312(3):481-99. PMID:11563911 doi:https://dx.doi.org/10.1006/jmbi.2001.4977
↑Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [6]
↑McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [7]
↑Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [10]
↑Prokop JW, Watanabe IK, Turner ME, Underwood AC, Martins AS, Milsted A. From rat to human: regulation of Renin-Angiotensin system genes by sry. Int J Hypertens. 2012;2012:724240. doi: 10.1155/2012/724240. Epub 2012 Jan 22. PMID:22315667 doi:https://dx.doi.org/10.1155/2012/724240
↑Veitia RA. Of adrenaline and SRY in males (comment on DOI 10.1002/bies.201100159). Bioessays. 2014 May;36(5):438. doi: 10.1002/bies.201400026. Epub 2014 Mar 7. PMID:24604382 doi:https://dx.doi.org/10.1002/bies.201400026
↑Veitia RA. Of adrenaline and SRY in males (comment on DOI 10.1002/bies.201100159). Bioessays. 2014 May;36(5):438. doi: 10.1002/bies.201400026. Epub 2014 Mar 7. PMID:24604382 doi:https://dx.doi.org/10.1002/bies.201400026
↑Cohen, Tamara. The 'macho' gene that makes men behave aggressively has been found. The Daily Mail (2012). [11]
↑de la Chapelle A. Analytic review: nature and origin of males with XX sex chromosomes. Am J Hum Genet. 1972 Jan;24(1):71-105. PMID:4622299
↑Xue TC, Zhang L, Ren ZG, Chen RX, Cui JF, Ge NL, Ye SL. Sex-determination gene SRY potentially associates with poor prognosis but not sex bias in hepatocellular carcinoma. Dig Dis Sci. 2015 Feb;60(2):427-35. doi: 10.1007/s10620-014-3377-y. Epub 2014 Oct, 2. PMID:25274159 doi:https://dx.doi.org/10.1007/s10620-014-3377-y