5dtd: Difference between revisions

Line 1:

~~'''Unreleased structure'''~~

~~The entry 5dtd is ON HOLD until Paper Publication~~

==Crystal structure of Fis bound to 27bp DNA F1-8C (AAATTCGTTTGAATTTTGAGCGAATTT)==

~~Authors: Hancock, S.P., Cascio, D., Johnson, R.C.~~

== Structural highlights ==

<table><tr><td colspan='2'>[[5dtd]] is a 4 chain structure. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=5DTD OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=5DTD FirstGlance]. <br>

~~Description:~~ Crystal structure of Fis bound to 27bp DNA F1-8C (AAATTCGTTTGAATTTTGAGCGAATTT)

</td></tr><tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=5dtd FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=5dtd OCA], [http://pdbe.org/5dtd PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=5dtd RCSB], [http://www.ebi.ac.uk/pdbsum/5dtd PDBsum]</span></td></tr>

[[~~Category~~: ~~Unreleased Structures~~]]

</table>

[[~~Category~~: ~~Hancock~~, S.P]]

== Function ==

[[~~Category~~: ~~Johnson, R~~.C]]

[[http://www.uniprot.org/uniprot/FIS_ECOLI FIS_ECOLI]] Activates ribosomal RNA transcription, as well other genes. Plays a direct role in upstream activation of rRNA promoters. Binds to a recombinational enhancer sequence that is required to stimulate hin-mediated DNA inversion. Prevents initiation of DNA replication from oriC.<ref>PMID:2209559</ref> <ref>PMID:8836178</ref>

== References ==

__TOC__

</StructureSection>

[[Category: Cascio, D]]

[[Category: Hancock, S P]]

[[Category: Johnson, R C]]

[[Category: Dna bending]]

[[Category: Dna binding protein-dna complex]]

[[Category: Hth domain]]

[[Category: Indirect recognition]]

[[Category: Protein-dna complex]]

Navigation menu

Page actions

Page actions

Personal tools

Navigation

Search

Tools

@@ Line 1: / Line 1: @@
-'''Unreleased structure'''
-The entry 5dtd is ON HOLD  until Paper Publication
+==Crystal structure of Fis bound to 27bp DNA F1-8C (AAATTCGTTTGAATTTTGAGCGAATTT)==
+<StructureSection load='5dtd' size='340' side='right' caption='[[5dtd]], [[Resolution|resolution]] 2.64&Aring;' scene=''>
-Authors: Hancock, S.P., Cascio, D., Johnson, R.C.
+== Structural highlights ==
+<table><tr><td colspan='2'>[[5dtd]] is a 4 chain structure. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=5DTD OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=5DTD FirstGlance]. <br>
-Description: Crystal structure of Fis bound to 27bp DNA F1-8C (AAATTCGTTTGAATTTTGAGCGAATTT)
+</td></tr><tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=5dtd FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=5dtd OCA], [http://pdbe.org/5dtd PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=5dtd RCSB], [http://www.ebi.ac.uk/pdbsum/5dtd PDBsum]</span></td></tr>
-[[Category: Unreleased Structures]]
+</table>
-[[Category: Hancock, S.P]]
+== Function ==
-[[Category: Johnson, R.C]]
+[[http://www.uniprot.org/uniprot/FIS_ECOLI FIS_ECOLI]] Activates ribosomal RNA transcription, as well other genes. Plays a direct role in upstream activation of rRNA promoters. Binds to a recombinational enhancer sequence that is required to stimulate hin-mediated DNA inversion. Prevents initiation of DNA replication from oriC.<ref>PMID:2209559</ref> <ref>PMID:8836178</ref>
+== References ==
+<references/>
+__TOC__
+</StructureSection>
 [[Category: Cascio, D]]
+[[Category: Hancock, S P]]
+[[Category: Johnson, R C]]
+[[Category: Dna bending]]
+[[Category: Dna binding protein-dna complex]]
+[[Category: Hth domain]]
+[[Category: Indirect recognition]]
+[[Category: Protein-dna complex]]