2m91: Difference between revisions
From Proteopedia
Jump to navigationJump to search
No edit summary |
No edit summary |
||
| Line 3: | Line 3: | ||
<StructureSection load='2m91' size='340' side='right'caption='[[2m91]]' scene=''> | <StructureSection load='2m91' size='340' side='right'caption='[[2m91]]' scene=''> | ||
== Structural highlights == | == Structural highlights == | ||
<table><tr><td colspan='2'>Full | <table><tr><td colspan='2'>[[2m91]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=2M91 OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=2M91 FirstGlance]. <br> | ||
</td></tr><tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=2m91 FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=2m91 OCA], [https://pdbe.org/2m91 PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=2m91 RCSB], [https://www.ebi.ac.uk/pdbsum/2m91 PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=2m91 ProSAT]</span></td></tr> | </td></tr><tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=2m91 FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=2m91 OCA], [https://pdbe.org/2m91 PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=2m91 RCSB], [https://www.ebi.ac.uk/pdbsum/2m91 PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=2m91 ProSAT]</span></td></tr> | ||
</table> | </table> | ||
<div style="background-color:#fffaf0;"> | |||
== Publication Abstract from PubMed == | |||
Coaxial and orthogonal orientations of the helices (left and right illustration, respectively) in a quadruplex-duplex junction were realized by incorporating a duplex hairpin across the diverse geometries of a quadruplex. The modularity of the approach was validated through the simultaneous attachment of multiple duplex stems onto a G-quadruplex scaffold to generate a G-junction. | |||
Structural Basis of DNA Quadruplex-Duplex Junction Formation.,Lim KW, Phan AT Angew Chem Int Ed Engl. 2013 Jun 21. doi: 10.1002/anie.201302995. PMID:23794476<ref>PMID:23794476</ref> | |||
From MEDLINE®/PubMed®, a database of the U.S. National Library of Medicine.<br> | |||
</div> | |||
<div class="pdbe-citations 2m91" style="background-color:#fffaf0;"></div> | |||
== References == | |||
<references/> | |||
__TOC__ | __TOC__ | ||
</StructureSection> | </StructureSection> | ||
Revision as of 09:31, 14 June 2023
Structure of d[GGGAAGGGCGCGAAGCATTCGCGAGGTAGG] quadruplex-duplex hybrid
| ||||||||||||