User:Wayne Decatur/I-Ppo Morph Methods: Difference between revisions

From Proteopedia
Jump to navigationJump to search
Wayne Decatur (talk | contribs)
New page: Generated straight B-form DNA of homing site used in structure (TTGACTCTCTTAAGAGAGTCAA [extra 'A' at 3' end for getting two T's on both strands since you only enter text for one strand) us...
 
Wayne Decatur (talk | contribs)
No edit summary
Line 1: Line 1:
Generated straight B-form DNA of homing site used in structure (TTGACTCTCTTAAGAGAGTCAA [extra 'A' at 3' end for getting two T's on both strands since you only enter text for one strand) using Model It as described in [[Lac repressor morph methods]]. I deleted the two 'A's at the three prime end of both strand to get like in structure.
Generated straight B-form DNA of homing site used in structure (TTGACTCTCTTAAGAGAGTCAA [extra 'A' at 3' end for getting two T's on both strands since you only enter text for one strand) using Model It as described in [[Lac repressor morph methods]]. Editing text of the pdb file, I deleted the 'A' at the three prime end of each strand to generate like in structure.


In order to use with straight B-form DNA, I needed to get unremediated pdb file for 1a73 or
In order to use with straight B-form DNA, I needed to get unremediated pdb file for 1a73 or