4ihv | pdb_00004ihv

From Proteopedia
Revision as of 08:59, 2 January 2013 by OCA (talk | contribs) (Protected "4ihv" [edit=sysop:move=sysop])
Jump to navigationJump to search

Unreleased structure

The entry 4ihv is ON HOLD

Authors: Hancock, Stephen P., Cascio, Duilio, Johnson, Reid C.

Description: Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)

Proteopedia Page Contributors and Editors (what is this?)

OCA

Retrieved from "https://proteopedia.org/index.php?title=4ihv&oldid=1642462"