4ihv | pdb_00004ihv

From Proteopedia

Revision as of 07:50, 9 January 2013 by OCA (talk | contribs)

(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)

Jump to navigation Jump to search

Unreleased structure

The entry 4ihv is ON HOLD

Authors: Hancock, S.P., Cascio, D., Johnson, R.C.

Description: Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)

Proteopedia Page Contributors and Editors (what is this?)

Retrieved from "https://proteopedia.org/index.php?title=4ihv&oldid=1702063"

Navigation menu