4ihv | pdb_00004ihv

From Proteopedia
Revision as of 07:52, 2 May 2013 by OCA (talk | contribs)
Jump to navigationJump to search

Template:STRUCTURE 4ihv

Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)

Function

[C9QXL3_ECOD1] Activates ribosomal RNA transcription. Plays a direct role in upstream activation of rRNA promoters (By similarity).[HAMAP-Rule:MF_00166]

About this Structure

4ihv is a 4 chain structure with sequence from Escherichia coli k-12. Full crystallographic information is available from OCA.

Proteopedia Page Contributors and Editors (what is this?)

OCA