2m91 | pdb_00002m91

From Proteopedia
Revision as of 15:38, 10 July 2013 by OCA (talk | contribs)
Jump to navigationJump to search

Template:STRUCTURE 2m91

Structure of d[GGGAAGGGCGCGAAGCATTCGCGAGGTAGG] quadruplex-duplex hybrid

Template:ABSTRACT PUBMED 23794476

About this Structure

2m91 is a 1 chain structure. Full experimental information is available from OCA.

Reference

  1. Lim KW, Phan AT. Structural Basis of DNA Quadruplex-Duplex Junction Formation. Angew Chem Int Ed Engl. 2013 Jun 21. doi: 10.1002/anie.201302995. PMID:23794476 doi:10.1002/anie.201302995

Proteopedia Page Contributors and Editors (what is this?)

OCA

Retrieved from "https://proteopedia.org/index.php?title=2m91&oldid=1819357"