5ds9 | pdb_00005ds9

From Proteopedia
Revision as of 13:27, 30 September 2015 by OCA (talk | contribs) (New page: '''Unreleased structure''' The entry 5ds9 is ON HOLD until Paper Publication Authors: Hancock, S.P., Cascio, D., Johnson, R.C. Description: Crystal structure of Fis bound to 27bp DNA F...)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigationJump to search

Unreleased structure

The entry 5ds9 is ON HOLD until Paper Publication

Authors: Hancock, S.P., Cascio, D., Johnson, R.C.

Description: Crystal structure of Fis bound to 27bp DNA F1-8A (AAATTAGTTTGAATTTTGAGCTAATTT)

Proteopedia Page Contributors and Editors (what is this?)

OCA

Retrieved from "https://proteopedia.org/index.php?title=5ds9&oldid=2490260"