5ds9 | pdb_00005ds9

From Proteopedia

Revision as of 02:38, 16 October 2015 by OCA (talk | contribs)

(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)

Jump to navigation Jump to search

Unreleased structure

The entry 5ds9 is ON HOLD

Authors: Hancock, S.P., Cascio, D., Johnson, R.C.

Description: Crystal structure of Fis bound to 27bp DNA F1-8A (AAATTAGTTTGAATTTTGAGCTAATTT)

Proteopedia Page Contributors and Editors (what is this?)

Retrieved from "https://proteopedia.org/index.php?title=5ds9&oldid=2493844"

Navigation menu