5e3l | pdb_00005e3l

From Proteopedia
Revision as of 02:56, 16 October 2015 by OCA (talk | contribs) (New page: '''Unreleased structure''' The entry 5e3l is ON HOLD Authors: Hancock, S.P., Cascio, D., Johnson, R.C. Description: Crystal structure of Fis bound to 27bp DNA F1-8G (AAATTGGTTTGAATTTTG...)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigationJump to search

Unreleased structure

The entry 5e3l is ON HOLD

Authors: Hancock, S.P., Cascio, D., Johnson, R.C.

Description: Crystal structure of Fis bound to 27bp DNA F1-8G (AAATTGGTTTGAATTTTGAGCCAATTT)

Proteopedia Page Contributors and Editors (what is this?)

OCA

Retrieved from "https://proteopedia.org/index.php?title=5e3l&oldid=2493966"