5e3n | pdb_00005e3n

From Proteopedia

Revision as of 02:56, 16 October 2015 by OCA (talk | contribs) (Protected "5e3n" [edit=sysop:move=sysop])

(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)

Jump to navigation Jump to search

Unreleased structure

The entry 5e3n is ON HOLD

Authors: Hancock, S.P., Cascio, D., Johnson, R.C.

Description: Crystal structure of Fis bound to 27bp DNA F31 (AAATTTGTAGGAATTTTCTGCAAATTT)

Proteopedia Page Contributors and Editors (what is this?)

Retrieved from "https://proteopedia.org/index.php?title=5e3n&oldid=2493971"

Navigation menu