5j05 | pdb_00005j05

DIY G-Quadruplexes: Solution structure of d(GGGTTTGGGTTTTGGGAGGG) in sodium

spinqualitylabelsall models 5j05 Show:Asymmetric Unit Biological Assembly Drag the structure with the mouse to rotate   Export Animated Image   Print3D Structural highlights 5j05 is a 1 chain structure with sequence from Synthetic construct. Full experimental information is available from OCA. For a guided tour on the structure components use FirstGlance. Method: Solution NMR Resources: FirstGlance, OCA, PDBe, RCSB, PDBsum, ProSAT Publication Abstract from PubMed The main challenge in DNA quadruplex design is to encode a three-dimensional structure into the primary sequence, despite its multiple, repetitive guanine segments. We identify and detail structural elements describing all 14 feasible canonical quadruplex scaffolds and demonstrate their use in control of design. This work outlines a new roadmap for implementation of targeted design of quadruplexes for material, biotechnological, and therapeutic applications. Encoding canonical DNA quadruplex structure.,Dvorkin SA, Karsisiotis AI, Webba da Silva M Sci Adv. 2018 Aug 31;4(8):eaat3007. doi: 10.1126/sciadv.aat3007. eCollection 2018, Aug. PMID:30182059 From MEDLINE®/PubMed®, a database of the U.S. National Library of Medicine.

Proteopedia Page Contributors and Editors (what is this?)

OCA