9pz7 | pdb_00009pz7

From Proteopedia
Revision as of 04:54, 20 August 2025 by OCA (talk | contribs) (Protected "9pz7" [edit=sysop:move=sysop])
Jump to navigationJump to search

Unreleased structure

The entry 9pz7 is ON HOLD

Authors: Werther, R., Stoddard, B.L.

Description: Engineered variant of I-OnuI meganuclease to target DNA sequence TTTCCACTTATTCACTATTTTA

Proteopedia Page Contributors and Editors (what is this?)

OCA

Retrieved from "https://proteopedia.org/index.php?title=9pz7&oldid=4366182"