User:Wayne Decatur/I-Ppo Morph Methods

From Proteopedia
Jump to navigationJump to search

Generated straight B-form DNA of homing site used in structure (TTGACTCTCTTAAGAGAGTCAA [extra 'A' at 3' end for getting two T's on both strands since you only enter text for one strand) using Model It as described in Lac repressor morph methods. Editing text of the pdb file, I deleted the 'A' at the three prime end of each strand to generate ends like in the 1a73 structure.

In order to use with straight B-form DNA, I needed to get unremediated pdb file for 1a73 or completely alter the order and chain designations to match. I felt the unremediated file was the easiest route to go.

I loaded 1a73 structure into swiss-pdb viewer and let it magic fit the apo enzyme in 1evx. I disabled movement on those two structures and loaded the unbound DNA. When I had turned it so it was close, I enable movement on all and turned about 90 degress and then disabled movement again all all but the unbound DNA and moved it into plane with the other structures. I save each layer individually. I edited the aligned 1evx file to match atom numbers with the aligned 1a73 and removed the SO4s. I deleted the 2 MGs in the aligned 1a73 file.

Next, I needed to renumber the atoms in the unbound DNA to make it easy to compare to file 1a73 for matchin up number of atoms since morphing needs equal numbers. I also needed to change the chain ids from a and b to match c and d in 1a73. (At first, I thought Biopython would do this but after using the tutorial to install numpy and Biopython, I found at the help site for manipulating pdb files with Biopython and also the cookbookthat it doesn't concern itself with atom numbers that I could see and instead just parses all the other information like chain id and residue number to make that easy to work with. In fact I wrote a program with it to easily renumber residues and save file and learned it wasn't what I want - the program: <no wiki> from Bio.PDB.PDBParser import PDBParser

parser = PDBParser()

structure = parser.get_structure('test', 'test.pdb') header = parser.get_header() trailer = parser.get_trailer()

for model in structure:

   for chain in model:
       i = 2493
       for residue in chain:
           residue.id = (' ', i, ' ')
           i += 1

from Bio.PDB import PDBIO

w = PDBIO() w.set_structure(structure) w.save('test-r1.pdb')

</no wiki>

So I searched for something else thinking alhtough I could break it up and do it with a simple Python program it would be nice to find something to do it.)

I found PDB Goodies to take care of the chain renumbering. To get started, just a bit down the page I clicked the not overly obvious spot that said 'click here to see available options in PDB Goodies' to start and on the next page uploaded my pdb file. (Note on this page a link to <help> in the bottom right corner that does summarize what PDB Goodies does). And I chose 'Change Identifiers' and changed A and B to C and D easily using the form generated from my uploaded file and getting the results. (Note PDB goodies also renumbers residues numbers, generating a nice form using the file.)

Proteopedia Page Contributors and Editors (what is this?)

Wayne Decatur