3iv5 | pdb_00003iv5

From Proteopedia
Revision as of 06:08, 9 September 2009 by OCA (talk | contribs) (New page: '''Unreleased structure''' The entry 3iv5 is ON HOLD until sometime in the future Authors: Stella, Stefano, Cascio, Duilio, Johnson, Reid C. Description: Crystal structure of Fis bound...)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigationJump to search

Unreleased structure

The entry 3iv5 is ON HOLD until sometime in the future

Authors: Stella, Stefano, Cascio, Duilio, Johnson, Reid C.

Description: Crystal structure of Fis bound to 27bp consensus sequence DNA F1(AAATTTGTTTGAATTTTGAGCAAATTT)

Page seeded by OCA on Wed Sep 9 09:08:12 2009

Proteopedia Page Contributors and Editors (what is this?)

OCA

Retrieved from "https://proteopedia.org/index.php?title=3iv5&oldid=993888"