1qwb

NMR structure of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA hairpin containing the in vitro selected consensus sequence for nucleolin RBD12

spinqualitylabelsall models 1qwb Show:Asymmetric Unit Biological Assembly Drag the structure with the mouse to rotate   Export Animated Image   Print3D Structural highlights 1qwb is a 1 chain structure. Full experimental information is available from OCA. For a guided tour on the structure components use FirstGlance. Method: Solution NMR Resources: FirstGlance, OCA, PDBe, RCSB, PDBsum, ProSAT

Proteopedia Page Contributors and Editors (what is this?)

OCA