4ihv

From Proteopedia

Jump to: navigation, search

Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)

Structural highlights

4ihv is a 4 chain structure with sequence from Escherichia coli K-12. Full crystallographic information is available from OCA. For a guided tour on the structure components use FirstGlance.
Method:X-ray diffraction, Resolution 2.716Å
Resources:FirstGlance, OCA, PDBe, RCSB, PDBsum, ProSAT

Publication Abstract from PubMed

The width of the DNA minor groove varies with sequence and can be a major determinant of DNA shape recognition by proteins. For example, the minor groove within the center of the Fis-DNA complex narrows to about half the mean minor groove width of canonical B-form DNA to fit onto the protein surface. G/C base pairs within this segment, which is not contacted by the Fis protein, reduce binding affinities up to 2000-fold over A/T-rich sequences. We show here through multiple X-ray structures and binding properties of Fis-DNA complexes containing base analogs that the 2-amino group on guanine is the primary molecular determinant controlling minor groove widths. Molecular dynamics simulations of free-DNA targets with canonical and modified bases further demonstrate that sequence-dependent narrowing of minor groove widths is modulated almost entirely by the presence of purine 2-amino groups. We also provide evidence that protein-mediated phosphate neutralization facilitates minor groove compression and is particularly important for binding to non-optimally shaped DNA duplexes.

Control of DNA minor groove width and Fis protein binding by the purine 2-amino group.,Hancock SP, Ghane T, Cascio D, Rohs R, Di Felice R, Johnson RC Nucleic Acids Res. 2013 May 9. PMID:23661683[1]

From MEDLINE®/PubMed®, a database of the U.S. National Library of Medicine.

Loading citation details..
Citations
reviews cite this structure
No citations found

See Also

References

  1. Hancock SP, Ghane T, Cascio D, Rohs R, Di Felice R, Johnson RC. Control of DNA minor groove width and Fis protein binding by the purine 2-amino group. Nucleic Acids Res. 2013 May 9. PMID:23661683 doi:10.1093/nar/gkt357

Contents


PDB ID 4ihv

Drag the structure with the mouse to rotate

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools